ID: 900325659

View in Genome Browser
Species Human (GRCh38)
Location 1:2107624-2107646
Sequence GAGGGAGGATGAGCCCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 306}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900325647_900325659 11 Left 900325647 1:2107590-2107612 CCCTCAGACACCGAACCCCTGGA 0: 1
1: 0
2: 1
3: 9
4: 99
Right 900325659 1:2107624-2107646 GAGGGAGGATGAGCCCTGCGAGG 0: 1
1: 0
2: 1
3: 29
4: 306
900325650_900325659 1 Left 900325650 1:2107600-2107622 CCGAACCCCTGGAGGAAACACAG 0: 1
1: 0
2: 3
3: 18
4: 275
Right 900325659 1:2107624-2107646 GAGGGAGGATGAGCCCTGCGAGG 0: 1
1: 0
2: 1
3: 29
4: 306
900325648_900325659 10 Left 900325648 1:2107591-2107613 CCTCAGACACCGAACCCCTGGAG 0: 1
1: 0
2: 1
3: 12
4: 162
Right 900325659 1:2107624-2107646 GAGGGAGGATGAGCCCTGCGAGG 0: 1
1: 0
2: 1
3: 29
4: 306
900325655_900325659 -5 Left 900325655 1:2107606-2107628 CCCTGGAGGAAACACAGGGAGGG 0: 1
1: 0
2: 6
3: 44
4: 398
Right 900325659 1:2107624-2107646 GAGGGAGGATGAGCCCTGCGAGG 0: 1
1: 0
2: 1
3: 29
4: 306
900325653_900325659 -4 Left 900325653 1:2107605-2107627 CCCCTGGAGGAAACACAGGGAGG 0: 1
1: 0
2: 3
3: 25
4: 278
Right 900325659 1:2107624-2107646 GAGGGAGGATGAGCCCTGCGAGG 0: 1
1: 0
2: 1
3: 29
4: 306
900325657_900325659 -6 Left 900325657 1:2107607-2107629 CCTGGAGGAAACACAGGGAGGGA 0: 1
1: 0
2: 4
3: 46
4: 407
Right 900325659 1:2107624-2107646 GAGGGAGGATGAGCCCTGCGAGG 0: 1
1: 0
2: 1
3: 29
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900325659 Original CRISPR GAGGGAGGATGAGCCCTGCG AGG Intronic
900325659 1:2107624-2107646 GAGGGAGGATGAGCCCTGCGAGG + Intronic
900553482 1:3268482-3268504 GAGGGCAGACGGGCCCTGCGAGG + Intronic
900601118 1:3503066-3503088 GAGCCAGGATGTGCCCTGCCTGG + Intronic
900831002 1:4965218-4965240 GATGGAGGGTGAGCACTGCCTGG + Intergenic
900985702 1:6071881-6071903 GCGGCAGGAGGAGCCCTACGCGG - Intronic
902235186 1:15052946-15052968 GAGTGAGGAAGAGGCCTGGGTGG - Intronic
902427755 1:16337967-16337989 GAGGGAGGATTGGCCGGGCGCGG + Intronic
902974652 1:20080166-20080188 GAGGGAGGCTGTGCCCTGGAGGG + Intronic
903479821 1:23645072-23645094 CAGGGAGGAGGAGCCCTCCATGG - Intergenic
904057345 1:27680166-27680188 GAGGGAGGCTGTACCCTGCAAGG - Intergenic
905095983 1:35471206-35471228 TAGGGAGGATTGGCCCTGAGAGG - Intronic
905454590 1:38079386-38079408 GAGGGAGGATGGCCTCTTCGAGG + Intergenic
905693227 1:39957494-39957516 GAGGGAGAATGGGGCCTGCTGGG + Intronic
905871064 1:41404859-41404881 GAGGGAGGAGGGGCTCTTCGCGG + Intergenic
906069917 1:43008749-43008771 GAGGGAGGATGTGCAGGGCGTGG + Intergenic
907239632 1:53074346-53074368 GAGTGGGGATGACCCCTGAGAGG - Intronic
907405597 1:54251733-54251755 GAGGGAGGAGGAGCCCCTCCTGG + Intronic
908534628 1:65066675-65066697 GAGAGAGGGCGAGCCCCGCGCGG - Intergenic
908671966 1:66557965-66557987 GCTGGAGCATGAGCTCTGCGAGG + Intronic
909520834 1:76565788-76565810 GAGGGAGGATTAGCAGTGCAGGG - Intronic
911794526 1:102059044-102059066 TTGGGAGGATGTACCCTGCGAGG - Intergenic
914704882 1:150162450-150162472 GAGGGAGGAGAAGCACTGGGAGG - Intronic
914852580 1:151326187-151326209 GAGGGATGAACAGGCCTGCGTGG - Exonic
