ID: 900332566

View in Genome Browser
Species Human (GRCh38)
Location 1:2143430-2143452
Sequence CTGGAAAGAATCTGAATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900332566 Original CRISPR CTGGAAAGAATCTGAATTGG AGG Intronic
900269870 1:1781551-1781573 CGGGCAAGAAGCAGAATTGGTGG + Intergenic
900332566 1:2143430-2143452 CTGGAAAGAATCTGAATTGGAGG + Intronic
901170277 1:7252045-7252067 CTGAAAGGAATCTAAAGTGGGGG - Intronic
901273256 1:7970217-7970239 ATGGAAGTAAGCTGAATTGGTGG + Intronic
901673591 1:10869816-10869838 CAGGACAGAGTCTGGATTGGAGG - Intergenic
902281637 1:15379001-15379023 CTGGAAAGGGTCTGAAGTGAAGG + Intronic
903509278 1:23862148-23862170 CTGGATAGAATCTGAATACAAGG + Intronic
905764794 1:40591400-40591422 CTGGAAAGAAGGTGAAGTTGAGG - Intergenic
907444111 1:54496897-54496919 CTGACAATAATTTGAATTGGGGG + Intergenic
908374916 1:63526299-63526321 CTGGAAAGAACCAAATTTGGTGG - Intronic
908462410 1:64357968-64357990 CTGGAGAAACTCTGAGTTGGTGG - Intergenic
911868496 1:103059770-103059792 AAGGAAAGAATCTGAGTTTGAGG + Intronic
912849916 1:113114703-113114725 CTGGGAAGAGTCACAATTGGGGG - Exonic
913697887 1:121345569-121345591 CTGGAAAAATTCTGAAATGGGGG + Intronic
914139667 1:144934482-144934504 CTGGAAAAATTCTGAAATGGGGG - Intronic
914973048 1:152328923-152328945 CAGCAAAGAATTTGAATAGGGGG - Intergenic
918857372 1:189775386-189775408 ATGAAAAGAACATGAATTGGGGG - Intergenic
919658773 1:200222802-200222824 CAGGAATGGATCTAAATTGGGGG + Intergenic
919775692 1:201192664-201192686 CTGGAAGGATTCTAGATTGGTGG + Intronic
920485282 1:206364219-206364241 CTGGAAAAATTCTGAAATGGGGG + Intronic
920567675 1:206988373-206988395 CTGGATAGAATCTGAGATGCAGG - Intergenic
920710557 1:208290666-208290688 CTGGTGAGAAACTAAATTGGTGG + Intergenic
922039409 1:221881742-221881764 GAGGAAGGAATCTTAATTGGAGG + Intergenic
1062819027 10:520070-520092 CTGGAAAACATCTGAATTAATGG + Intronic
1064008601 10:11717180-11717202 CTGGAAAGAATTGAAATTAGAGG - Intergenic
1067455701 10:46418123-46418145 CTGGCCAGGATCTGATTTGGAGG + Intergenic
1067631503 10:47966516-47966538 CTGGCCAGGATCTGATTTGGAGG - Intergenic
1067927174 10:50521527-50521549 CTGGACTGGATCTGAATTGGAGG - Intronic
1069750407 10:70741748-70741770 CTGTAAAGAGTCTGAATTTGGGG + Intronic
1071045091 10:81363583-81363605 ATGGAAAGAATCAGAATTTCTGG + Intergenic
1074108452 10:110405922-110405944 CTGGAAGGAATCTAACTGGGCGG - Intergenic
1074666890 10:115737761-115737783 TTAGAAAGAAGCAGAATTGGGGG - Intronic
1075697134 10:124444956-124444978 CTTCACAGAATCTGAATTAGTGG - Intergenic
1078911476 11:15736685-15736707 GTGCAAAGAATCTGAAGTTGGGG - Intergenic
1079124419 11:17708699-17708721 CTGGAAAGAAGTTAACTTGGGGG - Intergenic
1080894385 11:36437068-36437090 CTAGTAAGACTCTGAATGGGAGG - Intronic
