ID: 900330680

View in Genome Browser
Species Human (GRCh38)
Location 1:2133073-2133095
Sequence GATGAGCCCTGGCGTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900330676_900330680 -6 Left 900330676 1:2133056-2133078 CCTGCTGGAGGCTCCCTGATGAG 0: 1
1: 0
2: 0
3: 19
4: 174
Right 900330680 1:2133073-2133095 GATGAGCCCTGGCGTCTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 145
900330672_900330680 15 Left 900330672 1:2133035-2133057 CCTGTGGGAGAGTTTGTTCACCC 0: 1
1: 0
2: 0
3: 10
4: 93
Right 900330680 1:2133073-2133095 GATGAGCCCTGGCGTCTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 145
900330675_900330680 -5 Left 900330675 1:2133055-2133077 CCCTGCTGGAGGCTCCCTGATGA 0: 1
1: 0
2: 3
3: 18
4: 224
Right 900330680 1:2133073-2133095 GATGAGCCCTGGCGTCTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900330680 Original CRISPR GATGAGCCCTGGCGTCTGCT AGG Intronic
900330680 1:2133073-2133095 GATGAGCCCTGGCGTCTGCTAGG + Intronic
900579242 1:3400342-3400364 GCTGACCCCTGGGGTCTGGTGGG - Intronic
900658410 1:3771552-3771574 GCTGGGCCCCGGCCTCTGCTGGG - Exonic
902360299 1:15938827-15938849 GATGATCCCTGCCGCCTGCTTGG - Exonic
902503324 1:16924570-16924592 GATGGGCCCTGGAGTCAGGTTGG + Intronic
903170167 1:21547673-21547695 GTTGAGCCCTGGCGTCAGCCTGG + Intronic
903850006 1:26300411-26300433 GATGAGCCCTGCAGAGTGCTGGG - Intronic
904868816 1:33603495-33603517 CAGGACCCCTGGCCTCTGCTTGG - Intronic
905168494 1:36097283-36097305 TGTGAGTCCTGGCCTCTGCTGGG - Exonic
914436584 1:147665742-147665764 GAGGACCCTTGGCGTCTCCTAGG + Intronic
915128985 1:153684182-153684204 GGTGAGCCCTGGTGTGTGCCAGG + Intronic
917834919 1:178933885-178933907 CAGGAGCCCTGCCCTCTGCTAGG + Intergenic
920033977 1:203053843-203053865 GATGAGCCAGGGGGTCTGGTGGG + Exonic
920435349 1:205943509-205943531 GGTGAGCCCCGGCTTCTGATTGG + Intergenic
920549428 1:206846163-206846185 GAGGAGCCCAGGCCTCAGCTGGG - Intergenic
924352179 1:243126571-243126593 GAAGAGCCCTAGCTTCTGGTTGG + Exonic
1069795951 10:71051779-71051801 GATGAGAAGTGGCTTCTGCTGGG + Intergenic
1070722261 10:78764907-78764929 GCTGAGCCTGGGTGTCTGCTGGG - Intergenic
1071334331 10:84589046-84589068 GCTGAGCCCTGGGGTTTGTTAGG - Intergenic
1072801314 10:98394170-98394192 GATGAGCGCTTGCCTGTGCTAGG - Intronic
1075564721 10:123494987-123495009 GATGGTCCTTGGCCTCTGCTAGG + Intergenic
1077215468 11:1393630-1393652 GTTGAGCCCTGGTGGCTGCCAGG + Intronic
1084187570 11:67482961-67482983 GCTGAGCGCGCGCGTCTGCTCGG - Intergenic
1084981553 11:72831624-72831646 GGTGACCCCTGGTGGCTGCTGGG - Intronic
1089174698 11:116540128-116540150 GCTGAGCCCTGGCATCAGCCTGG + Intergenic
1089329408 11:117679270-117679292 CATGAATCCTGGTGTCTGCTAGG - Intronic
1089631687 11:119788217-119788239 GAGGAGCCAGGGCCTCTGCTTGG + Intergenic
1089689231 11:120176571-120176593 GAGGAGCCCTGGACTCTGATGGG - Intronic
