ID: 900330677

View in Genome Browser
Species Human (GRCh38)
Location 1:2133062-2133084
Sequence GGAGGCTCCCTGATGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900330672_900330677 4 Left 900330672 1:2133035-2133057 CCTGTGGGAGAGTTTGTTCACCC 0: 1
1: 0
2: 0
3: 10
4: 93
Right 900330677 1:2133062-2133084 GGAGGCTCCCTGATGAGCCCTGG 0: 1
1: 0
2: 1
3: 26
4: 232
900330669_900330677 22 Left 900330669 1:2133017-2133039 CCGGGCTGTGTGCTGTGTCCTGT 0: 1
1: 0
2: 6
3: 71
4: 604
Right 900330677 1:2133062-2133084 GGAGGCTCCCTGATGAGCCCTGG 0: 1
1: 0
2: 1
3: 26
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900330677 Original CRISPR GGAGGCTCCCTGATGAGCCC TGG Intronic