ID: 900330622

View in Genome Browser
Species Human (GRCh38)
Location 1:2132807-2132829
Sequence GTGTGTGTATGGTGGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 942
Summary {0: 1, 1: 0, 2: 12, 3: 111, 4: 818}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900330615_900330622 -1 Left 900330615 1:2132785-2132807 CCCTTAGTCTCTGAGGGGCCTAG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG 0: 1
1: 0
2: 12
3: 111
4: 818
900330616_900330622 -2 Left 900330616 1:2132786-2132808 CCTTAGTCTCTGAGGGGCCTAGT 0: 1
1: 0
2: 0
3: 12
4: 82
Right 900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG 0: 1
1: 0
2: 12
3: 111
4: 818
900330609_900330622 22 Left 900330609 1:2132762-2132784 CCGCTTTGCTGTCCACGTTTCCA 0: 1
1: 0
2: 0
3: 11
4: 176
Right 900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG 0: 1
1: 0
2: 12
3: 111
4: 818
900330614_900330622 2 Left 900330614 1:2132782-2132804 CCACCCTTAGTCTCTGAGGGGCC 0: 1
1: 0
2: 1
3: 12
4: 167
Right 900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG 0: 1
1: 0
2: 12
3: 111
4: 818
900330610_900330622 10 Left 900330610 1:2132774-2132796 CCACGTTTCCACCCTTAGTCTCT 0: 1
1: 0
2: 0
3: 19
4: 242
Right 900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG 0: 1
1: 0
2: 12
3: 111
4: 818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900330622 Original CRISPR GTGTGTGTATGGTGGGAAGC GGG Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900773810 1:4566506-4566528 GTGTGTGGGTGGTGAGCAGCTGG - Intergenic
901436532 1:9250368-9250390 GTGTGTGTGGGGTGGGGAGTGGG - Intronic
901436557 1:9250444-9250466 GTGTGTGTAGGGTGGGGAGTGGG - Intronic
901436569 1:9250482-9250504 GTGTGTGTGGGGTGGGGAGTGGG - Intronic
902567812 1:17324791-17324813 TTTTGTGTATGGTGTGAGGCTGG + Intronic
902742317 1:18447326-18447348 GTGTGTGTATGGTGGGGGTTGGG + Intergenic
902794021 1:18788477-18788499 TTCTGTGTATGGTGTGAAGGAGG - Intergenic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903226460 1:21896637-21896659 GTGAGTGGATGGGGGGATGCGGG + Intronic
903343212 1:22667906-22667928 GTGTGTGTGTGTTGGGTAGGGGG - Intergenic
903452870 1:23466512-23466534 GTGTGTGTATGTTGGGATCAGGG - Intronic
904115734 1:28160556-28160578 GTGTGTGTGTGGGGGGTGGCGGG - Intronic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904823466 1:33259405-33259427 GTGTGGGTAAGGTGGGGACCGGG + Intronic
904867297 1:33590584-33590606 GTGTGTGTGTGATGGGAAATAGG - Intronic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905286953 1:36887158-36887180 TTCTGTGTATGGTGGGAGGCAGG - Intronic
905597875 1:39224179-39224201 ATGTGTGTATGGGGGGGAGTAGG - Intronic
905600013 1:39241714-39241736 GTGTATGTATGGCGGGGAGGGGG + Intronic
905770564 1:40635629-40635651 GTGTGTGCGTGGTGGGAGGTGGG + Intronic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906698256 1:47839349-47839371 GTGTGTGTGTGGTGGGAGTGAGG - Intronic
907338632 1:53717562-53717584 GTGTGTGTATTGGGTGAAGTGGG - Intronic
907426877 1:54385327-54385349 GTCTGTTTTTGGTGGGGAGCAGG - Intronic
907663475 1:56414553-56414575 GTGTGTGTGTGGTGGGGGGCAGG - Intergenic
907756004 1:57311511-57311533 GTGTGTGTGTGGTGGTTGGCAGG - Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
908222757 1:62024647-62024669 GTGTGTGTGTGTTGGGAGGTGGG - Intronic
908682984 1:66682779-66682801 ATGTGTGTATGTAGGCAAGCAGG + Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909431524 1:75592815-75592837 TTGTGTGTATGGTGAGAGACAGG - Intronic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
910705168 1:90121987-90122009 GTGTGTGTATAGTGGGATGATGG + Intergenic
911103633 1:94113216-94113238 GAGGGTGTATGGTGGGGAGGGGG - Intronic
911266425 1:95750084-95750106 GTGTGTGTGTGGTGGGGTGGGGG - Intergenic
911742615 1:101403672-101403694 GAGGGTGTATGGTGGGAGGAGGG - Intergenic
912075630 1:105872038-105872060 GTGTGTGTGTGGGGGGAGGTGGG + Intergenic
912296956 1:108478987-108479009 GTGTGTGTGTGGTGGGGTGGGGG - Intergenic
912300123 1:108506506-108506528 GTTTGTGTATGGTGTGAAATAGG - Intergenic
912449228 1:109759173-109759195 GTGTGTGTGTGGTGGGGTGATGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912663870 1:111561497-111561519 GTGTATGTATTGGGGGAAGGAGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912865190 1:113250261-113250283 GTATGTGTATGGTTGGGAGGGGG + Intergenic
913098847 1:115544865-115544887 GTGTATGTGTGGTGGGAGGCAGG + Intergenic
913192608 1:116426286-116426308 GTGTGTGTATGTGGGGAGGTAGG + Intergenic
913370116 1:118089345-118089367 GTGTGTGTGTGGTGGCAGGTAGG + Intronic
914912744 1:151800656-151800678 GTGTGTGGAGGGGGTGAAGCAGG + Exonic
915117917 1:153612097-153612119 GTGTGTGTGTTGGGGGAGGCGGG - Intronic
915141575 1:153771552-153771574 GCGTGTGTGTGTTGGGAAGGAGG - Intronic
915356235 1:155256505-155256527 GAGTGTGTGTGCTGGGCAGCAGG - Intronic
915607665 1:156963318-156963340 GGATGAGCATGGTGGGAAGCCGG + Intronic
915885180 1:159714246-159714268 GTGTGTGTGTGGTGTGTAACTGG - Intronic
915950736 1:160188417-160188439 ATGTGAGTGAGGTGGGAAGCAGG + Intergenic
916296435 1:163225581-163225603 GTGTGTGTGGGGTGGGTAGGGGG - Intronic
916437569 1:164791081-164791103 GTGTGGGTAGGGTGGGAAAGAGG - Intronic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
917368072 1:174255846-174255868 GTGTGTGTATAGCGAGTAGCAGG - Intronic
917469688 1:175315840-175315862 GTGTGTGAATGATTGGAAGGAGG + Exonic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918306272 1:183249725-183249747 GTGTGTGTTTGGGGGGTAGGGGG + Exonic
918497581 1:185157235-185157257 GTGTGTGTGTGTTGGGAGGCGGG + Exonic
919813194 1:201421826-201421848 GTGTGTGAAGGGTGGGAGGGAGG - Intronic
920677221 1:208046584-208046606 GTGTGTGCATGGCCTGAAGCAGG + Intronic
920677255 1:208046836-208046858 GTGTGTGTAGAGTGTGGAGCAGG + Intronic
920680154 1:208066056-208066078 GTGTGTGTGTGGTGGGGATGTGG + Intronic
921101504 1:211932837-211932859 GCATGTGTTTGGTGGGGAGCTGG + Intergenic
921348767 1:214214160-214214182 GTGTGTGTGTGGTGGGGGGGGGG - Intergenic
921584274 1:216929472-216929494 GTGCGTGTGTGGAGGGGAGCTGG + Intronic
922131016 1:222778329-222778351 TTTTGTATATGGTGTGAAGCAGG - Intergenic
922770836 1:228182323-228182345 GGGTGTGTATGGTGGGGACGGGG + Intergenic
922770882 1:228182459-228182481 GGGTGTGTGTGGTGGGGAGATGG + Intergenic
923221644 1:231899887-231899909 ATGTGTCTATTTTGGGAAGCAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923409783 1:233695554-233695576 GTGTGTGTATGGAGGTAGGCTGG - Intergenic
924286978 1:242497476-242497498 GTGTGTGTATGGAGGCAGGTGGG + Intronic
924638902 1:245814793-245814815 GTGTGTGCATGGTGGGATAAGGG - Intronic
1062974373 10:1672606-1672628 GTGTGTCCATGGAGGGAGGCAGG - Intronic
1063039240 10:2319980-2320002 GTGTGTGTGTGGTGGGGGGAGGG - Intergenic
1063221139 10:3969088-3969110 GTGTGTGTGTGGTGGGGTGGGGG + Intergenic
1063547505 10:6996695-6996717 GTTTATGTAGGGTGGGAGGCGGG - Intergenic
1063943752 10:11157381-11157403 GTGTGTGTGTGGGGGGAGGGCGG - Intronic
1066598692 10:37080137-37080159 GTGTGTGTTGGGTGGGAAGGTGG + Intergenic
1067261422 10:44696243-44696265 GTGTGTGTGTGATTGGAAGGAGG + Intergenic
1068182690 10:53543010-53543032 GTGTGTGTAGGGGGAAAAGCTGG - Intergenic
1068620667 10:59177346-59177368 GTGTGTGTGTTGGGGGAAGGGGG - Intronic
1068721063 10:60246846-60246868 GGGTGTGTGTGGGGAGAAGCAGG - Intronic
1068776509 10:60873515-60873537 GGGTGTGTATGGGGGTAAGGTGG + Intronic
1068896528 10:62209604-62209626 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1069244639 10:66188568-66188590 GTGTGTGTGTGGGGGGAGGGGGG + Intronic
1069319167 10:67146089-67146111 GTGTGTGTGTGGAGGGGTGCTGG - Intronic
1069564288 10:69452824-69452846 GTGTGTATTTGGTGGGAATGGGG - Intronic
1069846361 10:71374527-71374549 GTGTGTGTGTTGTGGGAAGCAGG + Intergenic
1069961872 10:72083943-72083965 AGGTGTGTGGGGTGGGAAGCAGG + Intronic
1071288500 10:84171359-84171381 GTGTGTGTGTGGTGTGAACATGG - Intergenic
1071290656 10:84186395-84186417 GTGTGTGTGTGGTGTGCAGAGGG + Intergenic
1071388596 10:85147085-85147107 TTGTGTTTTTGGTGGGAAGTTGG - Intergenic
1072207640 10:93218681-93218703 TTTTGTGTATGGTGAGAAGTAGG - Intergenic
1072756491 10:98024784-98024806 GTGTGTGTGTGGTGGAGAGGTGG - Intronic
1072933860 10:99693082-99693104 GTGTGAGTAGGGTGGGAGGATGG + Intronic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073403779 10:103278859-103278881 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