915117991 1:153612380-153612402 GAGGGATGATGAGATCTGGGAGG - Intronic
915512123 1:156392140-156392162 GAGGTAGGATGTGGCCTGCCAGG + Intergenic
917964221 1:180168285-180168307 GAGGGCTGAGGAGCCCAGCGAGG - Intronic
922271929 1:224043220-224043242 GAGGAAGGGAGAGCGCTGCGGGG - Intergenic
923126823 1:231040405-231040427 GAGGGAGGAGGAGACCCGGGTGG - Intergenic
923397564 1:233582219-233582241 GAGGGAGCAAGAGCCATGCCAGG + Intergenic
923461262 1:234211444-234211466 GAGGGAGGCTGTACCCTGCAAGG + Intronic
1062922290 10:1289470-1289492 GAGGGAGGAGGAGGCCTTCAGGG + Intronic
1064333997 10:14422134-14422156 GAGGGAGGAGCAGGCTTGCGGGG - Intronic
1064601691 10:17000047-17000069 GATGCAGGATTTGCCCTGCGAGG - Intronic
1065904986 10:30242373-30242395 GTGGGAGGATGAGCTCAGCCTGG + Intergenic
1066040715 10:31546000-31546022 GAGGGAGGCTGAACCCTGCAAGG - Intergenic
1066490680 10:35891167-35891189 GAGGTAGAATGAACCCTGGGAGG + Intergenic
1067769250 10:49111522-49111544 GAGGGAGGATCTGCCCTGCCTGG - Intronic
1068724457 10:60285699-60285721 GGGTGAGGATGAGCACTACGTGG - Intronic
1069622714 10:69847707-69847729 GAGGGATTAGGAGCCCTGGGAGG + Intronic
1069879331 10:71581833-71581855 GAGGAAGGATGAGGCCAGAGGGG - Intronic
1070846110 10:79523834-79523856 GAGGGAGCCTGGGCCCTGGGAGG + Intergenic
1070927688 10:80236476-80236498 GAGGGAGCCTGGGCCCTGGGAGG - Intergenic
1074896115 10:117778976-117778998 GGGGGAGAATGAGCCCTGCTGGG - Intergenic
1075663627 10:124215442-124215464 GAAGGAGTCTGAGCCCTGTGGGG + Intergenic
1075855059 10:125622842-125622864 GAGGCAGGAGGAGCCCAGAGTGG + Intronic
1075874563 10:125795612-125795634 GAGGGAGGCTGAGCCCATAGTGG - Intronic
1076143215 10:128096160-128096182 GAGGGAGGGAGAGCCGTGCTCGG - Intergenic
1076392050 10:130110649-130110671 GAGGGCGGATGGCCCCTGGGCGG - Intergenic
1076737982 10:132467213-132467235 CAGGGAGGCTCAGCCCTGTGAGG + Intergenic
1077030134 11:461811-461833 GAGGGAGCATGTGCCGTGCCTGG + Intronic
1077081213 11:725550-725572 GGGGGAGGAGCAGCCCAGCGAGG + Intronic
1077129813 11:965562-965584 GAGGTAGGAAGAGCCCAGAGGGG - Intronic
1077194353 11:1272008-1272030 GTGGGAGGCTCAGCCCTGCGCGG - Intergenic
1077295511 11:1824627-1824649 CAGGGAAGATGAGTCCTGCTGGG + Intergenic
1078528149 11:12116382-12116404 GAGGAAGGTTGAGCCCTCAGGGG + Intronic
1078672457 11:13377161-13377183 CAGGAAGGATGAGTCCAGCGTGG - Intronic
1079090486 11:17476908-17476930 GAGGGAGGGGGAGGCCAGCGGGG - Intergenic
1079181900 11:18201247-18201269 GAGGGAGGCTGTACCCTGCAAGG - Intronic
1083233134 11:61335738-61335760 GAGGAAAGATGAGCCCAGTGAGG - Intronic
1083254946 11:61490139-61490161 GAGGGAGGAGGAGCCATCTGAGG - Intronic
1083595185 11:63915659-63915681 GAGGGAGGATGTGGCGGGCGGGG + Intronic
1083757972 11:64801658-64801680 GAGGGAGGAGGAGGCCCTCGGGG - Intronic
1084726751 11:70946836-70946858 GAGGGAGGATGAGCCTGGGAAGG - Intronic
1088827509 11:113508108-113508130 GAGGGAGGTGGAGACCTGGGTGG + Intergenic
1089004677 11:115081534-115081556 CAGGGAGGATGAGGGCTGAGCGG - Intergenic
1089152343 11:116373681-116373703 AAGGCAGGAAGAGCCCTGCATGG + Intergenic
1089589095 11:119529190-119529212 GAGGGAGGCTGAGCAGTGGGTGG + Intergenic
1089800710 11:121024473-121024495 GAGGGAGGATGGGGCCTGCCTGG + Intronic
