ID: 900329460

View in Genome Browser
Species Human (GRCh38)
Location 1:2126807-2126829
Sequence TGCCACAATGCAGTGGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900329460_900329468 4 Left 900329460 1:2126807-2126829 CCCCATGCCACTGCATTGTGGCA 0: 1
1: 0
2: 3
3: 21
4: 121
Right 900329468 1:2126834-2126856 CACGGCCGCCCATCCCTCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 308
900329460_900329467 3 Left 900329460 1:2126807-2126829 CCCCATGCCACTGCATTGTGGCA 0: 1
1: 0
2: 3
3: 21
4: 121
Right 900329467 1:2126833-2126855 ACACGGCCGCCCATCCCTCCTGG 0: 1
1: 0
2: 2
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900329460 Original CRISPR TGCCACAATGCAGTGGCATG GGG (reversed) Intronic
900329460 1:2126807-2126829 TGCCACAATGCAGTGGCATGGGG - Intronic
903036987 1:20499352-20499374 TGCCACAATGGAGTGAAAGGTGG - Intergenic
904562115 1:31405826-31405848 TGCCAAAATGCACTGGCTTTGGG + Intergenic
908722903 1:67145518-67145540 AGCAACAATGCAATGGTATGAGG - Intronic
909316971 1:74234029-74234051 TGCTATACTGCAGTGGCATCTGG - Intronic
918398965 1:184144664-184144686 TGCCACCAGGGACTGGCATGGGG + Intergenic
919973101 1:202593338-202593360 TGCCTCCATGCAGTGGGGTGGGG - Exonic
924494782 1:244576240-244576262 TGCCTCACTGCAGTGGCCTCAGG - Intronic
1069279478 10:66637376-66637398 TGCAACCATGTAGTGCCATGTGG - Intronic
1069716103 10:70522515-70522537 CGCCACATTGCAGTGGGATCTGG - Intronic
1069730750 10:70610659-70610681 AGCCAAAATGCAGTCACATGTGG + Intergenic
1071710888 10:88048056-88048078 TGCCATAAACCAGGGGCATGAGG + Intergenic
1072307507 10:94121648-94121670 TGCCACCATCCAGTAGCATGGGG - Intronic
1072799794 10:98384998-98385020 AGCCAGAATGCAGGGGCACGGGG + Exonic
1075600626 10:123766001-123766023 TGCCAGAATTCAGTTGCATGTGG - Intronic
1077702430 11:4454673-4454695 TGCCTCATTGCAGTGGCCTCAGG + Intergenic
1083205651 11:61147232-61147254 TGCCACAATGCACTGAAAGGAGG + Intronic
1085031790 11:73275600-73275622 GGCCACAATGCGAAGGCATGAGG - Intronic
1085403591 11:76248660-76248682 TGCTACACAGCAGTGGCATATGG + Intergenic
1085615463 11:77994751-77994773 TCCCACAAGGCAGTGGGATTTGG + Intergenic
1086986898 11:93260971-93260993 TGCCTCATTGCAGTGGCCTCAGG + Intergenic
1091440062 12:505666-505688 TGCCACACTTCATTGTCATGGGG + Intronic
1092118153 12:6024236-6024258 TGCCTCACTGCAGTGCTATGGGG + Intronic
1092532061 12:9353004-9353026 TGCCACACTGCTGGGGCAGGAGG - Intergenic
1096168483 12:49446468-49446490 TGGCAGAATGCAGTTCCATGTGG + Intronic
1100957666 12:99926877-99926899 TTCCACAAGGTAGTAGCATGGGG - Intronic
1103078570 12:118005182-118005204 TGATACAATGCAGTGGTATCTGG + Intergenic
1108475788 13:50816100-50816122 TGCCACAATTACGTGGAATGTGG - Intronic
1108475818 13:50816540-50816562 TGCCACAATTCTGTGGAATGTGG + Intronic
