ID: 900330672

View in Genome Browser
Species Human (GRCh38)
Location 1:2133035-2133057
Sequence GGGTGAACAAACTCTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900330672_900330677 4 Left 900330672 1:2133035-2133057 CCTGTGGGAGAGTTTGTTCACCC 0: 1
1: 0
2: 0
3: 10
4: 93
Right 900330677 1:2133062-2133084 GGAGGCTCCCTGATGAGCCCTGG 0: 1
1: 0
2: 1
3: 26
4: 232
900330672_900330680 15 Left 900330672 1:2133035-2133057 CCTGTGGGAGAGTTTGTTCACCC 0: 1
1: 0
2: 0
3: 10
4: 93
Right 900330680 1:2133073-2133095 GATGAGCCCTGGCGTCTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900330672 Original CRISPR GGGTGAACAAACTCTCCCAC AGG (reversed) Intronic
900313860 1:2047670-2047692 GGCTGAACAAAGTCTGACACTGG + Intergenic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
906684184 1:47752385-47752407 GGCTGAGCCAACTCTCCCAGCGG - Intergenic
907859569 1:58338685-58338707 GTGTGAACAAACACTTGCACAGG + Intronic
908299213 1:62745435-62745457 GGAAGAACAGACTCTTCCACTGG - Intergenic
909565995 1:77054203-77054225 GAGTGAACATCTTCTCCCACAGG - Intronic
912568554 1:110606216-110606238 GGATGAACTTACTCTCCCTCCGG + Intronic
914219172 1:145662699-145662721 AGGTGAGCAAACTCTGCCACTGG - Intronic
914471755 1:147985570-147985592 AGGTGAGCAAACTCTGCCACTGG - Intronic
917985124 1:180308767-180308789 GGGTGAGCAAACACTCTAACTGG - Intronic
1068526891 10:58140684-58140706 TGGTCAATAAACTCTTCCACTGG - Intergenic
1070406610 10:76103367-76103389 TGATGAGGAAACTCTCCCACTGG - Intronic
1070741388 10:78905518-78905540 GGGTGAACAAAAACACACACTGG - Intergenic
1071522817 10:86341493-86341515 GGGTGAGCATCCTCCCCCACAGG + Intronic
1079416063 11:20237808-20237830 GGCAGAACAACCTCTCCCAGTGG + Intergenic
1081523619 11:43907542-43907564 GGGAGAAAAACCTCTACCACTGG - Intronic
1084509716 11:69595615-69595637 GGGTGCCCACCCTCTCCCACTGG + Intergenic
1085326667 11:75611442-75611464 GAGTTACCAAACTTTCCCACAGG - Intronic
1092052256 12:5480296-5480318 GGGTGGAAAAACAATCCCACCGG + Intronic
1105766881 13:23568481-23568503 TGGTGAATAAACTCTTCCACTGG + Intergenic
1110631893 13:77718171-77718193 GAGTGAACAAACTGTCTCAAGGG + Intronic
1112887381 13:104191420-104191442 GTGTGAAAAAAATCTCGCACCGG + Intergenic
1114409351 14:22486130-22486152 GGGAGAATAAACTCACCCAAAGG - Intergenic
1116172487 14:41420967-41420989 GGGTAAATAAACTCTCACCCAGG - Intergenic
1116826357 14:49677054-49677076 GGCTGAACCCACTCTCCCCCAGG - Intronic
1119174880 14:72561747-72561769 GGGTCATCAAACTCTGCCTCTGG + Intronic
1121248496 14:92482395-92482417 GGGGGAACAGACTCACCCAGAGG - Intronic
1121693555 14:95894706-95894728 GGAAGAGCAAGCTCTCCCACAGG + Intergenic
1122786220 14:104164399-104164421 GGGTGAACGAACACACACACTGG - Intronic
1124556762 15:30733223-30733245 GGGTGAGTTAACTCTCCTACAGG - Intronic
1124674513 15:31672513-31672535 GGGTGAGTTAACTCTCCTACAGG + Intronic
1129116360 15:73367575-73367597 GGGTCAACAAATTCTCCCTAAGG - Exonic
1130681970 15:86004924-86004946 GGGTGAACAAGCTTTTCCAGTGG + Intergenic
1134088124 16:11372515-11372537 GGGACATGAAACTCTCCCACTGG - Exonic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1135926402 16:26697683-26697705 AAGTGAAGAAACTCTCCCAGTGG + Intergenic
1145904926 17:28511065-28511087 CAGGGAACAATCTCTCCCACTGG + Intronic
1146399890 17:32494212-32494234 GGGTGAGCAGAGTCACCCACAGG - Exonic
1148048314 17:44757550-44757572 GGGAGCACAATCTCTCCCTCTGG + Intergenic
1149590021 17:57822109-57822131 ATGTGGACCAACTCTCCCACTGG - Intergenic
1152068500 17:78124167-78124189 GGGTGAAGCAACCCTGCCACAGG + Exonic
1152355195 17:79803487-79803509 GGGAGCACCAACCCTCCCACGGG + Intergenic
1152442800 17:80319311-80319333 AGGTGAACAATCTCTCCTCCTGG + Exonic
1158115123 18:53986932-53986954 GGGTGATCAAATTCCCCCATTGG + Intergenic
1158325239 18:56306800-56306822 GTGTGAGCAAACCCTCCAACAGG + Intergenic
1159804385 18:72938442-72938464 TGCTTTACAAACTCTCCCACAGG - Intergenic
1164487683 19:28674412-28674434 GGGTCAGCAAACTCTGGCACAGG + Intergenic
