ID: 900327055

View in Genome Browser
Species Human (GRCh38)
Location 1:2113546-2113568
Sequence ACCAGGGCCTTGAGTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900327048_900327055 1 Left 900327048 1:2113522-2113544 CCGATAGCCCCTTTGTCAGAGGC 0: 1
1: 0
2: 2
3: 13
4: 103
Right 900327055 1:2113546-2113568 ACCAGGGCCTTGAGTGAGCTGGG 0: 1
1: 0
2: 2
3: 27
4: 251
900327051_900327055 -7 Left 900327051 1:2113530-2113552 CCCTTTGTCAGAGGCGACCAGGG 0: 1
1: 0
2: 2
3: 4
4: 96
Right 900327055 1:2113546-2113568 ACCAGGGCCTTGAGTGAGCTGGG 0: 1
1: 0
2: 2
3: 27
4: 251
900327049_900327055 -6 Left 900327049 1:2113529-2113551 CCCCTTTGTCAGAGGCGACCAGG 0: 1
1: 0
2: 0
3: 13
4: 82
Right 900327055 1:2113546-2113568 ACCAGGGCCTTGAGTGAGCTGGG 0: 1
1: 0
2: 2
3: 27
4: 251
900327053_900327055 -8 Left 900327053 1:2113531-2113553 CCTTTGTCAGAGGCGACCAGGGC 0: 1
1: 0
2: 0
3: 8
4: 134
Right 900327055 1:2113546-2113568 ACCAGGGCCTTGAGTGAGCTGGG 0: 1
1: 0
2: 2
3: 27
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900327055 Original CRISPR ACCAGGGCCTTGAGTGAGCT GGG Intronic
900327055 1:2113546-2113568 ACCAGGGCCTTGAGTGAGCTGGG + Intronic
900950246 1:5854594-5854616 ACCAAGGTCTGAAGTGAGCTTGG - Intergenic
902658466 1:17885523-17885545 GCCAAGGCCTGGAGAGAGCTGGG - Intergenic
903261823 1:22135767-22135789 GCCTGGGCCTTGAGAGACCTAGG - Intronic
904475573 1:30762564-30762586 ACCAGGGCCAGGAGGGAGCCGGG - Intergenic
905572237 1:39014990-39015012 AGCAGGGCTCTGAGAGAGCTGGG + Intergenic
906361941 1:45168310-45168332 ACCAGGGCCTGTCGTGGGCTGGG + Intronic
907447778 1:54520000-54520022 ACCAGGGCCTGGGCTGAGCGAGG - Intergenic
908553052 1:65229208-65229230 CCAAGGGCCTTGAGTCTGCTTGG + Exonic
913492989 1:119399495-119399517 ACCAGGGCCTGTAGTGAGGTGGG - Intergenic
914222070 1:145690062-145690084 ACCAGCACCTTGGGAGAGCTAGG + Intronic
916428738 1:164707478-164707500 ACCAGGGCCTTGTATGAGACAGG - Intronic
916768778 1:167887531-167887553 ACCAGGGCCTGTCGTGGGCTGGG + Intronic
916808262 1:168281088-168281110 CCTATGGCCATGAGTGAGCTGGG + Exonic
917667414 1:177238582-177238604 ACAAGAGCCTTTTGTGAGCTGGG + Intronic
918545646 1:185680713-185680735 GCCAGGGCCTTGGCTCAGCTGGG - Intergenic
919251910 1:195066668-195066690 GCCAGGGCCTTAAGTGATATAGG + Intergenic
922788758 1:228297981-228298003 AGCAGGTCCTTGTGTGGGCTGGG + Intronic
922789421 1:228302900-228302922 AGCAGGGCCTTGTGTGGGCTGGG + Intronic
923328933 1:232904794-232904816 ACAAAGCCCTTGAGTGAGCATGG + Intergenic
1064414299 10:15135535-15135557 CCCATGGCCTTGACTGGGCTTGG - Intronic
1064947877 10:20812475-20812497 ACCAGGGCCTGTTGTGAGGTGGG - Intronic