1073595976 10:104800564-104800586 GTGTGTGTGTGTTGGGGAGGCGG + Intronic
1073782245 10:106850843-106850865 GCGTGTGTGTGGTGGGTGGCAGG - Intronic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074741840 10:116492800-116492822 GTTTGTGTATGGTATGAGGCAGG + Intergenic
1074868020 10:117556090-117556112 GTGTGTGTCTGGGAGAAAGCAGG - Intergenic
1075242696 10:120792941-120792963 GTGTGTGTGTTGTGGGAGGGGGG - Intergenic
1075242758 10:120793181-120793203 GTGTGTGTGTTGTGGGAGGGGGG - Intergenic
1075242776 10:120793264-120793286 GTGTGTGTGTGGGGGGGAGGGGG - Intergenic
1075268316 10:121025549-121025571 GTGGGTGTAAGGAGGGGAGCAGG + Intergenic
1075333423 10:121591838-121591860 ATGTGGGTATTGTTGGAAGCAGG - Intronic
1075959233 10:126552987-126553009 TTGTGTTTATGATGGGAAGCAGG - Intronic
1076288728 10:129327137-129327159 GTGTGTGTAAGGTGGAAGGGAGG + Intergenic
1076835957 10:133021017-133021039 GTGTGTGTTTGGGGAGAAGCTGG + Intergenic
1077093859 11:791182-791204 GTGTGTGTGTTGTGGGGATCTGG - Exonic
1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG + Intronic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1077601523 11:3578054-3578076 ATGTGTTTATGGTGGGGAGGCGG - Intergenic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078333377 11:10444384-10444406 ATGTGTGTGTGGTGGGCAGGTGG + Intronic
1078350131 11:10586162-10586184 GTGTGTGGAGGGTGGGTAGGGGG + Intronic
1078650092 11:13182469-13182491 GTGTGTGTGTTGTGGGAGGGAGG + Intergenic
1078673112 11:13382510-13382532 GTGTGTGTGTTGTGGGCAGGGGG - Intronic
1078845000 11:15112628-15112650 GTGTGTGTGTATTGGGAAGTGGG + Intronic
1079271820 11:18994155-18994177 GGGTGTGTGTGGGGGGAAGTGGG - Intergenic
1079314848 11:19398808-19398830 GTGTGTCTGTGGGGGGAAGGAGG - Intronic
1079394096 11:20046585-20046607 GTGTGTGTGTGATGGGGAGGGGG - Intronic
1080049395 11:27843702-27843724 GATTGTGTATGGTGGAATGCTGG + Intergenic
1080908299 11:36569097-36569119 GTGGGTATAGGGTGGGCAGCTGG + Intronic
1080961969 11:37171386-37171408 GTGTGCGTGTGGTTGGAAGAGGG + Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081611799 11:44567383-44567405 GTGTGTGTATGTAGGGCAGGGGG + Intronic
1081766084 11:45610973-45610995 GTGTCTGTGAGTTGGGAAGCTGG - Intergenic
1082267258 11:50132308-50132330 ATGTGTGAATGGTGTGAAACAGG - Intergenic
1082288829 11:50346260-50346282 ATGTGTGAATGGTGTGAAACAGG + Intergenic
1082700379 11:56422407-56422429 GTGTGTGTATGTTTGTAAGGAGG + Intergenic
1082897514 11:58207833-58207855 GTTTGTGTATGGTGAGAGACAGG - Intergenic
1083268503 11:61558557-61558579 GTGTGTGTTTGTTGGGGAACAGG + Intronic
1083420888 11:62552602-62552624 GTGTGTGTATGGGGTGGAGGCGG - Intronic
1083493432 11:63030077-63030099 GTGTGGATATGGGAGGAAGCAGG + Intergenic
1084073421 11:66753205-66753227 GTGTGTGTATGCAGGCAAGCAGG + Intronic
1084257430 11:67952623-67952645 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1084609185 11:70191342-70191364 GTGTGTGTATGTTGGGATGGGGG + Intergenic
1084630382 11:70344437-70344459 GGGCGCATATGGTGGGAAGCGGG + Intronic
1084815340 11:71642631-71642653 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1084932060 11:72563985-72564007 CTGTGTGTGTGATGGTAAGCAGG + Intergenic
1085006770 11:73099207-73099229 GTGTGTTTATTTTTGGAAGCAGG - Intronic
1085773616 11:79346510-79346532 GTGTGTATGTGGTGGGAGGTGGG - Intronic
1086199406 11:84183392-84183414 GTGTGTGTTAGGTGGGGAGGAGG + Intronic
1086388992 11:86341178-86341200 GTATGTACATGTTGGGAAGCAGG - Intronic
1087007969 11:93487434-93487456 GTGGGTGTATGGAGGGGAGGAGG + Intronic
1087242645 11:95797161-95797183 GTGTGTGTGTGTTGGGAGGGGGG - Intronic
1087617725 11:100507411-100507433 GTGTGTGTATGTGGAGAAGGGGG - Intergenic
1088194182 11:107257469-107257491 GGATATGGATGGTGGGAAGCAGG + Intergenic
1088263273 11:107965300-107965322 GTGTGTGTATGTTGGGTGGAGGG + Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088495437 11:110427323-110427345 ATTTGTGTTTGGTGGGCAGCAGG - Intergenic
1088512559 11:110593391-110593413 GTGTGTATCTGTTGGGAAGAGGG - Intronic
1088736983 11:112735942-112735964 GTGTGTGTGTGTTGGGCTGCAGG + Intergenic
1089324945 11:117650705-117650727 GTGTGTGTGTGGTGGGGATTGGG + Intronic
1089355270 11:117846538-117846560 GTTTGTGTATGGTGTGAGGTAGG + Intronic
1089374669 11:117986100-117986122 GTGTGCATGTGCTGGGAAGCAGG - Intergenic
1089399574 11:118156678-118156700 GGGTGTGTGTGGGGGGAGGCGGG - Intergenic
1090040358 11:123285317-123285339 GAGTGTGTAGGGTTGGAGGCAGG - Intergenic
1090153202 11:124406782-124406804 GTGTGTGTGTGGTGAGAAGGAGG - Intergenic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090568476 11:128021573-128021595 ATGTGTGTCTGCTGGGCAGCAGG + Intergenic
1090645380 11:128763132-128763154 TTGTGTCTCTGGTGGGAAGGAGG + Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091332966 11:134744877-134744899 GTGTGTGTGTGGTGGGGGGGAGG - Intergenic
1091334344 11:134755102-134755124 GTGTGTGCATGCTGGGGTGCAGG + Intergenic
1091609721 12:1995638-1995660 GTCTGTGTATGCTGGGCAGGAGG - Intronic
1091631745 12:2166702-2166724 GTGCCTGTATGGTGTGAGGCAGG - Intronic
1091799515 12:3316093-3316115 GTGTGTGTGTGGTGGGGGGTGGG + Intergenic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092016191 12:5160986-5161008 GTATGTGTGTGGTGGGGAGTGGG - Intergenic
1092213437 12:6663349-6663371 GTGTCTGTAAGGGCGGAAGCGGG - Intergenic
1092913749 12:13171375-13171397 GTGTGGGAATGGCAGGAAGCGGG + Intergenic
1093519247 12:20028914-20028936 GTGTGTGTGTGGTGGGGACTGGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094078822 12:26509994-26510016 GTGTGTGTGTGGTGGGGGGTGGG + Intronic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1094797298 12:33990384-33990406 GTGTGTGGGCGGTGGGGAGCGGG - Intergenic
1096359140 12:50968391-50968413 GTGTGTGTGTGGGGGGAGACAGG + Intronic
1096429391 12:51530791-51530813 GTGTGTGTGCGGTGGGATGGGGG + Intergenic
1096451593 12:51747121-51747143 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096912469 12:54998109-54998131 GTGTGTGTGTGTTGGGATGTTGG - Intergenic
1096985332 12:55752364-55752386 GTGTGTGTGTGGTGGGTGGGGGG + Exonic
1097237691 12:57550923-57550945 GTGTGTGTGTTGTGGGGAGTAGG + Intronic
1097272261 12:57783284-57783306 GTGTGTGTGTGGAGGGGTGCAGG + Intronic
1098484110 12:71000874-71000896 GTGTGTGTATGGGGGATAGCGGG - Intergenic
1098740939 12:74172264-74172286 GTTTGTGCTTGGTGGAAAGCAGG + Intergenic
1100710586 12:97251983-97252005 GTGTGTGTTTGTTGGGAATGGGG + Intergenic
1100921335 12:99491530-99491552 GTGGGTGGAGGGTGGGAAGAGGG - Intronic
1101093635 12:101313710-101313732 GGGTGTGTGTGGTGGGGAGTGGG + Intronic
1101307518 12:103543985-103544007 GTGTGAGAATGGTGTGAACCCGG - Intergenic
1101652477 12:106690066-106690088 GTGTGTGTGTTGTGGGAAGGGGG + Intronic
1101766176 12:107701606-107701628 TTGTGTGTATGGTGTGAGGTAGG + Intronic
1102677686 12:114669269-114669291 GTGTGTGTCTGTTGGGGGGCGGG - Intergenic
1102704725 12:114871090-114871112 GTGTGTGTGGGGTGTGAAGTAGG + Intergenic
1102821546 12:115913217-115913239 GTGTGTGTGTGGTGGGGTGGAGG - Intergenic
1102867924 12:116388952-116388974 GTGTGTGTGTGGCGGGAGGGTGG - Intergenic
1103576759 12:121883226-121883248 GTGTGTGTGTGGTGGGGTACAGG + Intergenic
1104137202 12:125951923-125951945 GTGTGTGTCTGGTAGGAAATGGG - Intergenic
1105724702 13:23150704-23150726 TTTTGTGTATGGTAGGAAGAAGG + Intergenic
1105874132 13:24538633-24538655 GTGTGTGTTTGGTGGGGTGGGGG + Intergenic
1106186563 13:27414973-27414995 GTGTGTATATTGTGGGGAGACGG + Intergenic
1106310575 13:28550418-28550440 GTGTGTGGGGGGTGGGTAGCGGG + Intergenic
1106421638 13:29590353-29590375 GTGTGTGTTTGGTGGGGGGCAGG - Intronic
1107264050 13:38529986-38530008 GTGTGTGTCCCGTGGGAAACTGG - Intergenic
1107501436 13:40981336-40981358 GTGTGTGTGTTGTGGGGAGGGGG + Intronic
1107728545 13:43324782-43324804 GCGTGGGTGTGGTGGGGAGCAGG - Intronic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1108286973 13:48918319-48918341 GTTTGTATATTCTGGGAAGCGGG + Intergenic
1108584619 13:51859491-51859513 GTGTGTGTTTGGTTGGGAGTCGG - Intergenic
1109075639 13:57831845-57831867 GTGTGTTGATGTTGGGAAGCGGG + Intergenic
1109106834 13:58263416-58263438 TTGTGTGTATGGTGAGAGACAGG - Intergenic
1109171677 13:59105740-59105762 GGGTGTGAATGGTGAGGAGCTGG - Intergenic
