ID: 900330676

View in Genome Browser
Species Human (GRCh38)
Location 1:2133056-2133078
Sequence CTCATCAGGGAGCCTCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900330676_900330683 26 Left 900330676 1:2133056-2133078 CCTGCTGGAGGCTCCCTGATGAG 0: 1
1: 0
2: 0
3: 19
4: 174
Right 900330683 1:2133105-2133127 TCTTTACTGATTGAACTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 76
900330676_900330680 -6 Left 900330676 1:2133056-2133078 CCTGCTGGAGGCTCCCTGATGAG 0: 1
1: 0
2: 0
3: 19
4: 174
Right 900330680 1:2133073-2133095 GATGAGCCCTGGCGTCTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900330676 Original CRISPR CTCATCAGGGAGCCTCCAGC AGG (reversed) Intronic