1167694097 19:51003776-51003798 TGGAGAACAAACTCTGTCACTGG - Exonic
925807495 2:7665289-7665311 GGTTTAACAACCTCTCCCAGCGG - Intergenic
927053241 2:19349794-19349816 GGGTGAACACACACACACACAGG - Intergenic
928260439 2:29761797-29761819 GGGTGAGCAATCTCTCCCTTTGG + Intronic
929020679 2:37549585-37549607 TGGTGAATAAGGTCTCCCACTGG + Intergenic
933952499 2:87342626-87342648 GGGTGAACAAGCTCTCGGCCCGG + Intergenic
934660802 2:96142759-96142781 GCGTGCACACACGCTCCCACAGG + Intergenic
935816431 2:106850284-106850306 GAGAGAGCAAACTCTGCCACAGG - Intronic
937000982 2:118467379-118467401 GGGTGAACAATCTATCCCCTGGG + Intergenic
939677905 2:145095317-145095339 GGGTCAAGAATATCTCCCACTGG - Intergenic
948762260 2:240199422-240199444 AAGTGACCCAACTCTCCCACAGG - Intergenic
1175146840 20:56903401-56903423 GGGTCGACAAACTCTACCTCTGG - Intergenic
1178024946 21:28455857-28455879 GGTTGCCCAAACTGTCCCACAGG + Intergenic
1178512114 21:33214267-33214289 GGGTGAACATACCCCACCACTGG + Intergenic
1182172744 22:28249421-28249443 GGTAGAACAAAATCTCCCACAGG + Intronic
950334630 3:12183509-12183531 GGGAAAACAGACCCTCCCACTGG + Intronic
952195971 3:31075716-31075738 CTGTGACCAAAGTCTCCCACAGG - Intergenic
953509732 3:43523973-43523995 GGGTAAACAAGCTCACCCAGGGG + Intronic
957330557 3:78758039-78758061 GGCTGAGCAGACTCTCCCAAGGG - Intronic
964680149 3:159329303-159329325 GCAGGAACAAACTGTCCCACAGG - Intronic
969070550 4:4534908-4534930 GGGTCCACAAACTGGCCCACAGG - Intronic
976373375 4:84315951-84315973 GGATGAACACACTCTGCCTCAGG + Intergenic
980966162 4:139523119-139523141 GGGTGAGGAAACTCTCTTACAGG + Intronic
981401077 4:144314180-144314202 TCCTGAACAAACACTCCCACTGG - Intergenic
981401091 4:144314243-144314265 TCCTGAACAAACACTCCCACTGG - Intergenic
986060076 5:4179736-4179758 CACTGAACAAACTCTCCCAGTGG + Intergenic
987126379 5:14816823-14816845 TGGCAAACAAACTCTCCCACGGG + Intronic
991666004 5:69000584-69000606 GGGTGAATAAACTGTCCAACTGG - Intergenic
993605897 5:89990570-89990592 GGGTGAACAACAGCACCCACGGG - Intergenic
997431364 5:133843397-133843419 GACTGAAGAGACTCTCCCACTGG - Intergenic
997469452 5:134108776-134108798 GGATGGCCAAACTCTCCCCCAGG + Intergenic
999531055 5:152464044-152464066 GGGGGAAAAATCTTTCCCACTGG - Intergenic
1001240241 5:170063390-170063412 GGGTGCACAAACACTTCCAGGGG + Intronic
1001688457 5:173614155-173614177 GAACGAACAAACTCTCCCAGAGG - Intronic
1003112496 6:3261478-3261500 GGGTGACCAAAACCACCCACAGG - Intronic
1003843920 6:10152707-10152729 GGATGAACAAACTCTCTAAAGGG + Intronic
1005126082 6:22448147-22448169 GGGTAAACAAAGGATCCCACGGG + Intergenic
1006166990 6:32070933-32070955 GGGAGAACTAAGGCTCCCACTGG + Intronic
1006567595 6:34973726-34973748 AGCTGAACAAAATCTCCCACAGG - Intronic
1007407588 6:41643928-41643950 GGGGGACCTGACTCTCCCACAGG - Intronic
1015681111 6:135809507-135809529 GGGATAACAAACTGTACCACTGG + Intergenic
1020814748 7:12891587-12891609 GGGTAAACAAACTCTCCCTTGGG - Intergenic
1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG + Intronic
1029681172 7:102111817-102111839 GGCTGACCCAACTCTCCCCCTGG - Intronic
1031827864 7:126588830-126588852 GGGTGAACACACACCCTCACTGG + Intronic
1034323396 7:150206313-150206335 GGTTGAACAAGCACTCCCAGGGG - Intergenic
1038244282 8:25840263-25840285 GGCTGAGCAACCTCTCCAACAGG + Intergenic
1044280690 8:90352059-90352081 GTGAGAACAAACTCTCCTGCAGG - Intergenic
1050585852 9:7110615-7110637 TGGTGCACATACTCTTCCACAGG + Intergenic
1055018448 9:71644189-71644211 GGGTGAAGCAATCCTCCCACTGG - Intergenic
1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG + Intronic
1062432991 9:136534247-136534269 TGCTGAACAAACTCTTCCACAGG - Intronic
1203490976 Un_GL000224v1:104255-104277 GCCTGACCAAACCCTCCCACTGG + Intergenic
1203503600 Un_KI270741v1:46128-46150 GCCTGACCAAACCCTCCCACTGG + Intergenic
1189561290 X:42193872-42193894 AGGTGACCAATCCCTCCCACTGG + Intergenic
1197845915 X:130802626-130802648 GGGAGACCAAACTCTGCCACTGG - Intronic
1200775779 Y:7168888-7168910 GGGTGAGCTAGCTCTTCCACGGG - Intergenic