ID: 900330675

View in Genome Browser
Species Human (GRCh38)
Location 1:2133055-2133077
Sequence TCATCAGGGAGCCTCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900330675_900330683 27 Left 900330675 1:2133055-2133077 CCCTGCTGGAGGCTCCCTGATGA 0: 1
1: 0
2: 3
3: 18
4: 224
Right 900330683 1:2133105-2133127 TCTTTACTGATTGAACTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 76
900330675_900330680 -5 Left 900330675 1:2133055-2133077 CCCTGCTGGAGGCTCCCTGATGA 0: 1
1: 0
2: 3
3: 18
4: 224
Right 900330680 1:2133073-2133095 GATGAGCCCTGGCGTCTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900330675 Original CRISPR TCATCAGGGAGCCTCCAGCA GGG (reversed) Intronic