1109370837 13:61417104-61417126 GTGTGTGTGGGGTGGGGAGGAGG - Intronic
1109520321 13:63501909-63501931 CTGAGTGTAAGGTGGGAAGGTGG + Intergenic
1109527151 13:63591035-63591057 GTGTGTGTGTGATGAGAATCAGG - Intergenic
1109580737 13:64329759-64329781 GTGTGTGTATGGTGAGGTGGGGG - Intergenic
1109758253 13:66790583-66790605 TTTTGTGTATGGTGTGAGGCAGG + Intronic
1109864632 13:68246711-68246733 GTGGGTGGAGGGTGGGAAGAGGG - Intergenic
1110094016 13:71492771-71492793 GTGTGTGTATGGTGTGAGGGAGG + Intronic
1110605221 13:77424615-77424637 ATGTGTCTGTGGTGGGAAGGGGG - Intergenic
1111150186 13:84243159-84243181 GTGTGTGTAATATGGGTAGCAGG + Intergenic
1111547773 13:89765873-89765895 GTGTGTGTATGGGGAGTGGCGGG - Intergenic
1112151454 13:96769113-96769135 GTGTGTGTTTGGTGGGGAGGTGG - Intronic
1112452290 13:99523576-99523598 TTGTGTGTATTATGTGAAGCTGG + Intronic
1112641901 13:101284933-101284955 ATGTGTGTATGGTAGGAATAGGG + Intronic
1112883485 13:104138050-104138072 GTGTGTGTGTGGTGGTATGGGGG + Intergenic
1112986283 13:105454166-105454188 TTGTGTGTATGGTGAGAGGTAGG + Intergenic
1113473679 13:110564486-110564508 GTGTGTGTGTGGCGGGGGGCAGG - Intergenic
1113571048 13:111358293-111358315 GTGTGTGTGTGGTGGGGAATAGG + Intergenic
1113874146 13:113584308-113584330 GTGTGTGCATGTGGGGGAGCGGG - Intergenic
1114166510 14:20224196-20224218 GTCTGTGTATGCTGGGTAGGCGG + Exonic
1114811164 14:25901305-25901327 GTGTGTGTATAGGGGGGAGATGG - Intergenic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115888728 14:38003717-38003739 GTGTGTGTGTGGTGGGGGGCGGG + Intronic
1115961832 14:38842718-38842740 GTGTGTATATATTGGGCAGCTGG - Intergenic
1116421569 14:44738739-44738761 GTGTGTGTACGGTGTGTAGGAGG - Intergenic
1117906160 14:60589705-60589727 CTCTATGTATGGTGTGAAGCAGG - Intergenic
1118138461 14:63053098-63053120 GGGTGTGCTTGGTGGGAAGAAGG + Intronic
1118331960 14:64822136-64822158 GTGTGTGTATGTGTGGAAGGTGG - Intronic
1119064591 14:71512644-71512666 TTTTGTGTGTGGGGGGAAGCCGG + Intronic
1119188786 14:72664325-72664347 GTGTGTGTGTGTTGGGAGGTCGG - Intronic
1119382617 14:74238978-74239000 CAGTGTGTGTGGTGGTAAGCTGG - Intergenic
1119416905 14:74477029-74477051 GTGTGTGTGTGTTGGGAATGGGG - Intronic
1119416917 14:74477108-74477130 GTGTGTGTGTGTTGGGAATGGGG - Intronic
1119483834 14:74975729-74975751 GTGTATGTGTGGTGGGAAGGAGG - Intergenic
1120015707 14:79470986-79471008 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
1120816349 14:88863061-88863083 GTGTGTGAATGATGGGGAGGGGG + Intronic
1121167585 14:91821470-91821492 TTTTGTATATGGTGGGAGGCAGG - Intronic
1121399924 14:93666077-93666099 GTGTGTGTGTGGTTGGAGACTGG + Intronic
1121539918 14:94717829-94717851 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
1121564936 14:94902136-94902158 GTGTGTGTATGGTGGGGTGGGGG - Intergenic
1121626182 14:95387066-95387088 GTGTGTGTGCAGTGGGGAGCAGG - Intergenic
1121628877 14:95408304-95408326 GTGTGTGTGTGTTGGGAAAATGG - Intronic
1121696185 14:95914197-95914219 GTGTGTGGATGATCTGAAGCTGG + Intergenic
1121958950 14:98240773-98240795 GTGTGTATATGTGGGGAAGGAGG + Intergenic
1121990547 14:98552816-98552838 GTGCTTGGATGGTGGAAAGCTGG - Intergenic
1122096298 14:99375254-99375276 GTCTGTGGAAGGTGGGAAGGTGG - Intergenic
1122356285 14:101124806-101124828 GTCTGTGTGTGCTGGGAAGGGGG - Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1122879470 14:104683603-104683625 GTGTGTGTGTGGTGGGGAGGGGG - Intergenic
1123037564 14:105477709-105477731 GGGTGTGTGTGGGGGGAAGCGGG + Intronic
1124342991 15:28901934-28901956 GTGTGTGTATGTTGGGGGTCTGG + Intronic
1124485469 15:30111067-30111089 ATGTGAGTATGTTGGGGAGCTGG - Intergenic
1124518107 15:30386200-30386222 ATGTGAGTATGTTGGGGAGCTGG + Intronic
1124540546 15:30580053-30580075 ATGTGAGTATGTTGGGGAGCTGG - Intergenic
1124758107 15:32427528-32427550 ATGTGAGTATGTTGGGGAGCTGG + Intergenic
1125375086 15:39020229-39020251 GTGTGTCTGTGGTGTGAAGGGGG + Intergenic
1125419325 15:39488315-39488337 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
1125440434 15:39696916-39696938 GTGTGTGTGTGTTGGGATGGGGG + Intronic
1125687818 15:41573814-41573836 GTGTGAGTATCCTGGGAAGGGGG + Exonic
1125910395 15:43432753-43432775 GTGTGTGTGTAGTGGCAAGGGGG + Intronic
1126467910 15:48977242-48977264 GAGGGTGGAGGGTGGGAAGCTGG - Intergenic
1127577322 15:60304297-60304319 GTGTGTGTGTGTTGGGAAATAGG - Intergenic
1127747044 15:61988876-61988898 TTTTGTGTATGGTGTGAAGTTGG - Intronic
1127998404 15:64169132-64169154 GTGTGTGTGTGTGTGGAAGCAGG + Exonic
1128342530 15:66832357-66832379 GTGTGTGTGTGGTGAGAGGCAGG + Intergenic
1128577711 15:68787733-68787755 GTCTGTGTGTGCTGGGAGGCGGG - Intronic
1128650516 15:69409213-69409235 GTGTGTGTGTGTTGGGGAGTTGG - Intergenic
1129184556 15:73897960-73897982 GTGTGTGTGTGCTGGGGGGCAGG - Intergenic
1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG + Exonic
1129373164 15:75110451-75110473 CTCTGTGTCAGGTGGGAAGCCGG - Intronic
1129762025 15:78134744-78134766 GTGTGTGTTTGCTGGGAGGGAGG + Intronic
1129843892 15:78759495-78759517 GGGTGCGGATGGTGGGCAGCTGG + Exonic
1129919535 15:79308715-79308737 CAGTGTGTTTAGTGGGAAGCTGG + Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1131527242 15:93162269-93162291 GAGTGTGTCTGGTGGGGAGGGGG - Intergenic
1131686790 15:94776941-94776963 GTGTGTGTATGGGGGGGAGGGGG - Intergenic
1132243196 15:100276228-100276250 GTGGGTGCCTGGTGGGAAGGTGG + Intronic
1132794568 16:1713022-1713044 GTGTGTGGATAAAGGGAAGCCGG + Intronic
1133271537 16:4613063-4613085 GTAGGTGTCCGGTGGGAAGCGGG - Intronic
1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
1134600281 16:15528554-15528576 GTGTGTGTAAGGGAGGGAGCTGG - Intronic
1134661994 16:15991275-15991297 GTGTGTGTGTGGTGGGGTGCGGG + Intronic
1135274853 16:21103345-21103367 GTGTGTGTGTGGGGGGGGGCAGG + Intronic
1135739568 16:24962132-24962154 GTGTGTGTATGGTGGGGTTGAGG - Intronic
1136655600 16:31707259-31707281 GTCAGTGGAGGGTGGGAAGCTGG - Intergenic
1136957762 16:34804308-34804330 GTGGGTGCATGGTGGGAACTGGG + Intergenic
1137024706 16:35460902-35460924 GTGTGTGTGTGTTGGGGAGAGGG + Intergenic
1137267745 16:46883210-46883232 GTGTGTGTGTGTTGGGATGTGGG + Intergenic
1137568813 16:49551378-49551400 GTGTGTGTATTTTGGGAGGGGGG - Intronic
1137592332 16:49701260-49701282 GTGTGTGTAGGGTGGGGGACAGG + Intronic
1137731279 16:50692607-50692629 ATGTGTGTGTGTTGGGAAGTGGG + Intergenic
1137731328 16:50692946-50692968 GTGTGTGAGTGTTGGGAAGCAGG + Intergenic
1137731383 16:50693291-50693313 ATGTGTATGTGTTGGGAAGCGGG + Intergenic
1138235970 16:55382983-55383005 GTGTTTGTTTGGTGGGTGGCAGG - Intergenic
1138944672 16:61834261-61834283 GTGTGTGTCTGGTGGGAGGGTGG + Intronic
1139527300 16:67524863-67524885 GTGTGTGTATGAGGGGAGGCAGG - Intronic
1139582176 16:67880233-67880255 GTGTGTGAAGTGTGGGGAGCAGG + Intronic
1139950884 16:70668994-70669016 GTGTGTGTGTGGTGTGAGGTAGG - Intronic
1140730355 16:77850744-77850766 GTATTTGCATGGTGGGATGCCGG - Intronic
1141303187 16:82837147-82837169 GAGGGTGAATGGTGGGAAGTGGG + Intronic
1141524775 16:84604245-84604267 GTGAGTGTGGGGTGGGGAGCAGG - Intronic
1141641970 16:85346741-85346763 GTGAGTGGATGGTGGGCAGGTGG + Intergenic
1141779101 16:86146155-86146177 GTGTGTGTAGGGGGGGGTGCGGG + Intergenic
1142568180 17:854206-854228 GAGCGAGTACGGTGGGAAGCGGG - Intronic
1142721596 17:1779778-1779800 GTGTGTCTCTGGAGGTAAGCAGG + Exonic
1143867733 17:9936115-9936137 TTGTGTGTATGGTGTGAGGTAGG - Intronic
1143997456 17:11019605-11019627 GTGTGTGTGTGGTGGGGGGTGGG + Intergenic
1143999360 17:11038271-11038293 GTGTGTGTATGGGGTGCAGGTGG + Intergenic
1144139877 17:12337833-12337855 GTGTATATATGTTGGGAGGCTGG + Intergenic
1144764759 17:17726281-17726303 GTGTGGGAAGGGTGGGGAGCAGG - Intronic
1145279820 17:21458745-21458767 GTGTGTGTGTGGCGGGGAGCAGG + Intergenic
1145769733 17:27484609-27484631 TTGTGTGTATGCTGGGGATCAGG - Intronic
1145786482 17:27597199-27597221 GGGTGTGGCTGGTGGGAGGCAGG + Intronic
1146838042 17:36127869-36127891 GTATGTGCAGGGTGGGAAGATGG + Intergenic
1147182213 17:38693569-38693591 GTGGGTGTGGGGTGGGAAGGGGG + Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147570720 17:41568897-41568919 GTGTGTGTATGTTTGAAAGGTGG - Intronic
1148219696 17:45852731-45852753 GTGGGTGCCTGGTGGTAAGCAGG + Intergenic
1148271915 17:46267852-46267874 GTGTGTGGAGGGTTGGTAGCGGG + Intergenic