1081098153 11:38966884-38966906 CTGGAAAGAGTTTGAAATGATGG + Intergenic
1082652284 11:55808108-55808130 CTGGGAATTCTCTGAATTGGAGG - Intergenic
1084347503 11:68564855-68564877 TTGGAGAGAATATGATTTGGGGG + Intronic
1084944495 11:72631435-72631457 CTGGAGAGAAGCAGAAGTGGAGG - Intronic
1085120643 11:73965322-73965344 CTGGAAAGGCTCTGAATGGGAGG + Intronic
1088348794 11:108861405-108861427 CTAGAAATAACCTGAATTGTAGG + Intronic
1088353478 11:108916377-108916399 CTGGAAAGAAATTGAGTTGGGGG - Intronic
1089805872 11:121088353-121088375 CTGCAAAAAATATGACTTGGAGG - Exonic
1089976610 11:122737682-122737704 CTGGAGAGAAGCAAAATTGGCGG + Intronic
1092747506 12:11687674-11687696 CTTGAAAGTATCTTAAATGGAGG - Intronic
1092787838 12:12045379-12045401 CTGGTGAGAATGTGAAATGGTGG + Intergenic
1092959472 12:13582211-13582233 CATGAAAGAATCTGGAATGGAGG + Intronic
1095965323 12:47863609-47863631 CTGGAGAGAATAAGAAGTGGAGG - Intronic
1097723922 12:63052958-63052980 TTGGAAAGAAACTAAATTGCTGG + Intergenic
1098462041 12:70742690-70742712 CTGGAAAAAAACAGAATTCGAGG + Intronic
1100112337 12:91260699-91260721 CTGGGAAGAATATTAAGTGGGGG + Intergenic
1100170335 12:91968636-91968658 CAGGAAAGAAGCTGAATGTGGGG + Intergenic
1105675075 13:22662324-22662346 ATTGAAAGAATGTGAATTCGGGG + Intergenic
1106303669 13:28492428-28492450 CTTGAAAGTATCTGAATTATTGG + Intronic
1107128788 13:36872782-36872804 CTGGAAAGAGTCAGGATAGGTGG + Exonic
1107344595 13:39445314-39445336 ATGGAAAGAACATGAATTTGGGG + Intronic
1108537159 13:51395689-51395711 CTGAAAAAAATCTGTATTGTTGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114069216 14:19094820-19094842 CTGGGAAGAACCTGGAGTGGAGG - Intergenic
1114093044 14:19305183-19305205 CTGGGAAGAACCTGGAGTGGAGG + Intergenic
1115403848 14:32993973-32993995 CTGGAAGGAATTTGAAGAGGAGG + Intronic
1116601777 14:46935095-46935117 CTGTAGAGTATGTGAATTGGTGG + Intronic
1118722703 14:68605739-68605761 CTGGAAAGGACATGAATTTGGGG + Intronic
1121237127 14:92400138-92400160 CTGGAAAAAATCAGAGTTGGAGG + Intronic
1121591978 14:95122000-95122022 AAGGAAAGAATCTGAATTTCAGG + Intronic
1122024760 14:98867688-98867710 CTGGAAAGAATCAGATTTGCAGG - Intergenic
1124662896 15:31565442-31565464 CTGAACAGAATCTGAATATGTGG + Intronic
1124697355 15:31875704-31875726 CTTGAAAAAAGCTGAATTGGGGG - Intergenic
1125397485 15:39265161-39265183 ATGAAAGGAGTCTGAATTGGAGG - Intergenic
1127127466 15:55825903-55825925 CTGGAAGGACTCTGATTTGGAGG + Intergenic
1127521610 15:59748221-59748243 TTGGAGAGAATATGAACTGGAGG - Intergenic
1127836073 15:62792325-62792347 CTGGTAAGAATGTTAATTAGAGG - Intronic
1127887977 15:63220658-63220680 CTGGAATGAATCTTAATGGCTGG - Intronic
1130073604 15:80669870-80669892 CTGGAAATCATTTGAATTTGCGG + Intergenic
1130100615 15:80890993-80891015 CTGGAAAGAATGTGCTGTGGGGG - Intronic