1090267029 11:125359695-125359717 GAGGGAGTACCAGCCCTGCCGGG + Intronic
1090778346 11:129984602-129984624 CAGGGAGGATGAGAGCTGTGGGG - Intronic
1091205662 11:133819112-133819134 GAGGGAGGAGCAGGCCTGCTGGG + Intergenic
1091705722 12:2691680-2691702 GAGGGAGGAGGAGGCCTCCAGGG + Intronic
1092149302 12:6236128-6236150 GAGGGAGGAGGTGCCCTGGGAGG + Intronic
1092219013 12:6700454-6700476 GAGGGATGGAGAGCCCTTCGGGG + Intronic
1096180789 12:49549365-49549387 GAGGACAGATGAGCCCAGCGTGG + Intronic
1096707080 12:53429100-53429122 GAGGGAGGAAGAGCCGGGCACGG + Intronic
1096882385 12:54683607-54683629 GTGGGAGGACGAGGCCTGAGAGG - Intergenic
1103904153 12:124318942-124318964 GAGGGAGAATTAGACCTGGGAGG - Intergenic
1104847127 12:131852234-131852256 GAGGGAGGGTGCTCCCTGCAAGG + Intergenic
1105964521 13:25372310-25372332 GAGGGAGGGTGGGCCCGGGGCGG + Intronic
1110889897 13:80686115-80686137 GAAGGAGGAAGGGCCCTGAGAGG - Intergenic
1112263119 13:97896231-97896253 GAGGGAGTATGAGCCTTCTGGGG + Intergenic
1113127822 13:106999959-106999981 GATGGAGGCTGAGGCCAGCGTGG - Intergenic
1114674811 14:24432642-24432664 GAGGGAGGATATGTCCTGAGGGG + Intronic
1115852015 14:37596173-37596195 GCGGGAGGAGGAGCCCGGCAGGG - Intronic
1117814490 14:59583025-59583047 GAAAGAGGATGAGGCCTGCCTGG + Intergenic
1117953760 14:61107284-61107306 CAGAGAAAATGAGCCCTGCGGGG - Intergenic
1121208402 14:92188175-92188197 AAGGCAGGAAGAGCCCTGGGAGG - Intergenic
1122658530 14:103279133-103279155 GAGGGAGGAAGGGTCCTGGGAGG - Intergenic
1122772170 14:104102406-104102428 GCAGGAGGAAGAGCCCTGTGCGG + Intronic
1122983606 14:105202370-105202392 CAGGGTGGCTGAGCCCTGTGGGG + Intergenic
1123506270 15:20942905-20942927 GAGGGAGTAGGAGAGCTGCGGGG + Intergenic
1123563496 15:21516609-21516631 GAGGGAGTAGGAGCGCTGCGGGG + Intergenic
1123599748 15:21953895-21953917 GAGGGAGTAGGAGCGCTGCGGGG + Intergenic
1124159431 15:27255176-27255198 GCCTGAGGATGAGCCCTGTGGGG - Intronic
1124270029 15:28271813-28271835 GAGGGAGGAGCAGGCGTGCGGGG - Intronic
1124819781 15:33033318-33033340 GAGCGAAGATGAGCCAGGCGTGG - Intronic
1129152213 15:73696292-73696314 CAGGCAGCATGAGGCCTGCGTGG + Intronic
1131217456 15:90550781-90550803 GAGGGGGCAGGAGCCCTGAGAGG - Intronic
1131261795 15:90891492-90891514 GAGGGGGCGTGAGCCCTGGGAGG - Intronic
1132238536 15:100239845-100239867 GAGGGATGGTGAGCCCTCTGGGG + Intronic
1202971854 15_KI270727v1_random:243746-243768 GAGGGAGTAGGAGCGCTGCGGGG + Intergenic
1132457983 16:34846-34868 GAGGCAGGAAGAGGCCTGGGAGG - Intergenic
1136006932 16:27337179-27337201 GAGGGAGGTGGAGCCCTGCTGGG + Intronic
1137787801 16:51152066-51152088 GAGGGAGGCCGAGCCGTGGGCGG - Intergenic
1139293316 16:65877229-65877251 GAGGGAGAATGAACCCTTCCAGG - Intergenic
1140406944 16:74717457-74717479 GAGGGAGGGAGAGCCCTGATTGG + Intronic
1140540834 16:75755095-75755117 TAGAGAGGATGAGCACTACGAGG + Intronic
1141276926 16:82596640-82596662 GAGGGAGTATCAACCCTGGGAGG + Intergenic
1141463402 16:84191530-84191552 GCGGCAGGCTGAGCCCTGCTGGG - Exonic
1142698654 17:1646848-1646870 GAGGGAGGAAGGGCCCTGGCTGG - Intronic
1143025932 17:3942035-3942057 GAGGCAGGCTGAGCCCTGCCTGG + Intronic