1148654843 17:49275546-49275568 GTGTGTGTGTGGTGGGGTGGGGG + Intergenic
1148788018 17:50155234-50155256 GTGTGTGTGTGTTGGGGGGCGGG + Intergenic
1148850132 17:50550613-50550635 GTGTGTCCATGGTGGCAGGCAGG + Intronic
1149088299 17:52747304-52747326 GTGTGTGTATGGTGTGAGACAGG + Intergenic
1149429702 17:56587976-56587998 GACAGTGTATGGTGGGGAGCGGG + Intergenic
1149571681 17:57676715-57676737 GTGGGTGGATGGTGGGAAACGGG - Intronic
1150225728 17:63523494-63523516 GTGTGTGTATGTTGGGGCGGGGG + Intronic
1150929270 17:69566468-69566490 GTGTGTGTGAGGTGGCAGGCAGG + Intergenic
1151015761 17:70551006-70551028 GTGTGTGTGTGTATGGAAGCTGG + Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151376483 17:73692303-73692325 GTGTGTGTGTGGTGGGGATGGGG - Intergenic
1151498994 17:74476967-74476989 GTGTGTGTATGTGGGGAAATTGG + Intronic
1151655558 17:75494296-75494318 GTGCGTGTCTGGTGGGAATGGGG - Intronic
1151712073 17:75812697-75812719 GTGGGTGTAGGGTGGGATGCGGG - Intronic
1152039268 17:77892484-77892506 GTGGGTGCAGGGTGGGGAGCAGG + Intergenic
1152077733 17:78169264-78169286 GTGTGTGTGTGGCGGGGAGGGGG + Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152641840 17:81452520-81452542 GTGTGTGGATGGTAGGAGGTGGG + Intronic
1152721485 17:81926018-81926040 GTGTGTGTGTGGCGGGGGGCGGG + Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG + Intergenic
1153328168 18:3843120-3843142 GTGTGTGTATATAGGGAAGGTGG + Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155032650 18:21997612-21997634 ATGTGTGTAGGGTCGGAAGGAGG - Intergenic
1155063903 18:22252764-22252786 GTGTGGGTTTGATAGGAAGCAGG - Intergenic
1155147529 18:23096625-23096647 GTGTGTGTATTTTGGGGAGCAGG + Intergenic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156278336 18:35606861-35606883 GTGTGTGTGTGTTTGGAGGCTGG + Intronic
1156310018 18:35913231-35913253 GTGTGTGTGTGGTGGGATGGGGG - Intergenic
1156524420 18:37753185-37753207 GTGTGTGTGTTGGGGGAGGCGGG + Intergenic
1156570227 18:38244183-38244205 GTGTGTGCATGGCAGGAAGTAGG - Intergenic
1156801032 18:41114206-41114228 GTGTGTGTGTGTTGGGGTGCAGG + Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1157966542 18:52215231-52215253 GTGTGTGTGTGGTGGAGAGAAGG - Intergenic
1157989881 18:52482126-52482148 GTGTTTGTGTGGTGTGCAGCTGG - Intronic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1158185568 18:54767724-54767746 TTGTGTGAATTGTGGGAAACAGG - Intronic
1159793087 18:72808458-72808480 GTGTGTGTGTGGTGAGGAGATGG + Intronic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1160531180 18:79565651-79565673 TTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1161258636 19:3323404-3323426 GTGTGTGTGTGGTGGGGTGTGGG - Intergenic
1162040465 19:7968169-7968191 GTGTGTGGTTGGTGGGTAACAGG + Intronic
1162412632 19:10515621-10515643 GTGTGTGTTTGGTGGGGAGGGGG - Intronic
1163458921 19:17424784-17424806 GTGTGTGTCTGGGGCAAAGCGGG - Intronic
1164037254 19:21466056-21466078 GTTAGTGGAGGGTGGGAAGCTGG - Intronic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165445645 19:35855642-35855664 GTGTGTGTATGGGGAGGTGCGGG - Intronic
1165469744 19:35996372-35996394 GTGTGTGTGTGGTGGCAGGGGGG - Intergenic
1165808767 19:38597604-38597626 GTGTGTATGTAGGGGGAAGCAGG + Intronic
1166103436 19:40585077-40585099 TTTTATGTATGGTGTGAAGCAGG + Intronic
1166424794 19:42668098-42668120 GTGTGTGTGTGTTGGGAAAAGGG - Intronic
1166533856 19:43559529-43559551 TTTTGTGTATTGTGTGAAGCAGG - Intronic
1166704824 19:44902977-44902999 GCATGGATATGGTGGGAAGCTGG + Intronic
1166709097 19:44925719-44925741 ATGTGGTGATGGTGGGAAGCAGG + Intergenic
1167112898 19:47472184-47472206 GTGTGTGTGTGTTGGGGGGCGGG - Intergenic
1167677636 19:50897418-50897440 GTGTGTGTGTGGTGGGAGAGTGG - Intergenic
1168328078 19:55548394-55548416 GTGTGTGTATGGGGGGGTGGTGG + Intergenic
1168333202 19:55581134-55581156 GTGTGTGCATGTTGGGGAGCCGG - Intergenic
1168398018 19:56065436-56065458 GTGTGTGTGTGGTGGCGGGCGGG + Intergenic
1168679947 19:58307623-58307645 GTGTGTGTGTTGGGGGGAGCGGG - Intronic
925589461 2:5494942-5494964 GGGGGTGTAGGGTGGGAGGCAGG - Intergenic
925747137 2:7052828-7052850 GTGTGTGTGTGTTGGAAAGGGGG - Intronic
925817535 2:7768133-7768155 GTGTGTGTGTGGTGTGATGTGGG - Intergenic
927144314 2:20151645-20151667 GTGTGTGTTGGGTGGGGAGTTGG + Intergenic
927275525 2:21259268-21259290 GTGTGTGTGTGTCGGGAAGGGGG + Intergenic
927352133 2:22128099-22128121 ATTTGTGTCTGGTGGGAAGGGGG - Intergenic
927888766 2:26735198-26735220 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928435795 2:31253730-31253752 GGGTGTGTCTTGTGGGAAGAAGG + Intronic
929373436 2:41254942-41254964 GTGTGTGTATGGTGAAAGACAGG - Intergenic
929589970 2:43138578-43138600 GTGTGTGTGTGGTGCGGAACTGG - Intergenic
929667992 2:43848668-43848690 TTGTGTGTATGTTGGGCAGGGGG - Intronic
929723015 2:44390519-44390541 GTGTGTGTGTGGGGGGGAGGTGG + Intronic
930370513 2:50495409-50495431 GTGTGTGTGTGTTGGGATGGGGG + Intronic
932008680 2:67953847-67953869 GTGTGTGTGTGCTGGGTAGGGGG - Intergenic
932030768 2:68182077-68182099 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
932156547 2:69423199-69423221 GTGTGTGTGTGGGGGGGGGCGGG + Intronic
932414598 2:71566001-71566023 GTGTGTGTGTGTTGGGCAGCAGG + Intronic
932429231 2:71664084-71664106 GTGTGTGTGTAGGGGGAAGGGGG - Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932495571 2:72144312-72144334 GAGTGTGTTTGGTGGGGAGAGGG - Intronic
932638864 2:73421014-73421036 GTGTGTGTGTGATGGGAAGGTGG - Intronic
932969978 2:76528794-76528816 CTGTGTGTATGGGTGGATGCAGG - Intergenic
933140414 2:78785653-78785675 TTGTGTGTATAGTGGGAATAAGG - Intergenic
933158622 2:79000547-79000569 GTGTATATGTGGTGGGAAGTGGG - Intergenic
933189146 2:79313818-79313840 GTGTGTGTTTGGGGGTAAGAGGG + Intronic
935354061 2:102181776-102181798 GTGTGTGTGTGGGGGGGGGCGGG + Intergenic
935721690 2:105985361-105985383 GTGTGTGTATGGTGTGAGTGTGG - Intergenic
936062043 2:109301296-109301318 GTGTGTATGTGGTGGGGGGCGGG + Intronic
936341489 2:111637435-111637457 TTGTGTGTATGGTGTGAGGTAGG - Intergenic
937212317 2:120282547-120282569 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
937245259 2:120488363-120488385 GTGTGTGTATGTGGGGATGGGGG + Intergenic
937865557 2:126748819-126748841 GTGTGTGTGTGGTGGGTTGTGGG - Intergenic
937907700 2:127060434-127060456 GTGCGTGTTGGGTGGGAAGGCGG - Intronic
938120153 2:128627325-128627347 ATCTGTGTGTGTTGGGAAGCGGG + Intergenic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
940079402 2:149783226-149783248 GTGTGTGTGTGGTGAGTCGCTGG - Intergenic
940204629 2:151189233-151189255 GTGTGTGTATGGTGGTAGAATGG - Intergenic
940589118 2:155697842-155697864 GAGGGTGAATGGTGGGAAGAGGG - Intergenic
940670121 2:156657184-156657206 GTGTGTGTGTGGTTGGAGGTGGG + Intergenic
941112730 2:161434211-161434233 GTGTGTGCATGGTGGGAGGCAGG - Intronic
941208733 2:162609048-162609070 GTGTGTGTGTGTTGGGGGGCTGG - Intronic
941483511 2:166048345-166048367 GAGTGTGCAAGGTGGGAAGAGGG - Intronic
941566662 2:167117301-167117323 GTATGTGTATGGCGGGGAGTGGG - Intronic
942264724 2:174211168-174211190 GTGTGTGTGTTGTGGGGAGGAGG - Intronic
942485252 2:176432521-176432543 GTGTGTGTATTATGGGAAGAAGG - Intergenic
943212458 2:184985603-184985625 GTGTGTGTGTGGGGGGGTGCGGG + Intergenic
943365980 2:186967872-186967894 TTGTGTGGATGGTGGGCAGCAGG + Intergenic
943648620 2:190432819-190432841 GTGTGTGTGTGTTGGGGGGCGGG - Intronic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
944662522 2:201933109-201933131 GTGTGTGTAGGGAGGCATGCGGG + Intergenic
945265571 2:207888340-207888362 GTGTGTGTATGAAGAAAAGCAGG - Intronic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
946586116 2:221189688-221189710 GTGTGTGTTTGGGGGGCAGGGGG - Intergenic
946818440 2:223605268-223605290 GAGTGTGGATGGTGGGAGGAGGG - Intergenic
947360405 2:229340272-229340294 GTGTGTGTCTGGTGGGAGGCTGG - Intergenic
948264226 2:236625586-236625608 GTGTGTGTGTGGGGGGGGGCGGG + Intergenic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
1168796152 20:611313-611335 GTGTGTGTGTGATGGGATGGTGG - Intergenic
1168799397 20:634602-634624 GTCTGTGGAGGGTGGGGAGCGGG + Intergenic
1168806186 20:673642-673664 CTGAGTGAATAGTGGGAAGCAGG - Intronic
1168840782 20:908769-908791 GTTTGTGTGTGGTGGGGGGCAGG + Intronic