1115453396 14:33574483-33574505 GGCCAAAATGCAGTGGCTTGCGG + Intronic
1117907598 14:60606323-60606345 TGCAACAAGCCAGTGGCATGGGG - Intergenic
1119124370 14:72112025-72112047 AGCCAGAATCCATTGGCATGCGG + Intronic
1123157493 14:106242710-106242732 TGCCACACTGCATTTGGATGAGG + Intergenic
1123720986 15:23061792-23061814 TGCCACAAAGCTGTGGCACCTGG + Intergenic
1127158012 15:56149820-56149842 TGCCATACCCCAGTGGCATGTGG + Intronic
1127878543 15:63134327-63134349 CACCAAAATGCAGTGGCGTGAGG + Intronic
1128494225 15:68183122-68183144 TGACAGACTGCAGTGGCATGAGG - Intronic
1132989118 16:2784116-2784138 TGCCAGAATCCAGTGCCTTGCGG + Exonic
1134330821 16:13249780-13249802 AGCTAGAGTGCAGTGGCATGTGG + Intergenic
1134563658 16:15232234-15232256 GGCTACAATGCAGTGGCATGAGG + Intergenic
1137052101 16:35723097-35723119 TGCCTCATTGCAGTGGCCTCAGG - Intergenic
1137876286 16:51999531-51999553 GGCCACAAGGCTGGGGCATGAGG - Intergenic
1138188134 16:54992500-54992522 AGCAACAGTGCCGTGGCATGAGG - Intergenic
1138327210 16:56184655-56184677 TGCCATCATGCAGAGGCATATGG - Intergenic
1140308118 16:73822715-73822737 TGACACAATGATGTGGCATGAGG + Intergenic
1145282366 17:21477444-21477466 AGCACCAATGCAGTGGCAAGAGG + Intergenic
1145395106 17:22488312-22488334 AGCATCAATGCAGTGGCAGGAGG - Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1148148921 17:45384720-45384742 CCCCACAATGCATGGGCATGTGG - Intergenic
1149358977 17:55873116-55873138 TTACCCAATGTAGTGGCATGAGG + Intergenic
1149467895 17:56893921-56893943 GGTCAGAATGCAGTGGCACGAGG + Intronic
1151449798 17:74191576-74191598 TGCCAAAATGCAGAGGCACTTGG - Intergenic
1156300521 18:35832465-35832487 TGCCTCATTGCAGTGGCCTCAGG + Intergenic
1156545076 18:37956268-37956290 TGCCACAAAGGAGTGGCTGGAGG - Intergenic
1156555605 18:38064448-38064470 TGCCTCAATGCAGTGGTTTCTGG + Intergenic
1160614719 18:80116281-80116303 TGCCCCAATGCAGGGGCATTTGG + Intronic
1160937340 19:1603110-1603132 TGCCACCAGGCAGTGGCTTTGGG - Intronic
1163976509 19:20858218-20858240 TGCCTCATTGCAGTGGCCTCAGG + Intronic
1165848397 19:38834029-38834051 TGCTGGAGTGCAGTGGCATGAGG - Intronic
926128325 2:10285365-10285387 TGCAACTCTGCAGAGGCATGAGG + Intergenic
926702824 2:15815210-15815232 TGACACAATGAAGTGGGAAGAGG + Intergenic
928771532 2:34707637-34707659 TTCAACAATGGAATGGCATGTGG - Intergenic
928924246 2:36561376-36561398 TGCACCAAGGCAGTGGCAGGTGG - Intronic
930479625 2:51930526-51930548 TGCCACAATGCAAGGTGATGGGG + Intergenic
932551897 2:72779599-72779621 TGCCAGAGAGCATTGGCATGGGG - Intronic
932747141 2:74343353-74343375 TACCCCAGTGCAGTGGCCTGTGG + Intronic
936020043 2:108988024-108988046 AGCCACAGAGCAGTGGCCTGGGG + Intronic
941841189 2:170086510-170086532 TGACAGAATGCAGTAACATGAGG + Intergenic