1130699459 15:86164129-86164151 CAGGGAAAGATCTGAATTGGAGG + Intronic
1131492808 15:92877515-92877537 CTAGAAAGTCTCTGACTTGGAGG - Intergenic
1134361201 16:13532713-13532735 CTTGAAAGAAACTGAAATGTTGG - Intergenic
1135388603 16:22068974-22068996 GTGGATAGCATCTGCATTGGGGG - Intronic
1136181766 16:28557704-28557726 TTGGAAATAAACTGAATTAGAGG + Intronic
1136535558 16:30896981-30897003 CGGGAAAGAATCAGAGCTGGGGG + Intronic
1137647574 16:50089131-50089153 ATGGAAAGTTTCTGAATTGTGGG + Intronic
1139407612 16:66731464-66731486 CTGGAAAGAATTGCAATAGGGGG - Intronic
1142541656 17:664506-664528 CTGGAAATAATCTGGAGAGGTGG + Intronic
1142733274 17:1877667-1877689 CTGGAAACAGTCTGATTTGCTGG + Intronic
1144265374 17:13563262-13563284 ATGGAAAGAAACTGAAGTTGGGG + Intronic
1148588726 17:48799522-48799544 CTGGACAGAATGTGAAATGAGGG - Intronic
1148758129 17:49985338-49985360 TAGGGAAGAATCTGAACTGGGGG - Intergenic
1151025630 17:70672918-70672940 TTGGCAAGGATCTGAATTTGTGG + Intergenic
1155191368 18:23433807-23433829 ATGGAAATAAACTGAAATGGAGG + Intronic
1155406822 18:25497778-25497800 CTTGAAAGATTCAGAATTGATGG - Intergenic
1158007499 18:52689751-52689773 CTGAAAAGACTCTTAATTTGGGG + Intronic
1159432225 18:68367624-68367646 ATTGAAAGAATCTGAATTACTGG + Intergenic
1159552847 18:69913978-69914000 CTGGAAACAAAATGAGTTGGGGG + Intronic
1160059213 18:75514523-75514545 CTGGAAGGGATCTGAGTTTGTGG - Intergenic
1166253539 19:41586808-41586830 CTGGAAAGGATCTGAATAAAGGG + Intronic
1166410489 19:42553178-42553200 CTGGAAAGGATCTGAATAAAGGG - Intronic
1168492595 19:56823089-56823111 CAGCAAAGAGTCTGAAGTGGGGG - Intronic
926064239 2:9824282-9824304 CTGGAAAGAATCTCTTCTGGGGG + Intergenic
926689949 2:15726181-15726203 CTGGGAAGAACATGAATTTGGGG + Intronic
926756706 2:16242266-16242288 CTGGAAAAAATCTGAGTAGCAGG + Intergenic
927835154 2:26390864-26390886 CTGGATAAAATGTTAATTGGGGG + Exonic
927934585 2:27069132-27069154 CTGGACTGAATCGGAGTTGGTGG - Intronic
928085249 2:28342121-28342143 CTAGAAAGAATATGAAGTTGAGG + Intergenic
928790563 2:34946827-34946849 TTGGAAAGAATCTTAACTGCAGG - Intergenic
931718784 2:65051667-65051689 CTGGTAAGAATGTCAAATGGAGG - Intergenic
933353198 2:81182471-81182493 GTGGAAAGAATACGTATTGGGGG + Intergenic
934764094 2:96870557-96870579 CTAGAAAGAGGCAGAATTGGGGG - Intronic
934783063 2:96985263-96985285 CTGGAAAGAATGTGAGATGGAGG - Intronic
936560212 2:113531411-113531433 CAGGTAAAAATCTGAAATGGTGG + Intergenic
936618110 2:114068917-114068939 CATGAAAGAATATGAATTTGAGG - Intergenic
936697595 2:114968804-114968826 GGGGAAAGAATCTGAATGGTTGG - Intronic
937273218 2:120668448-120668470 ATGGAGAGATTCTGAATGGGAGG - Intergenic
937331596 2:121033907-121033929 CTGGGCTGAATCTGAATTGAGGG + Intergenic