1065074814 10:22066688-22066710 ACCAGGGCCTGTAGTGGGGTGGG + Intergenic
1066981178 10:42418100-42418122 CCCTGGGCCTTGAGTGAAATAGG - Intergenic
1067522238 10:47016679-47016701 AGCAGGGCCTTGAGACAGCTGGG + Intergenic
1068111572 10:52686596-52686618 ACCAGGGCCTGTAGTGGGGTGGG + Intergenic
1069491691 10:68866730-68866752 ACCAGGGCTGTGAGTGTGCCTGG - Intronic
1072245931 10:93543832-93543854 AACAAGGCCATGACTGAGCTAGG + Intergenic
1073295897 10:102438537-102438559 AACAGGGCCTGGAGTGAAATGGG + Intergenic
1075798434 10:125136892-125136914 CCCAGGGCCTTGAAAGAGCCGGG + Intronic
1075923869 10:126235254-126235276 ACCACGGCCTTGAGGGAGAGTGG + Intronic
1076168445 10:128300879-128300901 ATTAGGGCCTTGGATGAGCTGGG + Intergenic
1076712425 10:132345710-132345732 ACCAGGACCTGGAGACAGCTGGG + Intronic
1076837074 10:133026445-133026467 AGCAGGGCAGTGAGTGGGCTGGG - Intergenic
1077783810 11:5360976-5360998 ACCAGGGCCTGCAGTGGGGTGGG + Intronic
1077963946 11:7107063-7107085 ACCAGGGCCTGTCGTGAGGTGGG - Intergenic
1079552396 11:21715864-21715886 ACCAGGGCCTGGTGTGGGGTGGG - Intergenic
1080893360 11:36428238-36428260 GGCAGGGCCATGGGTGAGCTGGG + Intronic
1081814634 11:45931703-45931725 CCCAGGGCCTGGAGTGGGCTTGG + Intronic
1083891567 11:65598281-65598303 AGCGGGGCCTTGAGTGGGCCAGG - Exonic
1084198303 11:67538979-67539001 ACCAGGGCTCTGAGTGAGCCTGG + Intergenic
1084459169 11:69286732-69286754 AGCAGGACGTTGAGTGAGCCTGG - Intergenic
1084470051 11:69354089-69354111 CCCCGGGCCTTGAGTTATCTGGG - Intronic
1084641597 11:70429664-70429686 CCCAGGGGCTTGGGTGAGCGGGG - Intronic
1086030266 11:82346116-82346138 CCCAGGGCCTGGTGTGAGGTGGG + Intergenic
1087398424 11:97633123-97633145 ACCAGGGCCTGTCATGAGCTGGG - Intergenic
1088103522 11:106180434-106180456 ACCAGGGCCTGTCGTGAGGTGGG - Intergenic
1088399800 11:109410983-109411005 ACTATGGCCTTGAATGAGATGGG - Intergenic
1090244470 11:125206039-125206061 ACCGGGGCCTTGGTTGGGCTGGG + Intronic
1090393976 11:126407051-126407073 AGCAGGGCATGGAGCGAGCTGGG + Intronic
1090666737 11:128919304-128919326 ACCAGGGCCCTCCGTGAGCCAGG + Exonic
1090752611 11:129760484-129760506 CCCAGGGCCATCAGAGAGCTGGG - Intergenic
1092915611 12:13186493-13186515 CCCTGCACCTTGAGTGAGCTAGG - Intergenic
1092931987 12:13324628-13324650 ACCAGGGCCTGTTGTGAGGTGGG - Intergenic
1096230540 12:49894446-49894468 ATGAGGGCCTTGAGAAAGCTGGG + Intronic
1096784801 12:54010746-54010768 AGCAGGGCATTTAGTGAGCGAGG - Intronic
1103889422 12:124227705-124227727 ACCAGGGGCTTGGGTGGGCTGGG - Intronic
1105833910 13:24192131-24192153 CCCAGGGCCTTGTCTGAGCATGG - Intronic
