ID: 900330680

View in Genome Browser
Species Human (GRCh38)
Location 1:2133073-2133095
Sequence GATGAGCCCTGGCGTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900330676_900330680 -6 Left 900330676 1:2133056-2133078 CCTGCTGGAGGCTCCCTGATGAG 0: 1
1: 0
2: 0
3: 19
4: 174
Right 900330680 1:2133073-2133095 GATGAGCCCTGGCGTCTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 145
900330675_900330680 -5 Left 900330675 1:2133055-2133077 CCCTGCTGGAGGCTCCCTGATGA 0: 1
1: 0
2: 3
3: 18
4: 224
Right 900330680 1:2133073-2133095 GATGAGCCCTGGCGTCTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 145
900330672_900330680 15 Left 900330672 1:2133035-2133057 CCTGTGGGAGAGTTTGTTCACCC 0: 1
1: 0
2: 0
3: 10
4: 93
Right 900330680 1:2133073-2133095 GATGAGCCCTGGCGTCTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900330680 Original CRISPR GATGAGCCCTGGCGTCTGCT AGG Intronic