1143319527 17:6059251-6059273 CACCGAGGATGAGCCCTGGGGGG + Intronic
1144729761 17:17519620-17519642 GAGGAAGGATGACCCCTTCCAGG + Intronic
1145283561 17:21486872-21486894 GAGGGAGGAGGAGGCCTGGCTGG - Intergenic
1145816369 17:27797799-27797821 GAGGAAGGATGGGCCCGGGGAGG + Intronic
1146524031 17:33550692-33550714 GAGGTATGATGAGCCCAGAGTGG + Intronic
1146626205 17:34437392-34437414 CAGAGAGGATGAGCCCTGAGTGG + Intergenic
1148469253 17:47883369-47883391 GAGAGAGGATGTGACCTGGGTGG - Intergenic
1149435451 17:56629857-56629879 GAGGCAGGAAGAGCCCACCGGGG - Intergenic
1150353521 17:64464211-64464233 GAGGCAGGAGGAGGCCTGGGAGG - Intronic
1152029604 17:77833951-77833973 ATGGGAGGCTGAGCCCTGCATGG + Intergenic
1152392185 17:80009629-80009651 GAGGGAGGCTGAAGCCTCCGGGG + Intronic
1152494768 17:80663173-80663195 GAGGGTGGATGCACCCTGCGTGG - Intronic
1152519523 17:80847026-80847048 GAGGGAGGAGGCTCCCTGAGCGG + Intronic
1152558512 17:81066537-81066559 GAGGGAGGCCGACACCTGCGGGG - Intronic
1152937120 17:83145671-83145693 GAGGAAGGCTGGGCCCTGTGGGG + Intergenic
1152961976 18:85587-85609 GAGGCAGGAAGAGGCCTGGGAGG - Intergenic
1152997903 18:425348-425370 GATGAAGAATGAGCCCTGGGTGG - Intronic
1154132861 18:11751514-11751536 CAGGGAGGAGGATCCCTCCGAGG - Intronic
1154140680 18:11821875-11821897 GAGGGCGGATGTGCGCTGCAGGG - Intronic
1156502705 18:37569676-37569698 GAGGGAAGCTGAGCCCAGTGAGG - Intergenic
1157490698 18:48121771-48121793 GAGAGAGGCTGAGCACTGCGGGG + Intronic
1158602255 18:58864591-58864613 GAGGGGGGATGGGCCCTGAGGGG + Intronic
1158786659 18:60721307-60721329 GAGGGAGGCTGTACCCTGCAAGG - Intergenic
1160389821 18:78521648-78521670 GAGGGAGGAGGAGCTCTTCTGGG - Intergenic
1160432050 18:78819260-78819282 CAGGGAGGATGAGCCCCTGGAGG + Intergenic
1161299754 19:3537047-3537069 GAGGGAGGGTGGGCACTGCTGGG + Intronic
1161330288 19:3683705-3683727 GAGTGAGGAGGAGCCAGGCGGGG + Intronic
1161672135 19:5619244-5619266 GATGGAAGATGAGGCCTGCAGGG + Intronic
1161800447 19:6414564-6414586 ATGGGAGGCTGAGCCCGGCGGGG + Intronic
1162139710 19:8578427-8578449 GAGGGAGGTTGGGCCAGGCGTGG - Intergenic
1162576967 19:11505124-11505146 GGGGGAGGATGAGACCGGTGAGG + Intronic
1162747008 19:12804357-12804379 GAGGGAGGATGTGCGGTGCGGGG + Intronic
1163014602 19:14446601-14446623 GCTGGAGGCTGAGCCCTGCAAGG - Intronic
1163785503 19:19273021-19273043 GAGGGAGGATGCGCGGTCCGCGG - Intronic
1165311899 19:35033531-35033553 GGAGGAGGATGAGCGCTTCGAGG + Exonic
1165657616 19:37548399-37548421 GACGCAGGAAGAGCCCTGGGAGG + Intronic
1165720333 19:38074428-38074450 GAGGGAGGATTAGTCCTTTGAGG - Intronic
1166372176 19:42308045-42308067 GATGGAGGGTGAGCCGGGCGCGG - Intronic
1166728617 19:45044670-45044692 GAGGCAAGATGAGACCTGGGAGG + Intronic
1167505021 19:49866828-49866850 TAGGGAGGATGTTCACTGCGCGG - Intronic
1168064758 19:53912804-53912826 GAGGCAGGGGGCGCCCTGCGGGG - Exonic
1168076821 19:53985017-53985039 GAGAGAGGATGACAGCTGCGCGG + Exonic
1168486226 19:56764724-56764746 GAGGGAGGATGAGCTTTGAAAGG - Intergenic
925260800 2:2526783-2526805 GTGGGAGGATGGGCTCTGGGTGG - Intergenic
925424069 2:3734307-3734329 GAGGGAGGGTGGGCCCTTCCAGG - Intronic