1109807150 13:67457825-67457847 ACCAGGGCCTGGCGTGGGGTGGG + Intergenic
1110488138 13:76070319-76070341 CCCAGGCCCTTGAGTGCTCTAGG + Intergenic
1112963018 13:105151428-105151450 ACCAGGGCCTGTTGTGGGCTGGG + Intergenic
1116301286 14:43187249-43187271 ACCAAGGCCTTGTATTAGCTAGG + Intergenic
1119527401 14:75333643-75333665 ACCAGGGCCTTGGCAGAGCCAGG + Intergenic
1120320703 14:82956858-82956880 ACCAGGGCCTTTTGTGGGGTGGG - Intergenic
1124007804 15:25808836-25808858 AGCAGCTCCTTGAGTGAGGTGGG + Intronic
1126889499 15:53189048-53189070 ACCAGGGCCTTTTGTGGGGTGGG + Intergenic
1128694500 15:69750519-69750541 ACCAACAACTTGAGTGAGCTTGG - Intergenic
1128874962 15:71194388-71194410 ACCAAGGACTTGAGTGGGCTGGG - Intronic
1129034340 15:72640588-72640610 AGCAGGGCCCTGAGTGAGCATGG + Intergenic
1129110531 15:73334562-73334584 ACCAGGGGGTTGGGTGAGCTGGG - Intronic
1129215542 15:74096628-74096650 AGCAGGGCCCTGAGTGAGCATGG - Intergenic
1129391880 15:75224832-75224854 AGCAGGGCCCTGAGTGAGCATGG + Intergenic
1129472495 15:75763330-75763352 AGCAGGGCCCTGAATGAGCATGG - Intergenic
1129665189 15:77575687-77575709 GCCAGGGACCTGAGTGAGCAGGG - Intergenic
1129732679 15:77940957-77940979 AGCAGGGCCCTGAGTGAGCATGG - Intergenic
1131077152 15:89502527-89502549 ACCTGGGCCTTGCCTGAGGTGGG - Intergenic
1133446717 16:5867601-5867623 GCCAGGGCTTTGTCTGAGCTGGG - Intergenic
1136184953 16:28582288-28582310 GCCAGGGCCTTGGGAGAGATAGG + Intronic
1136659336 16:31742315-31742337 ACCAGGGCCTGGTGGGGGCTGGG - Intronic
1138448569 16:57079446-57079468 ACCAGGGTCTGGGGTAAGCTAGG - Intronic
1138541538 16:57690581-57690603 ACCTGGTCCTTGACTGGGCTTGG + Intergenic
1140781766 16:78303450-78303472 ACTAGGGAGTTGAGTGAGCTTGG + Intronic
1141174999 16:81712952-81712974 ACCAGGGCATAGAGAGAGGTGGG - Intergenic
1143540008 17:7563139-7563161 GCCTGGGACTTGAGTAAGCTGGG - Exonic
1144728849 17:17515272-17515294 AGCTGGGCCCTGAATGAGCTGGG - Intronic
1145251759 17:21300662-21300684 AGCAGGGCCTGGAGGCAGCTGGG + Intronic
1146297615 17:31661936-31661958 ACCAGGGCAATGGGTGAGGTGGG + Intergenic
1148067062 17:44879468-44879490 CCCAGAGCACTGAGTGAGCTGGG - Intronic
1148445704 17:47735660-47735682 ATCAGGGCCTTCAGAGAGCGTGG - Intronic
1149075633 17:52594348-52594370 CCCTGGGCCTTGAGTGAACATGG - Intergenic
1149255944 17:54826644-54826666 ACCAGGGCCTGTTGGGAGCTGGG + Intergenic
1149404886 17:56338288-56338310 ACCAGGGCCTGTAGTGGGGTGGG + Intronic
1150200652 17:63353649-63353671 CCCAGAGCCCTGGGTGAGCTGGG + Intronic
1152178911 17:78805766-78805788 GCGAGAGGCTTGAGTGAGCTCGG - Intronic
1152585663 17:81188402-81188424 ACCAGGGATGTGAGTGAGATGGG - Intergenic