1168868493 20:1109065-1109087 GTGTGTGTGTGGTGGGGGTCGGG - Intergenic
1168937737 20:1681420-1681442 GTGTGTGTGTGGTGGGGGGCAGG + Intergenic
1169050288 20:2570970-2570992 TTTTGTGTATGGTGAGAGGCGGG - Intronic
1169274575 20:4224856-4224878 GTCTCTGTATGGTGGGAGGAGGG - Intronic
1169529315 20:6467127-6467149 CTTTGTGTCTTGTGGGAAGCAGG + Intergenic
1169781188 20:9312339-9312361 GTGTGTGTAGGGTGGAAGGTGGG - Intronic
1169867440 20:10217341-10217363 GTGTGTGTGTGGTGGGGCGGGGG + Intergenic
1169947539 20:11005392-11005414 GTCTGTGTGTGTTGGCAAGCAGG - Intergenic
1170231846 20:14057082-14057104 AAATGTGCATGGTGGGAAGCAGG - Intronic
1170476974 20:16725114-16725136 GTGTGTGTGTGTTGGGCAGGAGG + Intergenic
1171020665 20:21581684-21581706 GTGTGTCAATGCTGGGAAGTGGG - Intergenic
1171109982 20:22471880-22471902 GTGTGTGTGTGGTGTGTATCTGG - Intergenic
1171396339 20:24836227-24836249 GTGTGTGGAGGGTGGGCAGGTGG - Intergenic
1172130984 20:32655100-32655122 TTTTGTGTATGGTGTGAGGCAGG - Intergenic
1172215085 20:33230034-33230056 GTGTGTGTGTGGTGGGGTGAGGG - Intergenic
1172330531 20:34073284-34073306 GTGTGTGTGTGGTGGGGCGGGGG + Intronic
1172482132 20:35277493-35277515 CTGGGTGTAGGCTGGGAAGCAGG + Intergenic
1172798156 20:37557625-37557647 GTGTGTGTAGGGTGGTAGGGTGG + Intergenic
1173290801 20:41713315-41713337 GTGTGTGTGTCTTGGGAAGAAGG - Intergenic
1173667040 20:44770462-44770484 CTGTGTGTATTGGGGGAAACTGG + Intronic
1173964829 20:47104601-47104623 TTGTGTGTATGATGTGAGGCAGG + Intronic
1174130245 20:48339477-48339499 TTGTGTGTGTGGCGGGGAGCTGG - Intergenic
1174736769 20:52972468-52972490 GTGTGTGTGTGCGAGGAAGCGGG + Exonic
1175374572 20:58515360-58515382 GTTTGGGTGTGGTGGGGAGCGGG - Intergenic
1175679051 20:60971711-60971733 TTTTGTGTATGGTATGAAGCAGG - Intergenic
1175749223 20:61483688-61483710 GTGTGTGTGTTGGGGGCAGCGGG - Intronic
1175767515 20:61601569-61601591 GAGGGTGCATGGTGGGCAGCGGG - Intronic
1176936317 21:14871768-14871790 GTGTGTGTGTTTTGGGATGCTGG + Intergenic
1177272192 21:18864105-18864127 GAGGGTGTAGGGTGGGAAGAGGG - Intergenic
1178630834 21:34260056-34260078 GAGTTTGGAAGGTGGGAAGCAGG + Intergenic
1179030693 21:37717377-37717399 GTGGGTGTGTGGAGGGAGGCAGG + Intronic
1179487964 21:41722846-41722868 GTGTGTGTGCGGGGGGAAGTGGG - Intergenic
1179539067 21:42072484-42072506 GGGTGGGTATCCTGGGAAGCTGG + Intronic
1179635231 21:42704419-42704441 GTGTGTGTTTGGTGGGGTGGGGG - Intronic
1179769623 21:43605031-43605053 GTGTGTGTGTGGTGGGTATGTGG - Intronic
1179877018 21:44273763-44273785 TTCTGTGTATGGTGTGAAGTAGG - Intergenic
1180060019 21:45379989-45380011 GTGTGTGCATGGACGGACGCTGG - Intergenic
1181488530 22:23246935-23246957 GTGGGTGCATGGTGGTAAGAAGG + Intronic
1181687953 22:24542412-24542434 GTGTGTCTATGCTGGGTGGCAGG + Exonic
1181750147 22:24983595-24983617 ATGTGTGTATGGTGGGGGGGCGG + Intronic
1182692867 22:32176017-32176039 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1183394622 22:37564244-37564266 GTGTGTGTATGGTGGGGGTGGGG + Intronic
1183584582 22:38745584-38745606 TTGTGTGTACGGTGTGAGGCAGG + Intronic
1183724835 22:39582754-39582776 GTGGGTGTATGGGGGAAAGATGG - Intronic
1183724845 22:39582781-39582803 GTGAGTGTATGGGGGAAAGATGG - Intronic
1183727582 22:39598054-39598076 CTGTGTGTGTGGTGGGTTGCGGG + Intronic
1183849369 22:40571242-40571264 GTTTGTGTATGGTGTGAGGTAGG - Intronic
1184023521 22:41836822-41836844 GTATGTGTATGGTGGGGATAAGG + Intronic
1184035774 22:41917427-41917449 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
1184284755 22:43464325-43464347 GTGTGTGTGTGGTGGGCATAGGG + Intronic
1184818811 22:46893326-46893348 TTCTGTGTATGATGGGAGGCAGG + Intronic
1184988876 22:48154287-48154309 GGGTGTGTATTTTGGGGAGCGGG - Intergenic
1185013882 22:48332429-48332451 GTGTGTGTATGGTGTGTGGGGGG - Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185212756 22:49580813-49580835 GTGTGTGTATGGTGTGTATGTGG - Intronic
949096094 3:87577-87599 TTGTGTGTGTGGGGGGACGCGGG + Intergenic
949340053 3:3019722-3019744 GTGTGTATATGGTAGGGAGAAGG + Intronic
949627690 3:5886820-5886842 GTGTGTGTATGGGGGGGCGGTGG - Intergenic
950143325 3:10630307-10630329 GTGGGTGGAAGGTGGGAAGAGGG - Intronic
950190276 3:10971758-10971780 GTGTGTCTATGGAGGGGATCAGG + Intergenic
950337480 3:12208493-12208515 TGGTGTGTATGGTGGGAGGTAGG + Intergenic
950450361 3:13061794-13061816 GTGTGTGTTTGTTGGGACGGGGG - Intronic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
951129212 3:19022015-19022037 GTGTGTGTATTTGGAGAAGCAGG - Intergenic
952270803 3:31829599-31829621 GTGTGTCTATGAGGGGAAGCAGG + Intronic
952557767 3:34552789-34552811 GTGTGTGTATTGCAGGAGGCAGG + Intergenic
952643350 3:35625200-35625222 GTGTGTGTGTGGTGGGGGGGGGG - Intergenic
953025334 3:39141820-39141842 GTATTTGTGGGGTGGGAAGCAGG - Intergenic
953184440 3:40625147-40625169 GTGTGGGGAAGGTGGGAGGCAGG + Intergenic
953313134 3:41900038-41900060 ATGTGAGTATGTTGGGGAGCTGG + Intronic
953448216 3:42985577-42985599 GTGTGTGTGTGGGCGGAGGCAGG + Intronic
953540807 3:43816222-43816244 GTCTGTGTAGGGTGGGTACCAGG - Intergenic
953643916 3:44735952-44735974 GTGTGTTTAGGGTTGGCAGCAGG + Exonic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
953748861 3:45594766-45594788 GTGTGTGTGTTGAGGGCAGCGGG - Intronic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954881316 3:53837759-53837781 GTGTATGTAAGGTGGGAGGCCGG + Intronic
955156820 3:56425199-56425221 GTGTGTGTTTTGTGGGGAGATGG - Intronic
955404894 3:58619861-58619883 ATGTGTGTGTGGTGGGGAGGTGG + Intronic
956167720 3:66408952-66408974 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
956638443 3:71390565-71390587 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
956909005 3:73797439-73797461 ATGTGTGGATGGTGGGAAACAGG - Intergenic
957072368 3:75577110-75577132 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
957590029 3:82184859-82184881 GTGTGTGTATGTTGGGATGGGGG + Intergenic
957912756 3:86642975-86642997 GTATATGTATCGTAGGAAGCAGG - Intergenic
958065674 3:88542471-88542493 GTGTGTGTGTGTTGGGATGATGG + Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
958801023 3:98756028-98756050 GTGTATGTGTGGAGAGAAGCTGG + Intronic
959006836 3:101029135-101029157 GAGTGTGGAGGGTGGGAAGAGGG - Intergenic
959702190 3:109308992-109309014 GTGTGTTGATGGTGTGAAGGTGG - Intronic
959894617 3:111592122-111592144 GTGTGTGTTTGGTTGGAGGAGGG + Intronic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960185269 3:114630479-114630501 GTGTGTGTATGGTGGGTGCTAGG + Intronic
960187767 3:114664594-114664616 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
960692662 3:120363183-120363205 GTGTGTGTGTGGTGGGGAGGAGG + Intergenic
960708622 3:120505522-120505544 GTGTGTGTGTGGTGGAAGGGGGG - Intergenic
960959432 3:123059078-123059100 GTGTGTGTATGTTGGGATATGGG + Intergenic
961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
961315207 3:126030021-126030043 GTGTGTGAATGGTATGAAGTAGG - Intronic
961616160 3:128182853-128182875 CTCTGTGGCTGGTGGGAAGCAGG - Intronic
962199529 3:133390063-133390085 GTAAGTGTATGGTGGGAAAAGGG - Intronic
962463557 3:135636529-135636551 GTGTGTGTGTGATGGGAATGGGG - Intergenic
962776660 3:138667422-138667444 GTGTGTGTGTTGTGGGGAGGAGG + Intronic
963192454 3:142487843-142487865 TTTTGTTTATGGTGGGAAGAAGG + Intronic
963215021 3:142735782-142735804 GTGTGTGTGTGTTGGGAGGGTGG + Intronic
964432332 3:156620640-156620662 GTGGGTGAGTGGTGGGTAGCTGG - Intergenic
964868446 3:161287548-161287570 GAGGGTGGAGGGTGGGAAGCAGG + Intergenic
965381052 3:167988625-167988647 GTGTGTGTGTGGTGGGATGTGGG - Intergenic
965404081 3:168249350-168249372 GAGTGTGTATGCTGGGAGGGGGG + Intergenic
965993020 3:174844187-174844209 TTTTGTATATGGTGGGAAGAAGG + Intronic
966717771 3:183030696-183030718 AAGTGTGTATGTTGAGAAGCTGG - Intronic
966925209 3:184640135-184640157 GTGGCTGGATGGTGGGAACCTGG + Intronic
967484280 3:190012232-190012254 GTGTGTGTGTAGTGGGGGGCGGG + Intronic
968051886 3:195660159-195660181 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
968103927 3:195988178-195988200 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
968302229 3:197625768-197625790 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
968853566 4:3101606-3101628 GTGTGTGTATGGTGAAAACTAGG + Intronic
969061037 4:4435069-4435091 GTGTGTGTGTGATGGGGAGGGGG + Intronic
