ID: 900325720

View in Genome Browser
Species Human (GRCh38)
Location 1:2107843-2107865
Sequence CTCCCTCGACACTGCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 194}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900325720_900325735 17 Left 900325720 1:2107843-2107865 CCCCCAGGGCAGTGTCGAGGGAG 0: 1
1: 0
2: 0
3: 22
4: 194
Right 900325735 1:2107883-2107905 GTGTCCAGGGATTCCCCCCAGGG 0: 1
1: 1
2: 0
3: 9
4: 114
900325720_900325734 16 Left 900325720 1:2107843-2107865 CCCCCAGGGCAGTGTCGAGGGAG 0: 1
1: 0
2: 0
3: 22
4: 194
Right 900325734 1:2107882-2107904 AGTGTCCAGGGATTCCCCCCAGG 0: 1
1: 1
2: 0
3: 9
4: 123
900325720_900325738 27 Left 900325720 1:2107843-2107865 CCCCCAGGGCAGTGTCGAGGGAG 0: 1
1: 0
2: 0
3: 22
4: 194
Right 900325738 1:2107893-2107915 ATTCCCCCCAGGGCAGTGTCGGG 0: 1
1: 1
2: 0
3: 23
4: 172
900325720_900325737 26 Left 900325720 1:2107843-2107865 CCCCCAGGGCAGTGTCGAGGGAG 0: 1
1: 0
2: 0
3: 22
4: 194
Right 900325737 1:2107892-2107914 GATTCCCCCCAGGGCAGTGTCGG 0: 1
1: 1
2: 0
3: 6
4: 145
900325720_900325730 4 Left 900325720 1:2107843-2107865 CCCCCAGGGCAGTGTCGAGGGAG 0: 1
1: 0
2: 0
3: 22
4: 194
Right 900325730 1:2107870-2107892 CAACACCCCGGCAGTGTCCAGGG 0: 1
1: 0
2: 0
3: 41
4: 225
900325720_900325729 3 Left 900325720 1:2107843-2107865 CCCCCAGGGCAGTGTCGAGGGAG 0: 1
1: 0
2: 0
3: 22
4: 194
Right 900325729 1:2107869-2107891 CCAACACCCCGGCAGTGTCCAGG 0: 1
1: 0
2: 2
3: 42
4: 233
900325720_900325724 -8 Left 900325720 1:2107843-2107865 CCCCCAGGGCAGTGTCGAGGGAG 0: 1
1: 0
2: 0
3: 22
4: 194
Right 900325724 1:2107858-2107880 CGAGGGAGCCCCCAACACCCCGG 0: 1
1: 0
2: 0
3: 16
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900325720 Original CRISPR CTCCCTCGACACTGCCCTGG GGG (reversed) Intronic