938020451 2:127901938-127901960 CTGGAAAGAGTCTTATTTGAAGG - Intergenic
939785299 2:146502753-146502775 CTGGAAAGAAACAGAAGAGGAGG + Intergenic
941355994 2:164492066-164492088 CTGGTAAGAAACTGAAAAGGGGG + Intergenic
942471556 2:176266339-176266361 CTGGAAAGAATCTGTAATGTGGG - Intergenic
942739899 2:179164203-179164225 CTGGAAAGAATCAGAATAAATGG + Intronic
943591923 2:189808965-189808987 CTTAAAAGAATCTGACTAGGAGG - Intronic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
945558482 2:211308319-211308341 CTGGAAGAAATGTGAGTTGGTGG + Intergenic
945683329 2:212939059-212939081 GGGGAAAGTATCTGGATTGGGGG + Intergenic
1169652320 20:7883107-7883129 CTGGAGAGAATTGGAATGGGTGG - Exonic
1170205139 20:13790000-13790022 TTTGAAAGAATTTGAGTTGGTGG + Intronic
1172266946 20:33624383-33624405 CTGGAAAGAAACTACATGGGAGG - Intronic
1172326498 20:34039755-34039777 CTGGCAGGAATCTGAATTGGGGG - Intronic
1172625282 20:36343118-36343140 CTGGAAAGCCTCTGAAGTGCCGG + Intronic
1173755425 20:45511522-45511544 CTGGAAAAATTATGGATTGGGGG + Intergenic
1177661149 21:24085572-24085594 CTGGACAGAATCTGGGATGGGGG + Intergenic
1180487689 22:15817383-15817405 CTGGGAAGAACCTGGAGTGGAGG - Intergenic
1181642166 22:24207883-24207905 CTGGAACAAACCTAAATTGGTGG + Intergenic
1181725879 22:24810625-24810647 CTAGAAAGCCTCTTAATTGGAGG + Intronic
1182717266 22:32367557-32367579 CTGGAAAGAACGAGAATTTGGGG - Intronic
1184804749 22:46786984-46787006 ATGGAAAGAGGCTGAATTAGAGG - Intronic
950854012 3:16088605-16088627 TTGGAAGGAAACTGAAATGGAGG + Intergenic
952127550 3:30319638-30319660 CTGTAAACAATCTTATTTGGGGG + Intergenic
953233828 3:41088510-41088532 CTGGAAGGCAAATGAATTGGAGG - Intergenic
953444940 3:42955222-42955244 CATGAAAGAATCTGCATTGCAGG + Intronic
953563488 3:44012624-44012646 CTGGTAAGTATCTGTACTGGAGG + Intergenic
955764788 3:62331199-62331221 CTGGATATAATCTGAATGGATGG - Intronic
957272475 3:78049701-78049723 CTGGAATGTATCTGAGATGGAGG - Intergenic
960339128 3:116453929-116453951 GGGGAAAGAATCTGAATTTCTGG - Intronic
960465164 3:117989187-117989209 CTGGGAAGAAGCTGATTTAGAGG - Intergenic
960852045 3:122065836-122065858 GTTGGAAGAAACTGAATTGGGGG + Intronic
961638738 3:128351300-128351322 GAGGAAAGAATCTCAATTAGTGG - Intronic
962061246 3:131929827-131929849 ATTGAATGAATCTGCATTGGTGG + Intronic
965812656 3:172607682-172607704 CTGGAAAGCAGCTGAGATGGGGG - Intergenic
967459446 3:189728480-189728502 ATGCAAAGAATATGACTTGGGGG + Intronic
967576004 3:191093934-191093956 CTGGGAAGAAACAGAAATGGTGG - Intergenic
970830061 4:20327086-20327108 CTGGAAAGAATATGAATAATAGG - Intronic
971098512 4:23435616-23435638 ATGGAAAGAACATGAATTTGTGG + Intergenic
971475646 4:27069248-27069270 CAGGAAAGAATGGGGATTGGAGG - Intergenic
971994605 4:33949157-33949179 GTTGAAAGCATCTGAATTGCTGG - Intergenic