1089792302 11:120953801-120953823 GATGAGCCCTGGTGGCTCCCAGG + Intronic
1090586896 11:128222826-128222848 AGGGAGCCCTGGCTTCTGCTTGG + Intergenic
1101504237 12:105331190-105331212 GGTGAGCCCCGGCGGCTGCAGGG - Intronic
1103344171 12:120238335-120238357 CATGAGGCTTGGCATCTGCTTGG - Intronic
1105891951 13:24688383-24688405 GACGATCTCAGGCGTCTGCTTGG - Exonic
1107379864 13:39845309-39845331 CATGACCCCTGGCTTCTGGTTGG - Intergenic
1108378638 13:49836689-49836711 GCTGATCCCTGACGTCTCCTAGG + Intergenic
1112502407 13:99953242-99953264 GGTGAGTCCTGGCCGCTGCTGGG - Intergenic
1113373173 13:109740971-109740993 GAGGAGTCCTGGCGAGTGCTCGG + Intergenic
1121754366 14:96391251-96391273 GAAGACCCCTGGTGTCGGCTGGG - Intergenic
1122245425 14:100399743-100399765 GATGAGCTGTGGCATCAGCTTGG - Intronic
1124010247 15:25832370-25832392 AATGAGGCCTTGTGTCTGCTAGG - Intronic
1124097443 15:26661727-26661749 GATGAGCTCTTGCATCTCCTTGG - Intronic
1124202301 15:27688928-27688950 GAAGAGCCTTGGCGTGTGCCTGG - Intergenic
1124455886 15:29842492-29842514 GGTGAACCATGGTGTCTGCTTGG - Intronic
1124719222 15:32097511-32097533 GTTGAACCCTGGTGTCTGGTGGG - Intronic
1125972024 15:43919577-43919599 GAAGAGCCCTGTCCTCTTCTGGG - Intronic
1128495597 15:68196733-68196755 GACGAGGCCTGGGGTCTTCTAGG - Intronic
1130295771 15:82646632-82646654 CAAGAGCCCAGGCGTCTGCCTGG + Intronic
1131557864 15:93414855-93414877 GCTGTGCTCTGTCGTCTGCTAGG + Intergenic
1134689413 16:16181476-16181498 GATGAGCCCTGGGGACTCCTGGG + Intronic
1136044274 16:27602993-27603015 GAAAAGCCCTGGCATCAGCTGGG - Intronic
1136910438 16:34140874-34140896 GAGCAGGCCTGGCGTCTGCCCGG + Intergenic
1141460412 16:84175640-84175662 CCTGAGCCCTGGGCTCTGCTTGG - Intronic
1142096116 16:88240841-88240863 GAGGGTCCCTGGCGTCAGCTGGG - Intergenic
1142149421 16:88506123-88506145 CATGATGCCTGGCCTCTGCTGGG - Intronic
1142268745 16:89078124-89078146 GGTGAGCCCTGGAGTTTGCCAGG - Intergenic
1142885580 17:2910362-2910384 GGTGAGGCCAGGCCTCTGCTTGG + Intronic
1147536668 17:41326409-41326431 CCTGAGCCCTGGCCTCTGCTGGG - Intergenic
1148954578 17:51343197-51343219 AATGAGGCCTGGCATCTTCTGGG + Intergenic
1148984585 17:51610644-51610666 GATGAGCCCCGGGGGCTGCAGGG + Intergenic
1150128616 17:62654124-62654146 GATGACCCCTCGCCTCTGCGTGG + Intronic
1152555550 17:81051315-81051337 CAAGGGCCCTGGCGTATGCTGGG - Intronic
1157706681 18:49813475-49813497 GCAGAGCCATGGCGGCTGCTGGG + Exonic
1163721693 19:18900925-18900947 CCAGAGCCCTGGTGTCTGCTTGG + Intronic
1163777773 19:19228017-19228039 GGGGAGCCCTGGAGTCTTCTTGG + Exonic
1164094643 19:21995985-21996007 AATAAGACCTGGCCTCTGCTGGG - Intronic
1165342665 19:35224062-35224084 GATGAGCCCTGCCCTATCCTGGG + Intergenic
1165417260 19:35702501-35702523 GAGGCGCCCTGGCGTCTCATTGG + Intergenic
1167124031 19:47537112-47537134 AATGAGCTCTGGCTTCTTCTGGG + Intronic
1168338091 19:55607811-55607833 GATGAGCCCTGGATTCCACTAGG + Intronic