927004205 2:18831038-18831060 GAGGTGGGATGAGCCCAGAGGGG + Intergenic
929229054 2:39540526-39540548 GAGGCAAGCTGAGCCCTGGGTGG + Intergenic
930105633 2:47637130-47637152 GAGGACAGATGAGCCCTGCTCGG - Intergenic
931434473 2:62234999-62235021 GAGGGAGCATCAGGCCTGCTGGG + Intergenic
931513318 2:63024053-63024075 GTGGGAGGATCAGCCAGGCGCGG + Intronic
932137756 2:69245435-69245457 GAGGGAGGAGGTGCCCTGTTGGG - Exonic
932340709 2:70961205-70961227 GTGGTAGGATGGGCCCTGGGTGG + Intronic
932572679 2:72946145-72946167 GAGGGAGGATGACCCAGGAGGGG - Intronic
933897340 2:86823912-86823934 GACTGAGGAGGAGCCCTGGGGGG + Intronic
934241093 2:90271304-90271326 CAGGGAGGCTGAGTCCTGCCAGG + Intergenic
934272085 2:91545382-91545404 CAGGGAGGCTGAGTCCTGCCAGG - Intergenic
934658710 2:96131856-96131878 GAGGCAGGAAGAGCCCCACGAGG - Intronic
934662950 2:96152875-96152897 CAGGGAGGAGGAGCCCTGGCAGG - Intergenic
934783100 2:96985451-96985473 GAGGGAGGATGAGGGAAGCGGGG - Intronic
935192713 2:100791811-100791833 GAAGGAGGATGAACAGTGCGTGG - Intergenic
937080734 2:119137810-119137832 GAGGAAGACTGAGGCCTGCGTGG - Intergenic
937318028 2:120944356-120944378 GAGGTAGGATGAGCCAAGCATGG - Intronic
941803544 2:169687626-169687648 GAGGGAGGCTGTACCCTGCAAGG - Intronic
942849031 2:180461236-180461258 GAGGGAAGATGAGCTCTGGGTGG - Intergenic
943305646 2:186258302-186258324 AAGGGAGGAGGAGCACTGCTAGG + Intergenic
946005331 2:216520093-216520115 GAGGGAGGCTGAGTGCTGCCAGG - Intronic
946356243 2:219187264-219187286 GAGGGAGAAGGAGGCCTTCGTGG - Intergenic
946480378 2:220050088-220050110 GAGGGAGAATCAGTCCTGAGAGG + Intergenic
947451448 2:230212598-230212620 GAGGGATTATGAGCACTGCCGGG - Intronic
947817543 2:233048292-233048314 GAGGGAGGGAGAGGCCTGCAGGG + Intergenic
948423765 2:237875691-237875713 CAGAGAGGCTGAGCCCTGCACGG - Intronic
948459625 2:238122830-238122852 GAGGTGGGCTGAGCCCTGCCTGG - Intronic
948698791 2:239747827-239747849 GAGAGAGAAGGAGCCTTGCGTGG - Intergenic
948757274 2:240166988-240167010 GAGGGAGGATGAAGCCAGAGGGG + Intergenic
1171255970 20:23689209-23689231 GATGGAGGAGGAGGCCTGGGAGG - Intergenic
1171263318 20:23751106-23751128 GATGGAGGAGGAGGCCTGGGAGG - Intronic
1171423124 20:25032237-25032259 GAGAGATGATGCGCCCTGAGTGG - Intronic
1171885464 20:30648855-30648877 GAGGGTGGTTGCCCCCTGCGTGG - Intergenic
1172520943 20:35565079-35565101 GAGTGAGGCTGGGCCCTGTGGGG - Intergenic
1172615685 20:36282232-36282254 GAGGGAGGCTGAGCCCCACCCGG + Intergenic
1173703583 20:45094168-45094190 GAAGGAGGATGAGTCCTGGGAGG - Exonic
1174349189 20:49954988-49955010 GAGGGAGGAAGAGGCCTCCCAGG - Intergenic
1174398857 20:50264952-50264974 GAGGAGGGATGAGGCCTGGGGGG + Intergenic
1174424129 20:50420074-50420096 GAGGGAGCGGGAGCCCTGGGAGG - Intergenic
1175143744 20:56880545-56880567 GAGAGAGGAAGAGTCCTGCAGGG + Intergenic
1175740154 20:61414427-61414449 GAGTCAGGGAGAGCCCTGCGTGG + Intronic
1176115719 20:63431091-63431113 AAGGGTGGATGGGCCCTGGGAGG + Intronic
1176182559 20:63757833-63757855 GAGGGAGTGTGAGCCCTGGACGG - Intronic
1176182568 20:63757863-63757885 GAGGGAGTGTGAGCCCTGGATGG - Intronic
1176182611 20:63758015-63758037 GAGGGAGTGTGAGCCCTGGATGG - Intronic