1152809409 17:82374448-82374470 ACCAGGTCCTCCAGGGAGCTGGG - Exonic
1153099700 18:1452245-1452267 CCCAGGGCCTGGAGTGAACATGG + Intergenic
1155248781 18:23936392-23936414 ACCAGGGCCTGTAGTGGGGTGGG - Intronic
1156053677 18:32971178-32971200 ACCAGGGCCTGTAGTGGGGTGGG - Intronic
1157701601 18:49764363-49764385 ACCAGGGCCTGGAGTGGGGAGGG + Intergenic
1158104430 18:53869624-53869646 TTCAGGGACTTGAGAGAGCTGGG + Intergenic
1158330647 18:56358607-56358629 ACCATGGCCTTGCTTCAGCTAGG - Intergenic
1158811820 18:61046953-61046975 ACCAGGGCCTTTTGTGAGGTGGG - Intergenic
1159321794 18:66860643-66860665 ACCAGGGCCTGTCGTGAGGTGGG - Intergenic
1159884187 18:73888621-73888643 GCAAGGGCCTTGAGTGACCCTGG - Intergenic
1160944975 19:1637386-1637408 CCCAGGGCCTTGGGGGAGCGGGG - Intronic
1161617544 19:5280355-5280377 AGCAGAGCCTTGAGTGAGGGAGG - Intronic
1161622618 19:5306639-5306661 ACCATGGCATTGGGTGAGGTTGG - Intronic
1161983612 19:7642835-7642857 ACCAGCGCCTTTGGTGACCTGGG - Intronic
1162489698 19:10984830-10984852 AGCAGGGCCTTCAGTCAGCAAGG + Intronic
1164158546 19:22611349-22611371 ACCAGGGACTTGAGTTAGCTGGG - Intergenic
1164509884 19:28888592-28888614 ACGGGGGTCTTGCGTGAGCTGGG - Intergenic
1166255366 19:41600724-41600746 AACAGGGACTTGTGTGATCTTGG - Intronic
1166420484 19:42632528-42632550 AGCAGGGTCTTGTGTGATCTTGG + Intronic
1168288535 19:55346183-55346205 GCCAGGGCGCTGAGTGGGCTTGG + Intronic
925334847 2:3088350-3088372 ACCAGGGCCTGTTGTGAGGTGGG + Intergenic
928173605 2:29019522-29019544 ACCATGACCTTGAGTGATCTTGG - Intronic
929402621 2:41602933-41602955 ACCAGGGCCTGTTGTGGGCTGGG - Intergenic
930929915 2:56868858-56868880 ACCAGGGCCTTTCGGGAGGTTGG + Intergenic
931730640 2:65150259-65150281 ACCAGGGCCTAGAGGGAGGAGGG + Intergenic
933777673 2:85780738-85780760 GCCAGAGCCTTTAGTGAGCCAGG - Intronic
936069008 2:109353171-109353193 ATCAGGCCCTTGAGGGAGCAAGG - Intronic
936155748 2:110046558-110046580 ACCAGACCCTGGAGTGAGCTGGG - Intergenic
936188940 2:110324875-110324897 ACCAGACCCTGGAGTGAGCTGGG + Intergenic
936880348 2:117242991-117243013 ACCAGGGCCTTTAGTGGGGTAGG - Intergenic
936944942 2:117921684-117921706 ATCAGGGCCTCCAGAGAGCTGGG - Intronic
937075432 2:119101679-119101701 ACCAGGGCCTGTAGTGGGGTTGG + Intergenic
937436131 2:121883044-121883066 ACCAGGGCCTGTAGTGGGGTAGG + Intergenic
939206049 2:139105277-139105299 ACCAGGGCCTGTTGTGAGGTTGG - Intergenic
941164303 2:162068933-162068955 AACAGGCACATGAGTGAGCTTGG + Intronic
941225369 2:162840280-162840302 GCCTGTGCCTTGAGTCAGCTGGG + Intergenic
942094858 2:172527141-172527163 ACCAGGGCCTGTCGTGAGGTGGG - Intergenic