925145447 2:1580537-1580559 GAGGAGAACTGGCCTCTGCTTGG - Intergenic
925159881 2:1676502-1676524 GAGGGGCCCTGACCTCTGCTGGG - Intronic
926238286 2:11066430-11066452 GATGGGTCCTGGCATCTTCTTGG - Intergenic
926242862 2:11101520-11101542 GAGGTGCCCTGACGTCTGGTTGG - Intergenic
926299648 2:11593335-11593357 GGTTAGCCCTGGGGTCAGCTTGG + Intronic
927138874 2:20116203-20116225 GAGGAGCCCGGGTGACTGCTGGG + Intergenic
930194321 2:48494147-48494169 GAGGAGCCCTGGAGTCTGGGAGG + Intronic
930297149 2:49569299-49569321 GATGAGCAGTGGGGTCTGATGGG + Intergenic
933788928 2:85868101-85868123 GATAAGCCCTGGCTTCTCCAAGG - Intronic
933842482 2:86298583-86298605 GTCCAGCCCTGGCCTCTGCTGGG + Intronic
934776330 2:96940042-96940064 GCTGGGCCCTGGGGTCTCCTGGG + Intronic
937444782 2:121948795-121948817 CTTGAGCCCTGGCATCTGCCTGG + Intergenic
945923744 2:215782643-215782665 GATGACCCCTGGAGACTCCTGGG - Intergenic
947524589 2:230870462-230870484 GCTGAGCCCGGGTGTGTGCTGGG + Intronic
948079748 2:235196022-235196044 GGTGAGCCCTGGTGGATGCTCGG + Intergenic
948116144 2:235495151-235495173 GCTGCCCCCAGGCGTCTGCTGGG - Intronic
1169918326 20:10706032-10706054 GAGGAGCCAGGGCGTCGGCTCGG + Intergenic
1170525129 20:17228719-17228741 GAGGAGCCCTGGCGGTGGCTGGG - Intronic
1175139453 20:56849023-56849045 GGTGAGCCATGGGGTCTGCGTGG + Intergenic
1175368502 20:58471234-58471256 AAGGAGCCCTGGGGGCTGCTTGG + Intronic
1175974635 20:62704378-62704400 GGTGAGCCCTGGCCTCTGTGTGG + Intergenic
1176431671 21:6579846-6579868 GGCCAGCCCTGGGGTCTGCTGGG + Intergenic
1177452537 21:21289976-21289998 GATGAGACATGGAGTCTGATTGG + Intronic
1179707065 21:43187308-43187330 GGCCAGCCCTGGGGTCTGCTGGG + Intergenic
1182356347 22:29723880-29723902 GATGTCCCTTGGAGTCTGCTGGG + Intronic
1183477170 22:38042146-38042168 GAGGAACCCTGGTGTCTGCTTGG + Intergenic
1183686309 22:39363205-39363227 CAGGAGCCCTGGCGTTTGGTGGG + Intronic
954686909 3:52376034-52376056 GAGGAGCCCTGGGCTCTGGTTGG + Intronic
955073306 3:55589727-55589749 CATGAGCCCTGTCTCCTGCTGGG - Intronic
955650158 3:61185406-61185428 GATGATCACTTGTGTCTGCTTGG - Intronic
956897273 3:73675636-73675658 GATAAGCCCTGTTGTTTGCTGGG + Intergenic
960284949 3:115817770-115817792 GGTGAGTGCTGGCTTCTGCTAGG - Intronic
964307298 3:155355364-155355386 GATGACCCCTGGCTTCTGGCTGG - Intergenic
966917840 3:184594619-184594641 GGCCAGCCCTGGCGCCTGCTGGG + Intronic
968048268 3:195635794-195635816 GCAGCGACCTGGCGTCTGCTCGG + Intergenic
968099136 3:195953826-195953848 GCAGCGACCTGGCGTCTGCTCGG - Intergenic
968306342 3:197654127-197654149 GCAGCGACCTGGCGTCTGCTCGG - Intergenic
969854209 4:9985957-9985979 GTTCAGCCCTGGGGTCTACTAGG + Intronic
971140919 4:23924035-23924057 GCTCAGCCCTGGCCTCTCCTGGG + Intergenic
975659140 4:76671158-76671180 CATGAGGCCAGGGGTCTGCTTGG - Intronic
975801765 4:78067530-78067552 CATGAGCCCTGGGATCAGCTAGG - Intronic
978200579 4:106019937-106019959 AATGAGATCTGGCATCTGCTAGG + Intergenic