969075495 4:4574862-4574884 GTGTGTGTGTGTTGGGAGGAAGG - Intergenic
969103022 4:4784304-4784326 GTGTGTGTGTGGTGGGGATAAGG - Intergenic
969115634 4:4869162-4869184 GTGTGTGTGTGGTGGGGGGGAGG + Intergenic
969737990 4:9003929-9003951 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
969870977 4:10104659-10104681 GTGTGTGTATGCCGGGAGGGAGG - Intronic
970143053 4:13003509-13003531 GTGTGTGTGTGGGGGGAGGGGGG + Intergenic
970214968 4:13749381-13749403 GTGTGTGTCTGGGGGGGAGTTGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970869413 4:20798486-20798508 GTGTGTGTGTGGTAGAAAGAAGG - Intronic
971237092 4:24852273-24852295 GTGTGTGTATGGTGTGTTGGAGG - Intronic
971337021 4:25732736-25732758 GTGTGTGTGTGGTGGGGAGTCGG + Intergenic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
971456187 4:26847020-26847042 ATGGGTGTATGGGTGGAAGCTGG - Intergenic
971846214 4:31922154-31922176 GTGTGTTTGTGGTGGGGAGCAGG - Intergenic
972638093 4:40901933-40901955 GTGTGTGTGTGATGGAAAGATGG + Intronic
973970203 4:56205562-56205584 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
974555208 4:63437520-63437542 TTTTGTATATGGTGAGAAGCAGG + Intergenic
974677756 4:65116751-65116773 TTTTGTGTATGGTGAGAGGCAGG - Intergenic
974937762 4:68428779-68428801 GTGTGTGTGTGGGAGGAAGTGGG + Intergenic
975337684 4:73199247-73199269 GTGTGTGTGTGTTGGGAGGAGGG + Intronic
976657454 4:87504173-87504195 GTGTGTGTGTGGTGGGGTGGGGG + Intronic
976767490 4:88612317-88612339 GTGTGTGTGTGGTAAGAAGGAGG + Intronic
977005548 4:91565070-91565092 GTGTGTGTGTGATGTGAAGAAGG + Intronic
978768406 4:112428949-112428971 GTGTGTGTCTGCTGGGAAAAAGG + Intronic
978937166 4:114391800-114391822 GTGTTTGTGTTGGGGGAAGCAGG - Intergenic
978980396 4:114937879-114937901 GTGTGTGTGTGGCGGGGGGCGGG + Intronic
979397795 4:120209119-120209141 GTGTGTGTTTTGTGGGGGGCAGG + Intergenic
979920487 4:126490254-126490276 GCTTGTGTATGGTGGGCTGCAGG - Intergenic
979985588 4:127310030-127310052 GTCTGTGGATGGTGAGAAGCAGG - Intergenic
980682075 4:136176557-136176579 GTGTGTGTATGGTGGTGGGGGGG - Intergenic
981017586 4:139989826-139989848 GTTTGTGTGTGGTGGGGTGCAGG - Intronic
981222209 4:142250199-142250221 GAATGTGTATGTTGGGAATCTGG - Intronic
981713934 4:147733985-147734007 ATGTGTGTTGGGTGGGAAGTAGG + Intronic
982314084 4:154013605-154013627 TTTTGTGTATGGTGTGAAGAAGG + Intergenic
982705116 4:158700545-158700567 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
983804183 4:171973075-171973097 GTGTGTGTATGTTGGGGAGGAGG - Intronic
983831608 4:172335072-172335094 GTGCCTGTATGGTGTGAACCTGG - Intronic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
984150382 4:176122881-176122903 GTGTGTGTATTGAGGGTAGGAGG + Intronic
984405865 4:179328984-179329006 GTGTGTGTGTGTTGGGATGTGGG - Intergenic
984508698 4:180653356-180653378 GTGGGTGGAGGGTGGGAAGAGGG + Intergenic
984721726 4:182978583-182978605 GTGGTAGTATGGTGAGAAGCCGG - Intergenic
984863627 4:184261621-184261643 TTGGGTGGATGGTGGGAAGGGGG + Intergenic
985498093 5:221890-221912 GTGTGTGTGTGGTGGGGGGTGGG + Intronic
985777477 5:1852350-1852372 GTGTGTGTGTGGTGGGCGGGGGG - Intergenic
986028222 5:3871025-3871047 GGGTGAGGGTGGTGGGAAGCTGG + Intergenic
986374417 5:7115572-7115594 TTTTGTGTCTGTTGGGAAGCTGG + Intergenic
986470300 5:8067148-8067170 GTGTGTGTATTGGGGGGATCAGG + Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987095557 5:14546266-14546288 GTGTGTGTGTGGTGGGGGGTGGG + Intergenic
987385436 5:17324808-17324830 GTGTGTGTGTGGTGGGGAAGGGG - Intergenic
987591411 5:19932555-19932577 GTGTGTGTATTGTGGGGAGAGGG - Intronic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
987761285 5:22165465-22165487 GTGTATGTGTGTTGGGAGGCTGG - Intronic
988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG + Intergenic
988185901 5:27861612-27861634 GTGTGTGCATGAAGGGAAGGGGG - Intergenic
989142298 5:38213663-38213685 GCGCGTGTAGGGTGGGAAGGGGG + Intergenic
989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG + Intronic
989830148 5:45906586-45906608 TTGTGTATATGGTGTGAGGCTGG - Intergenic
990271480 5:54146149-54146171 TTGTGTGTATGGTGTGAGGCAGG - Intronic
990810019 5:59713525-59713547 GTGGGTGAGTGGTGGGTAGCTGG - Intronic
991240875 5:64458705-64458727 GTGTGGCTATGGTGGGATGCTGG - Intergenic
991443713 5:66678256-66678278 GGGTGTGTATGGGGGGAATGGGG + Intronic
991896076 5:71398919-71398941 GTGTATGTGTGTTGGGAGGCTGG - Intergenic
992094628 5:73351155-73351177 TTTTGTGTATGGTGTGAAGTAGG - Intergenic
992170485 5:74096892-74096914 GTGTGTGTATGGTGGAGATGGGG - Intergenic
993045277 5:82859323-82859345 GTGTGTGTATGTTGGGAGGGAGG - Intergenic
993672494 5:90778135-90778157 GTGTGTGTGTGGTTAGAAGTGGG + Intronic
993968309 5:94385896-94385918 GTGTGTGTATTGGGGGATGGGGG + Intronic
994067585 5:95560653-95560675 GTTTGTGTATGGTGCAAGGCAGG - Intronic
994570326 5:101506282-101506304 GTGTGGGCATGGTGGGCTGCAGG - Intergenic
995245718 5:109933001-109933023 GTGTGTGTATGATGGGAATGGGG + Intergenic
995754822 5:115491620-115491642 GTGTGTGTGTGTTGGGTGGCGGG + Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
997144313 5:131415861-131415883 TTGTGTGTAAGTTGGTAAGCTGG + Intergenic
997869906 5:137498255-137498277 GTGTGTGTGTGGTTGGGAGGGGG - Intronic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998103479 5:139453955-139453977 GTGTGTGTAGTGTGGGATGTGGG + Intronic
998187514 5:139993114-139993136 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
998390453 5:141783986-141784008 GTGTGTGTCTGGGGGAAGGCAGG - Intergenic
998430165 5:142063738-142063760 GTGTGTGTATGCTGGGTACAAGG + Intergenic
998580393 5:143368209-143368231 TTGTGTATATGGTGTGAAGTAGG - Intronic
999442453 5:151612982-151613004 GTGTGTGTGTGGTGGGGGGGTGG + Intergenic
999651659 5:153774067-153774089 GTGTGTGTGTGGGGGGAGGGGGG - Intronic
999987669 5:157020233-157020255 GTGTGTGTATTGTGTGAGGAAGG + Intergenic
1000227856 5:159285185-159285207 GTGTGTGTGTGGTGGGAGGGTGG - Exonic
1000276140 5:159736570-159736592 GTGTACCCATGGTGGGAAGCAGG - Intergenic
1000297873 5:159927915-159927937 GTGTGTATTTCGTGGGAAGCAGG + Intronic
1000346140 5:160315308-160315330 GTGTGTGTGTGTTGGGGGGCGGG - Intronic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000613702 5:163404629-163404651 GTGTGTGTAAGGAGGGAGGGGGG - Intergenic
1000795892 5:165663912-165663934 GTGTGTGTGTGGAGGGGTGCTGG + Intergenic
1001124392 5:169006457-169006479 TTGTGTGTAATGTGGGAGGCTGG - Intronic
1001640654 5:173242097-173242119 GTGTGTGTATGGTTTGAGACAGG + Intergenic
1001681125 5:173557622-173557644 GTGTGTGTATGGGGGGCAGGGGG + Intergenic
1001752873 5:174145031-174145053 GTGTGTGTGTTGTAGGCAGCAGG + Intronic
1002426912 5:179181978-179182000 GGGTGTGTGCGGTGGGAAGCTGG - Intronic
1002641501 5:180632792-180632814 GTGTGTATGTGGTGGGATCCCGG + Intronic
1003161546 6:3638881-3638903 TTGTGTGTATGGTGTGAGGTAGG - Intergenic
1003190671 6:3871641-3871663 GGGTGTGACTGCTGGGAAGCAGG - Intergenic
1003256988 6:4483238-4483260 GTGTCTGTGTGGTGGGGAGGGGG - Intergenic
1003397878 6:5769148-5769170 GTGTGTGTGTGGTGTGAGGTAGG + Intronic
1003528711 6:6920042-6920064 GTGTCTGCATGATGGAAAGCTGG - Intergenic
1004244218 6:13956911-13956933 GTGTGTGTATGGTGGGGGGCGGG - Intronic
1004700411 6:18074171-18074193 TTTTGTGTATGGTGTGAAGTAGG + Intergenic
1005574364 6:27178162-27178184 GTATGTGTGTGGTGGGGGGCGGG - Intergenic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006215808 6:32441641-32441663 GGGTTTGGATGCTGGGAAGCAGG + Intronic
1006450070 6:34100491-34100513 GAGAGTGTATGGGGGGAGGCTGG - Intronic
1006450774 6:34104606-34104628 GTGTGTGCCAGGTGGGGAGCAGG - Intronic
1006804172 6:36777755-36777777 GTGTGTGTGTGGTGGGGGGGGGG - Intronic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007369401 6:41416519-41416541 GTGTGTGTCTGGTGGGTGGAGGG - Intergenic
1007410033 6:41656175-41656197 GTGTGTGTGTGCTGGGGGGCTGG - Intergenic
1007416393 6:41693886-41693908 GTGTGCGTGTGGTGGGCAGTGGG - Intronic
1007521648 6:42454652-42454674 GTGTGTGTGTGCTGGGAGGGAGG - Intergenic
1007801852 6:44401246-44401268 CTGAGTGTTTGGTGGGAAGTAGG + Intronic
1007994059 6:46287466-46287488 GTGTGTGTATTTTGGGAAGTGGG - Intronic
1008683222 6:53896419-53896441 GTGTGTGTATGGGGGAAGGGAGG + Intronic
1008875240 6:56318909-56318931 GTGTGTGTTTGGGGGGAGGTGGG - Intronic