944185695 2:196945599-196945621 ACCAGGGCCTGTAGTGGGATGGG - Intergenic
944752644 2:202726771-202726793 ACCAGGGCCTGTTGTGGGCTGGG + Intronic
945279618 2:208023802-208023824 ACCAGGGCCTGGAGGGAGGCAGG - Intronic
945431039 2:209766045-209766067 ACCAGGGCCTGTTGTGAGGTGGG + Intergenic
945746000 2:213720172-213720194 ACCAGGGCCTTTCGGGGGCTGGG + Intronic
946152402 2:217785380-217785402 TCCAGGGCCTGGCTTGAGCTGGG + Intergenic
946200071 2:218066036-218066058 ATCAGGGCCTTGAGAGGGCCAGG + Intronic
946439278 2:219681384-219681406 ACCAGGGCCTTGAGCAAGCAGGG + Intergenic
946693481 2:222328388-222328410 ACCAGGGGCTGGGGGGAGCTGGG - Intergenic
948315932 2:237028427-237028449 ACCCGGGCCTTGTTTGACCTTGG - Intergenic
948484232 2:238270557-238270579 ACCTGGTCCTTGACTTAGCTGGG + Intronic
948867721 2:240783997-240784019 GGCAGGGCCTTGGGAGAGCTGGG - Intronic
1170042882 20:12056972-12056994 AGCAGCTCCATGAGTGAGCTTGG - Intergenic
1170103558 20:12728734-12728756 AACAGCCACTTGAGTGAGCTTGG - Intergenic
1171392373 20:24809804-24809826 ACCAGGGCCTGAAGGCAGCTTGG - Intergenic
1172566370 20:35933877-35933899 AACAGGGCCTTGAGTGGGGTAGG + Intronic
1174175128 20:48639792-48639814 ACCAGGGTCTTGATGGAGTTGGG + Exonic
1178734233 21:35134412-35134434 ACGAGGGCTTAGAGTGAGCCAGG + Intronic
1179005110 21:37507242-37507264 ATCAGGGCAATGAGTGGGCTTGG - Intronic
1179879886 21:44289037-44289059 ACCAGGGCCCTGGCTGTGCTTGG - Intronic
1179898758 21:44378037-44378059 CCCAGGGCCTGGAGTGAGTGGGG + Intronic
1181405067 22:22678546-22678568 ACCCGTGGCTTGAGTGAGGTGGG - Intergenic
1181408222 22:22700191-22700213 ACCCGTGGCTTGAGTGAGGTGGG - Intergenic
1181413539 22:22743503-22743525 ACCTGTGGCTTGAGTGAGGTGGG - Intronic
1181515427 22:23408703-23408725 GCCAGGGCCTGGGGTGAGATGGG + Intergenic
1182671928 22:32003462-32003484 ACCAGGGCCTGTAGTGGGGTGGG - Intergenic
1182703125 22:32256580-32256602 ACCAGGGCCTGGAGAGAGGGAGG - Intergenic
1182711927 22:32328564-32328586 ACCAGCCACCTGAGTGAGCTGGG + Intergenic
1183281611 22:36935505-36935527 AGCAGGGCCTGGAGGGAGCTGGG - Intronic
1184343295 22:43897970-43897992 ACCAGGTCCTGGAGTGAGTGGGG - Intergenic
1184815132 22:46863173-46863195 CCCAGGGCCTTGAGTCTGATGGG + Intronic
949589995 3:5484052-5484074 GCCAGGGCCTGGGGAGAGCTTGG + Intergenic
950140801 3:10613794-10613816 TCGAGGGTCTTGAGTGGGCTGGG - Intronic
952407340 3:33016180-33016202 AGGAGTGCCTTCAGTGAGCTTGG + Intronic
952673100 3:35994469-35994491 CTCAGGGCCTTGAGTGAACATGG + Intergenic
953428600 3:42817720-42817742 ACCAGTGGGTTGAGAGAGCTGGG - Intronic
953718660 3:45336660-45336682 CTCAGAGCCTTGAGAGAGCTGGG + Intergenic