972941599 4:44202000-44202022 CTGGAAAGAAGATGTATTGGTGG + Intronic
973899425 4:55452463-55452485 CATGAAAGAATCTGAAGTAGAGG + Intronic
975006095 4:69288182-69288204 CTGGTAATATTCTGAATTTGTGG + Intronic
975575426 4:75857804-75857826 CTGGAAAGAATCCTAGGTGGAGG + Intergenic
976555305 4:86443982-86444004 TGGGAAAGAATCTGAGTTTGAGG + Intronic
981509462 4:145539912-145539934 CTGGAAAGAATCTGGAAAAGTGG - Exonic
981977357 4:150746898-150746920 ATGGAAAGAAGTTGGATTGGAGG - Intronic
982704260 4:158690010-158690032 GTGTAAAGAATCTGAAATGGAGG - Intronic
983719316 4:170827613-170827635 GTGAAAAGAATCTGAATTTGAGG + Intergenic
985011913 4:185591521-185591543 GTGTAAAGAATTTGATTTGGAGG + Intronic
985159084 4:187025300-187025322 ATGGAAAGCATCTGCATTTGGGG - Intergenic
986040655 5:3990983-3991005 CTGGAAACACTCTGAGTTGAGGG - Intergenic
988547258 5:32170297-32170319 CTGGAAAGATACTCAAGTGGAGG + Intronic
989145121 5:38241830-38241852 CTGGGAAGTAACTGAATTAGTGG - Intergenic
990667922 5:58094564-58094586 CTGGAAAGCTCCTGAAGTGGAGG - Intergenic
990832448 5:59974813-59974835 ATGGAAAGAATGAGAATGGGAGG - Intronic
991019487 5:61964967-61964989 CTTGAAAGAAGCAGAAGTGGTGG + Intergenic
991393939 5:66183867-66183889 CTAGCAAGAAGCTGAATTTGTGG - Intergenic
994238047 5:97388831-97388853 CTGTATACAATCTGATTTGGAGG + Intergenic
995243316 5:109910057-109910079 GTGTAAAGAATTTGAGTTGGAGG - Intergenic
995419407 5:111946568-111946590 CTAGAAAGAATAAGAATAGGAGG - Intronic
997425703 5:133801315-133801337 CTGGGAAGAAGCTGATTGGGAGG - Intergenic
999133770 5:149304054-149304076 ATGGACAGAAAGTGAATTGGTGG - Intronic
999155101 5:149452201-149452223 CTGGAAAGAATGTGTATCTGGGG - Intergenic
999391939 5:151199573-151199595 CTGGAAAACATCTCAAGTGGGGG - Intronic
1000245477 5:159445478-159445500 TTGGAAGCTATCTGAATTGGAGG + Intergenic
1001257063 5:170192188-170192210 CTGGCAAGGAACTGAATTTGTGG + Intergenic
1001340317 5:170837469-170837491 CTGGAAAGCAAATGAATAGGTGG - Intergenic
1004159014 6:13196985-13197007 CTGGAAAGCATCAGGATAGGTGG + Intronic
1006479507 6:34280404-34280426 CTGGACAGCATTTGGATTGGGGG + Exonic
1006774068 6:36578290-36578312 ATGGAAAGATAGTGAATTGGAGG + Intergenic
1007037428 6:38689141-38689163 GTGGAAAGAAACTGAATTCAGGG + Intronic
1007190467 6:40012174-40012196 ATGGAGAGAATCTGCATTTGGGG - Intergenic
1008206505 6:48665765-48665787 ATGGAGAGAATCTGTATTTGTGG + Intergenic
1009192390 6:60645098-60645120 TTGGAAAGAATCTAAATTAATGG - Intergenic
1010674909 6:78731587-78731609 CCAGAAAGAAACTGAATTGCTGG + Intergenic
1011407584 6:87031771-87031793 CTGAAAAGATTCTGCATTCGGGG - Intergenic
1011716409 6:90109663-90109685 CTGGAAAGAAGCAGGTTTGGAGG - Intronic
1012651571 6:101761226-101761248 ATGGAAACAATGTGAATTGCTGG + Intronic