1008931036 6:56940177-56940199 GTGTGTGTATGGGGGTAATGTGG - Intronic
1008936421 6:56997414-56997436 GTGTGTATGTGGTGGGGAGATGG - Intronic
1009547605 6:65041295-65041317 TTGTGTGTCTGGCAGGAAGCTGG - Intronic
1009569948 6:65371771-65371793 GTGTGTGTAATGGGGGAAGTGGG + Intronic
1009681478 6:66898245-66898267 GTGGGTGAGTGGTGGGTAGCTGG - Intergenic
1009713070 6:67348989-67349011 GTGGGTGAGTGGTGGGTAGCTGG - Intergenic
1009965145 6:70569914-70569936 GTTTGTATATGGTGTGAGGCAGG + Intronic
1009985685 6:70778941-70778963 GTGTGTGGATGGTGGCCAACCGG + Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010249609 6:73694355-73694377 AAGTGTGTATTGTGGGAAGGAGG + Intergenic
1010948438 6:82005954-82005976 GTGTGTGTATGGTGGGGGAGGGG - Intergenic
1011130089 6:84043641-84043663 GTGTGTGTATGGGGGGGTGAGGG + Intronic
1011493377 6:87915352-87915374 GTGTGTGGAGGGTGGGAGGTGGG + Intergenic
1012637189 6:101558577-101558599 GTGGGTGTATGGTGGGAATTTGG + Intronic
1012950163 6:105509738-105509760 GTGTGTGTGGGGTGGGGAGGTGG + Intergenic
1013050982 6:106534817-106534839 GTGTGTGTAGGGGTGGAAGTGGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013609969 6:111785481-111785503 GTTTGTGTGTGTTGGGAAGCGGG - Intronic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1013697301 6:112718795-112718817 GTGTGTGTGTGGTGGGGATTAGG + Intergenic
1014461385 6:121699837-121699859 GTGTGTGTGTGGTGGGAATCAGG + Intergenic
1014622688 6:123688582-123688604 GTGGGTGAAGGGTGGGAAGAGGG + Intergenic
1015596380 6:134871440-134871462 GTGGGTGAGTGGTGGGTAGCTGG + Intergenic
1015687248 6:135878292-135878314 GTGTGTTTATAGTGGGAAAGAGG + Intronic
1015817290 6:137223780-137223802 GTGTGTGTGTGGTGGTCATCAGG + Intergenic
1016076967 6:139806940-139806962 ATCTGTGTATGGTGTGAGGCAGG + Intergenic
1016726796 6:147380482-147380504 TTTTGTGTGTGGTGTGAAGCTGG - Intronic
1017300079 6:152846815-152846837 GTGGGTGAGTGGTGGGTAGCTGG + Intergenic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1019092723 6:169553020-169553042 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019092736 6:169553088-169553110 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019221145 6:170473780-170473802 GTGTGTGTGTGGTGGGCTCCAGG - Intergenic
1019262646 7:90229-90251 CTTTGTGTATGTTGGGAAACAGG + Intergenic
1020375674 7:7482919-7482941 GTGTTTGTGTGGTGGGAAGAAGG + Intronic
1020706631 7:11552158-11552180 GAGGGTGTAAGGTGGGAAGAGGG + Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021277073 7:18664630-18664652 ATGTGTGAGGGGTGGGAAGCAGG - Intronic
1021487840 7:21186847-21186869 GTGTGTGTGTGTTGGGAGACTGG - Intergenic
1021691766 7:23237100-23237122 GTGTGTGTGTGTTGGGCAGCAGG - Intronic
1021951940 7:25783562-25783584 GTGTGTGTATGGGGAGATGGCGG - Intergenic
1022109128 7:27217281-27217303 GTGTGTGTGTGTGGGGAAGGTGG + Intergenic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1022518717 7:30992134-30992156 GTGTGTGTGTGTTGGGGGGCGGG - Intronic
1022812731 7:33885557-33885579 GTGTGTGTTTGGTGGGGGGATGG - Intergenic
1023079828 7:36516077-36516099 GTGTGTGTATGGTGTGTATGTGG - Intronic
1023259268 7:38341808-38341830 GTGTGTGTGTGGCGGGGGGCGGG + Intergenic
1023473351 7:40549695-40549717 GTGTGTGAGTTGTGGAAAGCAGG + Intronic
1023664970 7:42513404-42513426 GTGTGTGTGGAGTGGGATGCAGG + Intergenic
1024364745 7:48508101-48508123 GTGCGTGTATGGAGGGATGGAGG + Intronic
1024368569 7:48552947-48552969 GGGTGTGTAGGGAGGGAAGTGGG - Intronic
1024556516 7:50607824-50607846 GGGTGTGTAGGTTGGGATGCTGG - Intronic
1024816349 7:53275943-53275965 GTGTGTAGAAGCTGGGAAGCTGG - Intergenic
1024936825 7:54719440-54719462 GTGAGTGTAAGGTGGGATGTAGG - Intergenic
1025262247 7:57426865-57426887 GTGTGTGTAGGGGGGGGGGCGGG + Intergenic
1027151434 7:75736793-75736815 GTGTCTGGATGGTGTGAAGCAGG - Intronic
1027861799 7:83593324-83593346 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
1028033162 7:85944404-85944426 GTGTGTGTGTGGTGGGGTGGGGG - Intergenic
1028091692 7:86710554-86710576 GTGTGTGTGTGGTGGGGGGTGGG + Intronic
1028233625 7:88333975-88333997 GTGTGTGTGTATTGGGGAGCAGG + Intergenic
1028495944 7:91461272-91461294 GTGTGTGTATGTTGGGGTGGGGG + Intergenic
1028761434 7:94501383-94501405 TTTTGTGTATGGTGAGAAGTAGG - Intergenic
1029221752 7:98995688-98995710 GTGTGTGTATGATGGGATGGGGG - Intronic
1029650921 7:101890830-101890852 GAGTGTGTAAAGTGAGAAGCAGG - Intronic
1030112469 7:106038495-106038517 GTGTGTGTGTGGTGGTGAGTGGG + Intergenic
1030377621 7:108771506-108771528 ATCTGTGTTTAGTGGGAAGCAGG + Intergenic
1030517306 7:110554025-110554047 GTGTGTGTATGGGGTGAAAGGGG - Intergenic
1031035997 7:116788471-116788493 GTGTGTGTTTGTTGGGGAGGTGG - Intronic
1031284331 7:119844724-119844746 GTGTGTGTGTGGGTGGAAGGCGG + Intergenic
1031326695 7:120408670-120408692 GTGTGTGTCTGTTGGGGGGCAGG - Intronic
1032408484 7:131675130-131675152 GTGTGTGTAAGATGGGCAGGAGG - Intergenic
1032417449 7:131747319-131747341 GTGTGTGTATGGAGGGGTGGGGG + Intergenic
1032902321 7:136323755-136323777 GTGTGTGTGTGGTGGGGTGGTGG + Intergenic
1033279773 7:139997556-139997578 GTGTGTGTATAGTGGGGGGAGGG - Intronic
1033363140 7:140652054-140652076 GTGAGTGTGGGGTGGGAAGAGGG + Intronic
1033525174 7:142205958-142205980 TTTTGTGTATGGTGTGAGGCAGG + Intronic
1033571199 7:142630443-142630465 GTGTGTGTGTGTTGGGGAGGAGG - Intergenic
1033600834 7:142887477-142887499 TTGTGTGTATGGTGTGTAGTGGG + Intergenic
1033877341 7:145838586-145838608 GAGGGTGTAAGGTGGGAAGAGGG + Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034544334 7:151780019-151780041 GTGTGTGTGTTGTGGGGGGCAGG - Intronic
1034725336 7:153330598-153330620 TTGTGTGTGTGTTGGGGAGCTGG + Intergenic
1035299480 7:157887725-157887747 GAGTGGGTATGGTGGGGAGTGGG - Intronic
1035299529 7:157887880-157887902 GAGTGGGTATGGTGGAGAGCAGG - Intronic
1035399132 7:158553393-158553415 GTGTGTGTATAAGGGGAGGCTGG - Intronic
1035436516 7:158863811-158863833 CTGGGTGTTTGGTGGGGAGCCGG + Intronic
1035551195 8:527726-527748 GTGTGTGTATGGTGAGAAATAGG - Intronic
1036212112 8:6850672-6850694 GCATATGTATGGTGGGAAGTGGG - Intergenic
1036257719 8:7218837-7218859 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036258969 8:7225834-7225856 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036307652 8:7613677-7613699 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036309768 8:7677433-7677455 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036311022 8:7684430-7684452 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036358506 8:8061678-8061700 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036359768 8:8068686-8068708 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036891192 8:12598284-12598306 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036892452 8:12605274-12605296 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1037321863 8:17651179-17651201 GCGTGTGTATGGTGGGAGGTGGG + Intronic
1037766600 8:21776031-21776053 GTGTGTGTGTAGTGAAAAGCAGG + Intronic
1038054925 8:23849218-23849240 GTGTGTCTATGGTGGGATAGAGG + Intronic
1039025914 8:33257696-33257718 GTGTGTGTATGGTGTGAGTGAGG - Intergenic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039435001 8:37553877-37553899 GTGTGTGTGTTGCGGGAGGCGGG - Intergenic
1039567538 8:38562083-38562105 GTGTGTGTAAGGTGGGATGGGGG - Intergenic
1040017090 8:42708525-42708547 GTGTGTGTTTGGAGGGAGGTGGG + Intronic
1040429798 8:47328227-47328249 TTTTGTGTATGGTGTGAGGCAGG + Intronic
1040534809 8:48299537-48299559 GTGTGTGTGTGTTGGGGAGGCGG - Intergenic
1040839799 8:51772683-51772705 CTGTGTGGAAGGTGGGAAGGAGG + Intronic
1040969439 8:53117821-53117843 GTGTGTGTGTGGTAGGGAGAAGG + Intergenic
1041714119 8:60918195-60918217 GTGTGTGTATGGTGGGGAGGGGG + Intergenic
1041853594 8:62421891-62421913 GTCAGTATGTGGTGGGAAGCTGG + Intronic
1042070895 8:64931953-64931975 GTGTGTGTATAGTGGTAGGGGGG - Intergenic
1042448841 8:68921277-68921299 GTGTGTGTATGGTGGGGGGGGGG + Intergenic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1042860558 8:73309064-73309086 GTGTGTGTATGTGGGTAAGGGGG - Intronic
1042910532 8:73821510-73821532 GTGTGTGTGTGGTGGGGGGGTGG + Intronic
1042974333 8:74449019-74449041 TTTTGTGTATGGTGTGAAGGAGG + Intronic
1043184963 8:77137044-77137066 GTGTGTGTATGTTGGGATGTGGG + Intergenic