1176182636 20:63758105-63758127 GAGGGAGTGTGAGCCCTGGATGG - Intronic
1177008440 21:15702485-15702507 GAGGGAGGAGAAGGCCTGAGTGG + Intergenic
1178383971 21:32134657-32134679 AAGCGAGGAGGAGCCCTGGGAGG - Intergenic
1178619092 21:34158612-34158634 GAGGGTGGAGGGGCCCTGGGAGG + Intergenic
1180041465 21:45282384-45282406 GATGGAGGCTGAGCCCTGGACGG + Exonic
1180832319 22:18912487-18912509 GCCTGAGGAGGAGCCCTGCGGGG + Intronic
1181067523 22:20313855-20313877 GCCTGAGGAGGAGCCCTGCGGGG - Intergenic
1181082542 22:20424659-20424681 GAGGGGGGAGCAGCCCTGCTGGG + Exonic
1182677058 22:32047556-32047578 TTGGGAGGAAGAGCCCTGCCAGG + Intronic
1183987667 22:41578313-41578335 GAGGGAGGAAGAGCCTGGGGAGG + Intronic
1184470273 22:44692182-44692204 GTGGGAGGAGGAGCCCCGGGTGG - Intronic
1184470293 22:44692241-44692263 CCGGGAGGAGGAGCCCTGGGTGG - Intronic
1184470300 22:44692256-44692278 GTGGGAGGAGGAGCCCCGGGAGG - Intronic
1184470340 22:44692358-44692380 CCGGGAGGAGGAGCCCTGGGAGG - Intronic
1184470420 22:44692562-44692584 CCGGGAGGAGGAGCCCTGGGTGG - Intronic
1184686072 22:46096904-46096926 GTGGGATGCTGAGCCCTGAGTGG - Intronic
1184689085 22:46109351-46109373 GAGGTAGGAGGAGCCGTGGGAGG + Intronic
1184877484 22:47284657-47284679 GCGCCAGGCTGAGCCCTGCGTGG + Intergenic
1203282405 22_KI270734v1_random:137792-137814 GCCTGAGGAGGAGCCCTGCGGGG + Intergenic
949327972 3:2888457-2888479 TAGGGAGGATGTGCCGTGAGGGG + Intronic
950017959 3:9767610-9767632 GAGGGAGGCTGAGTCCAGGGTGG - Intronic
950362421 3:12459053-12459075 GAGGAAGGAACAGCCCTGCGGGG + Intergenic
950866790 3:16196129-16196151 GAAGGAGAAAGAGCCCTGCAGGG + Intronic
951803668 3:26623650-26623672 GAGGCAGGACGAGCACTGCTGGG - Intronic
954076844 3:48187960-48187982 GAGGGAGCGGGAGCTCTGCGAGG - Exonic
954862934 3:53705238-53705260 GTGGGAGGAGCAGCCCTGGGCGG + Intronic
955212407 3:56954459-56954481 GAGAGAGGAGGAACCCTGGGGGG - Intronic
958730308 3:97954070-97954092 GAGAGAGTATGAGCCCAGCCTGG + Intronic
958980083 3:100709882-100709904 GAGGGAGGACGAGGCCGGGGGGG + Intronic
959055368 3:101562361-101562383 AAGGGAGGCTGAGCCGGGCGCGG + Intronic
961743242 3:129046821-129046843 GGGGGAGGATGAGGCCTGGCCGG + Intergenic
962780446 3:138710093-138710115 GAGGGAGGCTGAGCCCAGGAGGG + Intronic
964978467 3:162647972-162647994 GAGGGAGGCTGTACCCTGCCAGG + Intergenic
966931464 3:184678359-184678381 GAGGGAGGAGGAGGCCAGCAGGG - Intronic
967551527 3:190800978-190801000 GAGGGAGGCTGTACCCTGCAAGG + Intergenic
967990480 3:195126677-195126699 GAAGGAGGAGGAGCCCTCCAGGG - Intronic
968808522 4:2789806-2789828 GAGGGAGGATGAGGCAGGCAGGG + Intergenic
968816148 4:2823001-2823023 CAGGGAGAAGGCGCCCTGCGGGG - Exonic
968966660 4:3772346-3772368 GGGGGAGGAGCAGCCCTGTGCGG + Intergenic
976718452 4:88148032-88148054 GAGGGAGCACAAGACCTGCGAGG + Intronic
982068249 4:151673218-151673240 GAGGGATGGTGAGTCCTGCCCGG + Intronic
984157603 4:176210654-176210676 GAGGGAAAATGAGCTCTGGGAGG + Intergenic
984714858 4:182916734-182916756 GAGGGAGGGGGAGCCATGGGGGG + Intronic
984946311 4:184971333-184971355 GAGTGAGGCTGAGCTCAGCGAGG - Intergenic
985559840 5:579458-579480 GATGGAGGCTGAGCTATGCGGGG + Intergenic