954573901 3:51664175-51664197 ACCAGGGACTTGAGTTAGCTGGG - Exonic
954612297 3:51951985-51952007 ACCAGAGCCTGGAGAGAGCTCGG - Intergenic
954943213 3:54393778-54393800 AACAGGGCGTTGGTTGAGCTGGG + Intronic
955966400 3:64393435-64393457 CCCATGGCCATGGGTGAGCTCGG + Intronic
957122804 3:76117981-76118003 ACCAGGGCCTGTAGTGGGGTGGG + Intronic
958043016 3:88248630-88248652 TCCAGGGCCAGGAGTGAGCTTGG + Intergenic
959926852 3:111931823-111931845 ACAAAGGCCTTGAGCGAGTTAGG + Intronic
961009748 3:123427647-123427669 CCCAGTTCCTTGTGTGAGCTTGG + Intronic
961067022 3:123884285-123884307 AGCAGGGCGCTGAGCGAGCTCGG - Intronic
961470381 3:127107609-127107631 CCCAGGGTCTTGGGTGAGCAGGG + Intergenic
962206221 3:133436760-133436782 ACCAGGGCCTGTAGTGGGGTGGG - Intronic
962830094 3:139131991-139132013 AGCAGGGCCTTTAGGGAGTTGGG + Intronic
963997420 3:151725937-151725959 ACCAGGGCCTGGGGAGAGGTTGG - Intergenic
965526083 3:169719777-169719799 ACCAGGGCCTGTTGTGAGGTGGG - Intergenic
967456007 3:189687195-189687217 ACCATGGACTTGAATGATCTGGG - Intronic
968691716 4:1993688-1993710 ACCAGCGCCTTAATTGATCTTGG - Intronic
969334704 4:6500836-6500858 TGCAGGGCCCTGAGGGAGCTGGG + Intronic
972856614 4:43114548-43114570 ACTAAGGCCTTGAGTGAGGTAGG + Intergenic
973949439 4:55996468-55996490 ACCAGAGCCCTGAGTGAGGATGG + Intronic
974089390 4:57295568-57295590 ACCAGGGCCTGTGGTGAGGTGGG - Intergenic
976964647 4:91022156-91022178 ACCAGGGCCTGGTGTGGGGTGGG - Intronic
977632388 4:99257613-99257635 ACCAGGGCCTGGCATGAGGTGGG - Intergenic
982027304 4:151263659-151263681 AACAGGCACATGAGTGAGCTTGG - Intronic
982620467 4:157697256-157697278 ACCAGGGCCTGTTGTGAGGTGGG + Intergenic
982848332 4:160278457-160278479 ACCAGGGCCTGTAGTGGGGTAGG - Intergenic
982924420 4:161318182-161318204 ACCAGGGCCTGTTGTGAGGTGGG - Intergenic
983706303 4:170664501-170664523 ACCAGGGCCTGTTGTGAGGTGGG - Intergenic
985686641 5:1284918-1284940 ACCAGGCCCTGCGGTGAGCTGGG - Intronic
990697296 5:58434415-58434437 ACCAGTGACTTGATTGATCTTGG + Intergenic
991272694 5:64803736-64803758 CATAGGGCCTTGAGTGAGTTGGG + Intronic
993257072 5:85605172-85605194 ACCATAGCTTTGAGTGCGCTAGG - Intergenic
993270576 5:85791062-85791084 ACCAGGGCCTGTAGTGGGGTAGG - Intergenic
994310682 5:98267029-98267051 ACCAGGGCCTGTTGGGAGCTGGG + Intergenic
995108855 5:108405520-108405542 ACCAGGGCCTGTTGTGGGCTGGG + Intergenic
996104460 5:119482980-119483002 ACCAGAGCCTTGTCTGACCTAGG - Intronic
996335200 5:122376722-122376744 ACCAGGAACTTGAGTGAAATTGG - Intronic
997981644 5:138471090-138471112 TCCTGGGCCTAGAGTGAGATGGG - Intergenic
1003445795 6:6183005-6183027 AGCAGAGCCTTGGGAGAGCTTGG - Intronic