946096063 2:217274859-217274881 TGCCACAATATGGTGGCTTGTGG - Intergenic
947353494 2:229270689-229270711 TGACACAATGCAGTGGTCTGGGG - Intronic
1169875729 20:10295129-10295151 TGTCACAACGCAGTGGCTGGTGG + Intronic
1173046399 20:39516931-39516953 TGCCACAAGACAGTGGTAAGAGG - Intergenic
1174565462 20:51461469-51461491 TGCCAGAATCCAGGGGCAGGAGG - Intronic
1175488511 20:59363069-59363091 TACCACAAAGCAGTGGGGTGAGG + Intergenic
1177852602 21:26366417-26366439 ACTCAAAATGCAGTGGCATGGGG - Intergenic
1178045580 21:28690324-28690346 TGCCACAATTCAGTTTCTTGAGG - Intergenic
1179813152 21:43885042-43885064 TGCTTCAATGCAGTGACGTGCGG + Intronic
1180569585 22:16702653-16702675 TGCCTCACTGCAGTGCTATGGGG + Intergenic
1180994705 22:19959732-19959754 GGCCACAATGCAGTGCCTGGGGG - Intronic
949875944 3:8626195-8626217 TGTCTCAATGCTGTGGCATGCGG - Intronic
950595070 3:13972712-13972734 TGCCTCACTGCAGTGGCCTCGGG - Intronic
950810486 3:15645814-15645836 ATCCACAAAGCAGTGGCTTGGGG + Intronic
952862084 3:37821415-37821437 TGGCAAAATGCAGTGGCATGTGG + Exonic
954337435 3:49927944-49927966 CGTCACAGAGCAGTGGCATGTGG - Intronic
957320637 3:78625806-78625828 AGCCAGAATGCAGTGGGCTGAGG + Intronic
959518973 3:107304386-107304408 TACCAAAATGCAGTGCAATGAGG + Intergenic
960217244 3:115056410-115056432 TGCCAGGTTGCAGGGGCATGAGG - Intronic
963508394 3:146216851-146216873 TGGGACAATGCAGTGGTCTGGGG + Intronic
967867284 3:194200743-194200765 TGGCCAAATGCAGTGGCCTGAGG + Intergenic
968118399 3:196107337-196107359 TGCTGGAGTGCAGTGGCATGAGG + Intergenic
971740515 4:30514567-30514589 TACCACAGTGCAGTGGAATGTGG + Intergenic
972684890 4:41342730-41342752 ATCCCCAATGCAGTGGCATGAGG + Intergenic
973992566 4:56424850-56424872 TACCAGAAAGCAGTGGCTTGCGG - Intronic
981401858 4:144322427-144322449 TGCCACCATGCACATGCATGGGG + Intergenic
982716884 4:158817985-158818007 GGCCCCAGGGCAGTGGCATGTGG + Intronic
984852018 4:184162668-184162690 TGCCACATTTTACTGGCATGAGG - Intronic
987335541 5:16895271-16895293 TGGGACAAAGCAGTGGCAGGGGG + Intronic
987898275 5:23977768-23977790 TGCCTCATTGCAGTGGCCTCAGG + Exonic
988729383 5:33955259-33955281 TGGCAGAATGCAGTTCCATGTGG - Intronic
990476944 5:56170713-56170735 TGGCAGCATGCAGTGGCAGGCGG + Exonic
990734475 5:58845068-58845090 TAACACAATGCAGTCACATGTGG + Intronic
992934026 5:81682626-81682648 TGCCAAAAAGCAGTGGTAAGAGG - Intronic
994992326 5:107012847-107012869 TGCCACAATGCAGTTTCAAGTGG + Intergenic
997355367 5:133259386-133259408 TGGCACAAGGCAAGGGCATGTGG + Intronic
999347509 5:150837174-150837196 TGCCTCATTGCAGTGGCCTCAGG - Intergenic
999651456 5:153771515-153771537 TGCAAGAATGTAGTGGCATGAGG - Intronic
1000740400 5:164962166-164962188 TGCCAAAAATCACTGGCATGTGG + Intergenic