985576141 5:674332-674354 GGGGGAGGAGGAGCACTGGGGGG + Intronic
985764028 5:1767683-1767705 GAGGAAGGCTGATCCCTGGGAGG + Intergenic
992888309 5:81181035-81181057 GAGAGAGAATGGGCCCTGCCTGG + Intronic
994501983 5:100590576-100590598 GAGGGAGCTTGAACCCTGCATGG - Intergenic
997216191 5:132113090-132113112 GAGGGAGTTTGAGACCTGCCTGG + Intergenic
997725422 5:136116460-136116482 GAGGGAGAATGTGCCCTGCAAGG + Intergenic
998107712 5:139478780-139478802 GAGGCAGGCAGAGCCCTGAGAGG + Intronic
998648879 5:144094939-144094961 GAGGGAGAGTGGGCCCTGTGAGG - Intergenic
1002559441 5:180071688-180071710 GAGGGACGATGAGCTGCGCGGGG - Exonic
1003810112 6:9769794-9769816 GAGGAAGAAAGAGCCCTGCTAGG - Intronic
1004413247 6:15400875-15400897 GAGGGAGGAAGAGCGCAGTGAGG - Intronic
1006079952 6:31559303-31559325 GCTGGAGGAAGAGCCCTGTGGGG + Intergenic
1006392659 6:33767801-33767823 GAGGGTGGATGAGCCCTGGCTGG - Intergenic
1006612822 6:35305039-35305061 GAGGCAGGAAGAGCCCTCCTGGG - Intronic
1006983767 6:38164767-38164789 GAGGGAGGCTGAGGGCTCCGAGG - Intergenic
1007419888 6:41713046-41713068 GAGGGAGGGTGAAGTCTGCGGGG + Intronic
1007476846 6:42124709-42124731 GAGGGAGGACAAGCTCTGTGTGG - Intronic
1007725367 6:43912844-43912866 GAGGGTCGATGGGCCCTGCATGG - Intergenic
1013272845 6:108559546-108559568 GAGGGAGGAGGAGCCCAGCGGGG + Intergenic
1017000023 6:149990176-149990198 GGGGCAGAAGGAGCCCTGCGTGG + Intergenic
1018027653 6:159818434-159818456 GAGGGAGGGAGAGCCGTCCGAGG + Intronic
1019175274 6:170156440-170156462 CAGGGAGGCTGCGCCCTGCGGGG + Intergenic
1019180104 6:170181349-170181371 GAGGGAGGCTGTGCTCTGTGTGG - Intergenic
1019255237 7:45637-45659 GTAGGAGTGTGAGCCCTGCGAGG - Intergenic
1019575015 7:1733421-1733443 GAGGCAGGAGGAGCCCTGGGCGG + Intronic
1019587281 7:1812508-1812530 GAGGGAGGTTGATCCCTCAGAGG + Intergenic
1020140603 7:5609543-5609565 GAGGGACCCTGAGTCCTGCGGGG + Intergenic
1020612621 7:10419369-10419391 GAGGGAGGATAGGACCTGGGAGG - Intergenic
1020621407 7:10524147-10524169 GAGGGAGGAGGAGACCTGATGGG + Intergenic
1021240274 7:18192098-18192120 GAGGTAGGATGAACCCGGCCGGG + Intronic
1023382319 7:39622069-39622091 GAGTTAGGATGAGTCCTGGGAGG - Intergenic
1023892253 7:44401463-44401485 GAGGCAGGCAGAGCCCTGCACGG + Intronic
1024524372 7:50336224-50336246 GGGGGAGGAGGAGCCCTGCCTGG + Intronic
1025247012 7:57325164-57325186 GAGGGAGCAGGAGCCATGGGAGG + Intergenic
1026010142 7:66629505-66629527 GAGGGAGGGTGGGCCGTGGGAGG + Intronic
1029415551 7:100440997-100441019 GAGGCAGGAGGATCCCTGTGAGG + Intergenic
1031158241 7:118135737-118135759 GAGGGAGGCTGTACCCTGCAAGG + Intergenic
1032238280 7:130142302-130142324 GAGGAAGGCTGACCCCTGCGTGG + Intergenic
1032497957 7:132376879-132376901 GAGAGAGGATTAACCCTGCCTGG - Intronic
1033032411 7:137840081-137840103 GAGGAGGGATGAGCACTGCTTGG - Intronic
1033588050 7:142788757-142788779 GAGGGAGGATGAGCCAAGAAGGG - Intergenic
1034075495 7:148227209-148227231 GAGTGAAGATGAGGCCTGAGAGG + Intronic
1035300973 7:157896952-157896974 GAGGGAGGCTCTGCCCTGAGAGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036692901 8:10956039-10956061 GAAGAAGGCTGAGCCCTGAGAGG + Intronic
