ID: 900330672

View in Genome Browser
Species Human (GRCh38)
Location 1:2133035-2133057
Sequence GGGTGAACAAACTCTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900330672_900330677 4 Left 900330672 1:2133035-2133057 CCTGTGGGAGAGTTTGTTCACCC 0: 1
1: 0
2: 0
3: 10
4: 93
Right 900330677 1:2133062-2133084 GGAGGCTCCCTGATGAGCCCTGG 0: 1
1: 0
2: 1
3: 26
4: 232
900330672_900330680 15 Left 900330672 1:2133035-2133057 CCTGTGGGAGAGTTTGTTCACCC 0: 1
1: 0
2: 0
3: 10
4: 93
Right 900330680 1:2133073-2133095 GATGAGCCCTGGCGTCTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900330672 Original CRISPR GGGTGAACAAACTCTCCCAC AGG (reversed) Intronic