1003318261 6:5030651-5030673 TGCCACAAGGCAGTTGTGTGCGG + Intergenic
1004689874 6:17984045-17984067 TGCCAGTATGCAGGAGCATGAGG + Intronic
1009638490 6:66299362-66299384 GGCTACAATGCAGTGGCATGAGG - Intergenic
1009690572 6:67027167-67027189 GGCTAGACTGCAGTGGCATGCGG + Intergenic
1014110400 6:117614120-117614142 TGCCTCATTGCAGTGGCTTCAGG + Intergenic
1019096940 6:169589492-169589514 TGACATAATACAGTGGCAGGAGG + Intronic
1021499898 7:21320765-21320787 TTCCACAAAGCAGTAGGATGTGG - Intergenic
1024604181 7:51011259-51011281 TTCCACAGGGCAGCGGCATGAGG + Intergenic
1027650200 7:80857027-80857049 TCCCATTATGCAGTCGCATGTGG - Intronic
1032454220 7:132059831-132059853 TACAACAACGCAGTGGAATGGGG - Intergenic
1032839323 7:135701849-135701871 TCCCACAGTGCTGAGGCATGGGG - Intronic
1034235916 7:149569404-149569426 TGCCTCATTGCAGTGGCCTCAGG + Intergenic
1034749418 7:153554877-153554899 GGCCAAAATGTAGAGGCATGGGG - Intergenic
1037331161 8:17745145-17745167 TACCACAAGGAAGTGGTATGGGG - Intronic
1037742598 8:21619504-21619526 AGCCACAATGTAGTGCCAAGTGG + Intergenic
1038178490 8:25203638-25203660 TGATACAATGTGGTGGCATGGGG + Intronic
1045287137 8:100801619-100801641 TGGCAGAATCCAGTGGCTTGTGG - Intergenic
1045365959 8:101476460-101476482 TGCAACAAGTCAGTGGCATGGGG - Intergenic
1046299515 8:112269024-112269046 TGTCACAGTGCAGGGGCAGGGGG - Intronic
1046705690 8:117449003-117449025 GACCACAAGGCAGTGGCCTGTGG + Intergenic
1048185844 8:132240115-132240137 TGTCAAAATTTAGTGGCATGAGG - Intronic
1048334626 8:133493259-133493281 TCCCACAATGCAGTGATAAGAGG + Intronic
1048837153 8:138530884-138530906 TGCCACAATACTGTGCCTTGAGG - Intergenic
1049461735 8:142732786-142732808 TGCCTCACTGCAGTGGCCTCAGG - Intronic
1051102626 9:13539126-13539148 TGCTACAGTGCAGTGGCACAGGG + Intergenic
1052727981 9:32253092-32253114 TGCCAGGATGCAGTGGATTGAGG + Intergenic
1057714558 9:97480853-97480875 TTCCACAATCTATTGGCATGTGG + Exonic
1058080781 9:100699113-100699135 TGCCAGAATTCAGTGCCAGGAGG + Intergenic
1189897773 X:45673435-45673457 TGCCAGCATGCAGAGGCAGGTGG + Intergenic
1195287453 X:103398730-103398752 TGCCCTATTGCAGTGGCCTGGGG + Intergenic
1195616297 X:106914992-106915014 TACTACAATGGAGTGGCATAAGG - Intronic
1196515080 X:116601497-116601519 TGCCACACTGCTGTGGCTTGTGG + Intergenic
1196581672 X:117386617-117386639 GGCCACCATGCAGTGCCATGAGG - Intergenic
1196874269 X:120143710-120143732 TGCCTCATTGCAGTGGCCTCAGG + Intergenic
1197032865 X:121839143-121839165 TGCCACAATGCTGGGGGCTGAGG + Intergenic
1202174298 Y:22083567-22083589 TGCCACCCTGCAGTGGCCTGTGG + Intronic
1202217062 Y:22502815-22502837 TGCCACCCTGCAGTGGCCTGTGG - Intronic
1202326123 Y:23693255-23693277 TGCCACCCTGCAGTGGCCTGTGG + Intergenic
1202544648 Y:25976799-25976821 TGCCACCCTGCAGTGGCCTGTGG - Intergenic