1038427297 8:27472090-27472112 GAGGGGTGATGAGCCCAGCGAGG + Intronic
1038433521 8:27518805-27518827 GAAGGAGGAGCAGCCCTGCCTGG - Intronic
1039471424 8:37815703-37815725 GAGGTAGGGTAAGCCCTGGGTGG + Intronic
1040450298 8:47539404-47539426 CAGGTAGGATGGGCCCTGTGTGG - Intronic
1041082439 8:54226472-54226494 GAGGGAGGTGGAGCCCTGGTTGG - Intergenic
1042011426 8:64249681-64249703 GAGGGAGGTTGGGCTCTGTGAGG - Intergenic
1045544980 8:103120389-103120411 GAGGGAGGAAGAGCACTAGGAGG + Intergenic
1047194973 8:122712959-122712981 GAGGGAGGCTGTACCCTGCAAGG + Intergenic
1048381597 8:133870398-133870420 GAGGGAGGATGGGGCCCGCATGG - Intergenic
1049064269 8:140300733-140300755 GAGGGAGGAAAAGCACTCCGAGG + Intronic
1049519857 8:143082580-143082602 GAGGGGCGCTGGGCCCTGCGAGG + Exonic
1049527301 8:143133857-143133879 GAGGGAGGCACAGCCCTGTGCGG + Intergenic
1049632679 8:143667063-143667085 GAGGGAGGGAGGGCCTTGCGGGG - Intergenic
1049697296 8:143990463-143990485 GAGAGCGGATGGGCCCTCCGCGG - Intronic
1049962168 9:747359-747381 GAGAGAGGTAGAGCCATGCGTGG + Intergenic
1050141926 9:2525030-2525052 AAGTGAGGATGAGACCTGCTGGG + Intergenic
1052883166 9:33618124-33618146 GAGGGAGGCTGAGCTCGGCCTGG + Intergenic
1052999833 9:34571816-34571838 GAGAGAGGAGGAGCTCTGAGTGG + Intronic
1053487599 9:38471604-38471626 GAGGGAGGATGAGCTCTCTAAGG + Intergenic
1055054122 9:72008028-72008050 CAGGGAGGAGGAGACCTGAGTGG + Intergenic
1056029894 9:82542334-82542356 GAGGGATGATGAGCCGTGCCTGG + Intergenic
1060294196 9:122332250-122332272 GAGGGAGGGTGAGCCAGGCCTGG + Intergenic
1061870104 9:133515904-133515926 CAGGGAGGAGGAGACATGCGAGG - Intronic
1061993632 9:134173367-134173389 GAGGGAGGCCGGGGCCTGCGCGG + Intergenic
1062726676 9:138078050-138078072 GAGGGAGCCCGAGCCCTGTGGGG - Intronic
1062736168 9:138138530-138138552 GAGGCAGGAAGAGGCCTGGGAGG + Intergenic
1187055408 X:15737949-15737971 GAGGGAGGATTGGTCCGGCGGGG + Intronic
1187977540 X:24718452-24718474 GAGGAAGGAGGAGGCCTGTGTGG + Intronic
1189973184 X:46438435-46438457 GTGGTAGGATGAGCCCTACCTGG + Intergenic
1190691338 X:52915828-52915850 GAGGGAGGAGGAGTCCTGCTGGG + Intergenic
1190694645 X:52939964-52939986 GAGGGAGGAGGAGTCCTGCTGGG - Intronic
1192722322 X:73712066-73712088 GAAGGAGGATGGGGCCTGAGAGG + Intergenic
1194177676 X:90671402-90671424 TAGGGAGGACTAGCCCTGCCAGG + Intergenic
1194277212 X:91900224-91900246 GAGGTAGGAGGAGCCCAGAGTGG + Intronic
1195444558 X:104937042-104937064 GAAGCAGGCTGAGCCCTGTGTGG - Intronic
1196224479 X:113149267-113149289 AAGGGAGGACCAGCCCTGCTGGG + Intergenic
1198383461 X:136105464-136105486 AAGGGAGGAGGAGCCCTGGAGGG + Intergenic
1199697258 X:150351595-150351617 GAGGCAGGGTGAGTCCTGGGAGG + Intergenic
1200149579 X:153944680-153944702 GGGGGAGGGTGAGCCGGGCGCGG - Exonic
1200524346 Y:4253551-4253573 TAGGGAGGACTAGCCCTGCCAGG + Intergenic
1200594555 Y:5122323-5122345 GAGGTAGGAGGAGCCCAGAGTGG + Intronic
1201771511 Y:17621017-17621039 GTTGGAGGATGAGGCCTGAGAGG + Intergenic
1201830044 Y:18284969-18284991 GTTGGAGGATGAGGCCTGAGAGG - Intergenic
1202176198 Y:22101098-22101120 AAGGCAGGATGAGACCTGCCAGG - Intergenic
1202215163 Y:22485286-22485308 AAGGCAGGATGAGACCTGCCAGG + Intergenic