979249764 4:118553956-118553978 GAAGAGCCCTAGCTTCTGGTTGG - Intergenic
984056285 4:174933199-174933221 GATGTGCTCTGTCCTCTGCTGGG - Intronic
984769125 4:183422439-183422461 GATGAGCACTGGCTCCTGCCGGG + Intergenic
984984216 4:185311835-185311857 GTAGAACCCTGGCGTATGCTGGG - Intronic
985504756 5:272289-272311 GCAGCGACCTGGCGTCTGCTCGG + Intronic
985743358 5:1633306-1633328 GCAGCGACCTGGCGTCTGCTCGG - Intergenic
986466308 5:8028415-8028437 GTTCAGCCCTGTCATCTGCTGGG + Intergenic
997434668 5:133865642-133865664 GATGAGCCCTGCACTCAGCTGGG - Intergenic
997761663 5:136454461-136454483 GATTATCCCAGACGTCTGCTTGG - Intergenic
1000053120 5:157578989-157579011 GATGAGGCCTGGCTTCTCCTCGG - Intergenic
1002570949 5:180139073-180139095 GATGTGCTCTGGCCTCTGCCTGG - Intronic
1002925291 6:1602212-1602234 GAGGAGCCTGGGCATCTGCTGGG + Intergenic
1003440109 6:6132827-6132849 GGTGAGTCTTAGCGTCTGCTTGG + Intergenic
1003693119 6:8374439-8374461 GATGAGCCCTGGAGGGAGCTGGG + Intergenic
1006028028 6:31159606-31159628 GATGAGGCCAGGCTCCTGCTGGG - Exonic
1008197890 6:48547557-48547579 GAATGGCACTGGCGTCTGCTAGG - Intergenic
1020491598 7:8791740-8791762 CATGGGTGCTGGCGTCTGCTTGG + Intergenic
1023592491 7:41794698-41794720 CATGAGCCCTGTCCTCTCCTCGG + Intergenic
1023978768 7:45053611-45053633 GCTGCTCCCTGGCTTCTGCTAGG + Intronic
1031886876 7:127252944-127252966 GAAGAGACTTGGCGCCTGCTAGG - Exonic
1035252905 7:157608750-157608772 AATCAGCCCTGGCCTGTGCTCGG + Intronic
1037611069 8:20476734-20476756 TGTGAGCCCTGGGCTCTGCTAGG - Intergenic
1040287246 8:46106726-46106748 GGTGAGCCCTGGAGGCTTCTGGG + Intergenic
1040288613 8:46112958-46112980 GTAGAGCCCTGGTGTCTTCTGGG + Intergenic
1040295419 8:46146533-46146555 GAAGTGCCCTGGTGTCTTCTGGG + Intergenic
1040329611 8:46379185-46379207 GATTAGCCCTGGTGGCTTCTGGG - Intergenic
1040339914 8:46435251-46435273 GAACAGCCCTGGGGTCTTCTGGG + Intergenic
1045419294 8:101998432-101998454 CATGACCCCTGGCTTCTGTTAGG + Intronic
1046856404 8:119036978-119037000 CATGTGCTCTGGCTTCTGCTTGG - Intronic
1049479712 8:142816101-142816123 GGTGAGCCCTGCAGCCTGCTGGG - Intergenic
1049639991 8:143711188-143711210 GAGGAGACCTGGTTTCTGCTGGG + Intronic
1049745084 8:144259858-144259880 GTTGAGCCCTGGGGTCAGCGGGG + Intronic
1056498527 9:87185222-87185244 GATGAGCCCAGACGTCAGCCCGG + Intergenic
1057261749 9:93588343-93588365 GGTGAGCTCTGGAGTCAGCTAGG + Intronic
1060801045 9:126546087-126546109 GAAGGGCCCTGGGGTCTGCGTGG + Intergenic
1060801609 9:126548885-126548907 GAAGGGCCCTGGGGTCTGCGTGG - Intergenic
1061150888 9:128827354-128827376 GAGGAGCCATGGAGACTGCTGGG - Intronic
1061681056 9:132242610-132242632 GGTGAGGCCTGGGGTCTGGTGGG - Exonic
1185705727 X:2264932-2264954 GGTGCTCCCTGGAGTCTGCTGGG - Intronic
1187443863 X:19343933-19343955 ACTGAGGCGTGGCGTCTGCTGGG + Exonic
1192202398 X:69074903-69074925 GGTGAGCCCTTGGGTCTGCCTGG - Intergenic