1044185589 8:89247042-89247064 TTTTGTGTATGGTGGGAGGTAGG + Intergenic
1044466669 8:92514454-92514476 GTGTGTGTGTTGTGGGGTGCAGG + Intergenic
1044646492 8:94449189-94449211 GTGTGTGTGTGGTGGGGGGCGGG - Intronic
1044757485 8:95480117-95480139 GTGTGTGTGTGTTGGGGGGCAGG + Intergenic
1045739143 8:105334150-105334172 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1045797253 8:106060752-106060774 GTGGGTGAGTGGTGGGTAGCCGG - Intergenic
1046144288 8:110137355-110137377 GTGTGTATATGTTGGGATGAGGG + Intergenic
1046217482 8:111167669-111167691 GTGGATTGATGGTGGGAAGCGGG - Intergenic
1046838865 8:118835169-118835191 GTGTGTGTGTGTTGGGAGGGAGG + Intergenic
1047046900 8:121063958-121063980 GTGAGAGTATAGTGAGAAGCTGG - Intergenic
1047243017 8:123110646-123110668 GTGTGTGTATGTTGGGATGTGGG - Intronic
1047248222 8:123162324-123162346 GTGTGTGTGTTCTGGGAGGCGGG + Intergenic
1047498976 8:125428137-125428159 GAGTATGAATGGTGGGAGGCCGG - Intergenic
1047599472 8:126411733-126411755 GTGTGTGTATGGGGGATAGAGGG + Intergenic
1048303861 8:133269996-133270018 GCATGTGTATGGTGGGTAGCAGG - Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048471104 8:134704823-134704845 GTTTGTGTATGGTATGAAGTAGG - Intronic
1048583399 8:135749868-135749890 GTGGGTGCATGGTGTGAGGCAGG + Intergenic
1048933117 8:139332297-139332319 GTGTGTGTGTGTTGGGCAGGGGG - Intergenic
1049454102 8:142678305-142678327 GTGTGTGTCTGGAGGGAGACCGG - Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049805358 8:144536370-144536392 GGGTGTGTCAGGTGGGGAGCAGG - Intronic
1050233559 9:3554816-3554838 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
1050615959 9:7402054-7402076 GTGTGTGTGTGTTGGGAAAGGGG - Intergenic
1051092905 9:13431154-13431176 GTGTGTGTGTGGTGTGTAGCGGG + Intergenic
1051276284 9:15402060-15402082 GTTTGTGTAGGGTGGGTAGTAGG - Intergenic
1051507522 9:17842820-17842842 GTGAGTGTATGCTGGGAGGGAGG - Intergenic
1052141894 9:24996094-24996116 GTCTGTGTAGGATGGGAAGGGGG + Intergenic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052263537 9:26545751-26545773 GAGGGTGTATGCTGGGAAGAGGG + Intergenic
1052443132 9:28524242-28524264 TTGTGTGTATGGTGTGAGGTAGG - Intronic
1052952685 9:34226147-34226169 GTGTGTGTGTGGTGGGCTGGAGG + Intronic
1053056640 9:34996885-34996907 GTGTGTGTGTGCTGGGGAGATGG + Intronic
1053089346 9:35259777-35259799 GTGTGTGTGTAGGGGGATGCGGG + Intronic
1053495777 9:38547051-38547073 GGGTGGGTAGGGTGGGAAGTAGG - Intronic
1055262165 9:74449954-74449976 GTGTGTGTCGGGTGGGGAGGCGG - Intergenic
1055587088 9:77766638-77766660 GGGGGTGTAGGGTGGGAGGCTGG + Intronic
1057381611 9:94572310-94572332 GTGTGTGTGTCGTGGGAGACGGG - Intronic
1057566878 9:96172721-96172743 GTGTGTCATTGGTGGGCAGCAGG - Intergenic
1057675711 9:97134566-97134588 GGGTGGGTAGGGTGGGAAGTAGG - Intergenic
1057869888 9:98709280-98709302 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1058758115 9:108102599-108102621 GTGTGTGTATGTTGGGGAGTAGG + Intergenic
1059065105 9:111075484-111075506 GTGTGTGTATGGTGGGAATTAGG - Intergenic
1059161289 9:112037740-112037762 GTGTGTGTGTGGTGGGTGGGGGG - Intergenic
1059458890 9:114417151-114417173 GTTTGTGAATGGGGGAAAGCTGG + Intronic
1059516544 9:114901045-114901067 GTGTGTGTGTGGTGGGGAGGTGG + Intronic
1059541634 9:115136269-115136291 GTGTGTGTATGTTGGGGGGATGG + Intergenic
1059633086 9:116145694-116145716 GAGGGTGTATGGTGGGAGGAGGG + Intergenic
1060025499 9:120167459-120167481 GTGTGTGTCTGGTGTGTAGAAGG + Intergenic
1060584842 9:124779535-124779557 GTGTGTGTGTGGTGGGGGGGGGG + Intronic
1061037917 9:128123709-128123731 GCAAGTGTATGGTGGGAAGGAGG - Exonic
1061681023 9:132242458-132242480 GTGTAAGTGTGGTGGGAGGCAGG - Exonic
1062118997 9:134824019-134824041 GTGTGTGTGTGTTGGGATGGGGG + Intronic
1062169442 9:135126847-135126869 GTGTGTGTGTGGTGGGGCACAGG - Intergenic
1062447782 9:136602830-136602852 GTGTAGGAATGGTGGGATGCTGG - Intergenic
1062649915 9:137570114-137570136 GTGGGTGGATGGTGGGTAGGAGG - Intronic
1185553981 X:1006072-1006094 GTGTGTGTGTGGTTGGAGCCAGG + Intergenic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1185709724 X:2293809-2293831 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1186310297 X:8310301-8310323 GTGTGTTTATGTGGGGAAGAAGG + Intergenic
1186356279 X:8794569-8794591 GTGGCTGTATGTTGGGAAGATGG - Intronic
1186378024 X:9028798-9028820 GTGGCTGTATGTTGGGAAGTTGG - Intronic
1186394045 X:9189888-9189910 GTGTCTGTGTGGGAGGAAGCAGG + Intergenic
1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG + Intronic
1186789075 X:12979402-12979424 GAGTGTGTATGGGGGGGAGGTGG + Intergenic
1186795066 X:13039298-13039320 GTGGCTGTATGTTGGGAAGATGG - Intronic
1187038478 X:15567280-15567302 GTGTGTGTGTGTTGGGCAGGGGG - Intronic
1187654849 X:21460070-21460092 GAGTATGTATGGTGGGAAGACGG - Intronic
1187749960 X:22451643-22451665 GTGTGTGTATGGTGAGAGATAGG - Intergenic
1187940504 X:24376178-24376200 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
1188805481 X:34583384-34583406 GTGTGTGTATGATGGTAAGTGGG - Intergenic
1189021164 X:37342266-37342288 GTGTGTGTATGGTGGTGTGGTGG + Intergenic
1189036183 X:37495709-37495731 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189037691 X:37509251-37509273 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189132493 X:38514747-38514769 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189582302 X:42419759-42419781 GTGTGTGTGTGGTGGTGGGCAGG + Intergenic
1189690710 X:43613956-43613978 GTTTCTGTATGCTGGGGAGCAGG - Intergenic
1189700694 X:43714774-43714796 GTGTGTGTGTGGTGGGGAAATGG + Intronic
1190056828 X:47186026-47186048 GTATGTGAATGTTGGGGAGCTGG - Intronic
1190057449 X:47189928-47189950 GTGTGTGTATGTTGGGGCGTGGG + Intergenic
1190440636 X:50471298-50471320 GTGTGTGTGTGGTGGGGGGGGGG + Intergenic
1191046242 X:56140602-56140624 GAGGGTGGATGGTGGGAAGAGGG + Intergenic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1191817324 X:65260415-65260437 GAGGGTGTAGGGTGGGAAGAAGG + Intergenic
1191902229 X:66053367-66053389 GTGTGTGTGTGGGGGGGGGCGGG - Intergenic
1192197597 X:69039249-69039271 TTCTGTGTATGGTGTGAGGCAGG + Intergenic
1192545053 X:72006290-72006312 GTGTCAGGTTGGTGGGAAGCTGG - Intergenic
1192639744 X:72850445-72850467 GTGTGTGTATGGGGGGAGGGGGG - Intergenic
1192641967 X:72870360-72870382 GTGTGTGTATGGGGGGAGGGGGG + Intergenic
1193037534 X:76968844-76968866 GTATGTGTATGGTAGGAGGAAGG - Intergenic
1193456621 X:81739061-81739083 GAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1194518343 X:94887654-94887676 GTGTGTGGGTGCTGGGGAGCAGG + Intergenic
1194758405 X:97765014-97765036 GTATGTTTAAGGAGGGAAGCTGG + Intergenic
1194766950 X:97852459-97852481 GTGGGGGTAGGGTGGGAAGTTGG + Intergenic
1194976890 X:100405559-100405581 GTGTGTGTATGGGGGGGGGAGGG - Intronic
1195272226 X:103243103-103243125 CTGTGTGTATGGTGGGAGTGTGG - Intergenic
1195606078 X:106807199-106807221 GTGTGTGTATGGGGGGGGGCGGG - Intronic
1195881260 X:109594885-109594907 GTGTGTCTGTGGTAGGAGGCAGG - Intergenic
1196279800 X:113810741-113810763 GAGTGTGTGAAGTGGGAAGCAGG + Intergenic
1196339103 X:114575576-114575598 GTGTGTGTGTGGGGGGGAGTGGG - Intergenic
1196796022 X:119502587-119502609 GTGTGTGAATGCTGGGATGCAGG + Intergenic
1197163069 X:123345429-123345451 GTGTGTGTGTGTTGTGAAGGGGG - Intronic
1197175009 X:123476364-123476386 GTGTGTGTGTGTTGGGGAGAGGG + Intronic
1197265961 X:124371779-124371801 TTGATTGTATGGTGGGAAGTTGG + Exonic
1197610177 X:128629465-128629487 GTGTGTGTGTGGTGTGAGGGTGG - Intergenic
1197842700 X:130766609-130766631 TTGTATATATGGTGGGAGGCAGG + Intronic
1197867417 X:131034074-131034096 GAGTGTGTATGGTCAGAAACCGG - Intergenic
1198435502 X:136613098-136613120 GTGTGTGTGTGTTGGGGGGCGGG + Intergenic
1198778523 X:140207907-140207929 ATATGTGTATGGTGGGCAGGAGG + Intergenic
1199217695 X:145279860-145279882 GTGTGTTTTTTGTGGGAAACGGG + Intergenic
1199272372 X:145898993-145899015 GTGTATGTTTGCTGGGAATCTGG + Intergenic
1199921456 X:152409040-152409062 TTTTATGTATGGTGAGAAGCAGG - Intronic
1200087777 X:153617856-153617878 TTTTCTGTATGGTGTGAAGCTGG + Intergenic
1200282284 X:154787091-154787113 GTGTGTGTGTGTTTGGGAGCAGG - Intronic
1200887445 Y:8282825-8282847 GTGTGTCCACGGTGGGAAACTGG + Intergenic
1201490881 Y:14540114-14540136 GTGTGTGTGTGGTGGGGGGGCGG + Intronic