1004349994 6:14882629-14882651 ACCAAGGCATTGAGTGGGCCTGG + Intergenic
1005735124 6:28738532-28738554 CCCAGGGCCTAGAGAAAGCTTGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006387695 6:33740553-33740575 AGCAGGGCCGTGAGTGGGTTTGG + Intronic
1006401631 6:33821186-33821208 ACCCAGGCCCTGAGTGGGCTTGG + Intergenic
1006589997 6:35147979-35148001 ACCAGGGTCTGGAGGGAGCAAGG - Intronic
1006795797 6:36731655-36731677 ACCAGGTCCTGGAGGGATCTGGG - Intronic
1008037572 6:46761937-46761959 ACCAGGGCCTGTTGTGAGGTGGG - Intergenic
1008133495 6:47745278-47745300 ACCAGGGCCTGTAGTGGGGTGGG - Intergenic
1009643558 6:66368399-66368421 ACCAGGGCCTGTTGTGAGGTGGG + Intergenic
1014760688 6:125353514-125353536 ACAGAGGCCTTTAGTGAGCTTGG + Intergenic
1016781651 6:147965773-147965795 ACCAGGGCCTGTAGGGGGCTGGG + Intergenic
1018293533 6:162318076-162318098 ACCAGGGCCTGGAGAGGGGTAGG - Intronic
1018766921 6:166941291-166941313 GCAAAGGCCTTCAGTGAGCTGGG - Intronic
1022356926 7:29624549-29624571 AGCAGTGCCTGGATTGAGCTTGG - Intergenic
1023074594 7:36470545-36470567 ACCAACAACTTGAGTGAGCTTGG - Intergenic
1024487408 7:49933888-49933910 ACCAGGGCCTGTTGTGGGCTGGG + Intronic
1024956595 7:54927221-54927243 CCTAGGTCCTTGAGTGAACTAGG + Intergenic
1027867153 7:83662709-83662731 ACCAGCGACTTGAGTAAGCTTGG - Intergenic
1029808565 7:103022316-103022338 ACCAGGGCCTGTAGTGGGGTGGG + Intronic
1030851387 7:114490660-114490682 ACCAGGGCCTGTTGTGAGGTGGG - Intronic
1033054903 7:138042042-138042064 ACCAGGGCCTTTCGTGGGGTGGG + Intronic
1033228529 7:139579468-139579490 ACCAGGCCCTTGATTGAATTCGG + Intronic
1037414165 8:18630946-18630968 ATCAGGGACTTGAGTGTCCTTGG + Intronic
1037648510 8:20815648-20815670 AACAGCCACTTGAGTGAGCTTGG + Intergenic
1038011819 8:23481974-23481996 CTGAGGGCCATGAGTGAGCTGGG + Intergenic
1039045344 8:33444441-33444463 ACTAGGGACTTGAATGAGGTGGG + Intronic
1040511416 8:48099706-48099728 CCCAGGGCCTTGAGAAAGCATGG - Intergenic
1040709729 8:50173992-50174014 ACCAGGGCCTTTTGGGAGTTGGG - Intronic
1041748755 8:61236674-61236696 CCCAGGGCCTAGATTCAGCTGGG + Intronic
1042638075 8:70900814-70900836 ACCAGGGCCTGTAGTGGGGTCGG - Intergenic
1044870850 8:96618509-96618531 ACCAGGGCCTTGGGGGATCTGGG + Intergenic
1045849629 8:106678090-106678112 AACAGGGACTTGGGTTAGCTGGG + Intronic
1047435842 8:124834918-124834940 ACCAAGGCCTGGAGGGGGCTGGG - Intergenic
1048098896 8:131325406-131325428 ACCAGGGCCTGTTGTGAGGTTGG + Intergenic
1049696517 8:143986639-143986661 ACCAGGGGCTGGAGTGGGCCAGG - Intronic
1050254422 9:3779268-3779290 ACTTGAGTCTTGAGTGAGCTTGG - Intergenic
