ID: 900330669

View in Genome Browser
Species Human (GRCh38)
Location 1:2133017-2133039
Sequence ACAGGACACAGCACACAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 0, 2: 6, 3: 71, 4: 604}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900330669_900330674 4 Left 900330669 1:2133017-2133039 CCGGGCTGTGTGCTGTGTCCTGT 0: 1
1: 0
2: 6
3: 71
4: 604
Right 900330674 1:2133044-2133066 GAGTTTGTTCACCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 147
900330669_900330677 22 Left 900330669 1:2133017-2133039 CCGGGCTGTGTGCTGTGTCCTGT 0: 1
1: 0
2: 6
3: 71
4: 604
Right 900330677 1:2133062-2133084 GGAGGCTCCCTGATGAGCCCTGG 0: 1
1: 0
2: 1
3: 26
4: 232
900330669_900330673 1 Left 900330669 1:2133017-2133039 CCGGGCTGTGTGCTGTGTCCTGT 0: 1
1: 0
2: 6
3: 71
4: 604
Right 900330673 1:2133041-2133063 GGAGAGTTTGTTCACCCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900330669 Original CRISPR ACAGGACACAGCACACAGCC CGG (reversed) Intronic