1050307717 9:4322033-4322055 ACCAGGGCCTGTCGTGGGCTCGG - Intronic
1050643663 9:7695304-7695326 ACCACAGCCTTGAGTAAGCATGG - Intergenic
1050914992 9:11120919-11120941 ACCAGGGCCTGTAGTGGGGTGGG - Intergenic
1051992166 9:23164060-23164082 CCTAGGGCCTTGAGTGAACATGG + Intergenic
1052685325 9:31748204-31748226 ACCAGGGCCTGTAGTGGGGTCGG + Intergenic
1052894165 9:33731759-33731781 CCCAGGGCCATCAGGGAGCTGGG - Intergenic
1054743074 9:68828104-68828126 ACCAGGGCCTTGACTGTCATGGG + Intronic
1055989565 9:82091168-82091190 ACTAAGGTCATGAGTGAGCTTGG - Intergenic
1056615282 9:88160238-88160260 AGCAGGGGCTGGAGGGAGCTGGG - Intergenic
1058090588 9:100801512-100801534 ACCAGGGCCTGTTGTGAGGTGGG + Intergenic
1058251100 9:102696905-102696927 ACCAGGGCCTTTTGTGGGGTGGG + Intergenic
1060995505 9:127873216-127873238 AGCAGGGATGTGAGTGAGCTCGG + Intronic
1062015704 9:134290133-134290155 ACCATGGACTTGAGGGAGTTTGG + Intergenic
1062388507 9:136324782-136324804 AGCAGGGCCCTGTGTGTGCTGGG + Intergenic
1185906949 X:3943295-3943317 AACAAGGTCTTGAGTCAGCTAGG + Intergenic
1187328291 X:18312326-18312348 ATCAGGGACTTGAGTGTCCTTGG - Intronic
1189013340 X:37070141-37070163 CCTAGGGCCTTGAGTGAACATGG - Intergenic
1190622119 X:52297756-52297778 ACCAGGGCCTTTTGTGGGGTGGG + Intergenic
1190908305 X:54749823-54749845 ACCAGGGCATGGGGTGAGCCAGG - Exonic
1191625811 X:63269909-63269931 ACCAGGGCCTGTTGTGAGGTGGG + Intergenic
1192082860 X:68064978-68065000 ACCAGGGCCTGTTGTGAGGTGGG + Intronic
1193697171 X:84723585-84723607 ATCAGGGCCTTGAGTGACATAGG - Intergenic
1194069616 X:89305087-89305109 ACTAGGGCCTTTTGGGAGCTGGG - Intergenic
1194285600 X:92007118-92007140 ACCAGGGCCTTGAGCAAACATGG - Intronic
1194534981 X:95094978-95095000 ACCAGGGGCTATAGTGAGCATGG - Intergenic
1195094952 X:101493436-101493458 GCCAGGTCCTTGGGGGAGCTAGG + Exonic
1196399460 X:115299301-115299323 TTCAGGGCCTTGAGCAAGCTGGG - Intronic
1196493613 X:116297470-116297492 TCCAGGGCCTTTACTGAGCAGGG - Intergenic
1196945268 X:120818137-120818159 ACCAGGGCCTGTCGTGAGGTGGG + Intergenic
1197775795 X:130117990-130118012 TGCAGGCCCTTGAGTGTGCTGGG + Intergenic
1197878187 X:131133998-131134020 ACCAGGGCCTGTTGTGAGGTGGG - Intergenic
1199347767 X:146761589-146761611 ACCAGGGGCTTCAGTGGGCATGG - Intergenic
1200441215 Y:3214458-3214480 ACCAGGGCCTGTAGTGGGGTTGG + Intergenic
1200574739 Y:4874311-4874333 ACCAGGGCCTTTTGTGGGGTAGG + Intergenic
1201344843 Y:12971640-12971662 ACCAGGGCCTTTTGTGGGGTGGG - Intergenic
1201460031 Y:14212205-14212227 ACCAGGGCCTTTCGTGGGGTGGG + Intergenic
1201551915 Y:15226621-15226643 ACCAGGGCCTATAGTGGGGTGGG + Intergenic