1013370286 6:109464036-109464058 CTGGAGAAAATGTGGATTGGTGG + Exonic
1015758696 6:136634028-136634050 CTGTAAAGAATGGGAAGTGGAGG + Intronic
1015867322 6:137740263-137740285 CTGGAAAGAACATGAATTCTCGG - Intergenic
1016208683 6:141502361-141502383 ATGGAAAGAATAAGAATTTGCGG + Intergenic
1017994793 6:159522404-159522426 AGGGAAAGAATTTGAATTTGAGG + Intergenic
1018028833 6:159826285-159826307 CTGGAGAGAAGCTGCATTGTAGG - Intergenic
1021048645 7:15955062-15955084 CTGGAAAGCATGTGAATAAGTGG + Intergenic
1023566848 7:41532084-41532106 CTGGAAAGGATCTGCACTGGGGG - Intergenic
1026610526 7:71855578-71855600 CTGCAAAGAAGCTGTTTTGGAGG + Intronic
1029837252 7:103325601-103325623 CTGGAAAGATTCTGATTTATTGG - Intronic
1030398601 7:109019555-109019577 CTGGAAAGATTTTTAATTGAGGG + Intergenic
1031042369 7:116851597-116851619 AAGGAAAAAATATGAATTGGAGG + Intronic
1031847302 7:126821585-126821607 CTGGAAAGAATATGAAGCTGAGG - Intronic
1033305343 7:140221349-140221371 CTGGAAAGAGTCTGAATAATGGG + Intergenic
1034542711 7:151769284-151769306 CTGGAAAGGAAATGAATTAGTGG - Intronic
1037346433 8:17906216-17906238 GTGGAAAGAGGATGAATTGGTGG - Intronic
1037412825 8:18616401-18616423 GTGGAGAGAATCTGTATTGATGG + Intronic
1041897076 8:62937677-62937699 CTGGACAGAATCTGTAGTGGGGG + Intronic
1043069497 8:75620734-75620756 CTGGAGAGCATTTGAATTGGGGG + Intergenic
1044488692 8:92786021-92786043 GTTTAAAGAATCTGAATTAGAGG + Intergenic
1044581037 8:93826442-93826464 TAGGAAAGAATCTGAAATGATGG + Intergenic
1044808166 8:96030140-96030162 GTGAAAAGAATATGAATTGGGGG - Intergenic
1049892655 9:84947-84969 CAGGTAAAAATCTGAAATGGTGG - Intergenic
1050353468 9:4761864-4761886 CTGCAAAGACTCGGAGTTGGTGG - Intergenic
1051854592 9:21549488-21549510 ATGGAAACAATATAAATTGGGGG + Intergenic
1052142502 9:25004269-25004291 CTGGAAGGAAGCTGCAGTGGGGG + Intergenic
1052661094 9:31432761-31432783 CTGGAAAGCATCTGAAATAAGGG - Intergenic
1053733884 9:41085002-41085024 CAGGTAAAAATCTGAAATGGTGG - Intergenic
1054694523 9:68346540-68346562 CAGGTAAAAATCTGAAATGGTGG + Intronic
1054812750 9:69447642-69447664 CTGGGATGACTCTGTATTGGAGG + Intronic
1055039926 9:71858538-71858560 CTGGAAACAGGCTGTATTGGTGG - Intergenic
1055545040 9:77361744-77361766 CTGGTAAGAATGTAAAATGGTGG - Intronic
1055879534 9:80983480-80983502 CTGGAAATAATCTGAATACTTGG - Intergenic
1056061950 9:82892631-82892653 CTGGAAAGAATCAGGTGTGGGGG + Intergenic
1058548375 9:106085910-106085932 ATGGAAAGAAAAAGAATTGGAGG + Intergenic
1059716198 9:116915653-116915675 CTGAAGAGTATCTGAGTTGGTGG + Intronic
1190890303 X:54561602-54561624 CTGGGCAGATTGTGAATTGGAGG + Intergenic
1192035671 X:67560290-67560312 GTGTTAAGAATCTGAACTGGGGG - Intronic
1192474964 X:71432632-71432654 CTGGAAAGATTGGGAATTGAGGG + Intronic
1192556130 X:72091114-72091136 CTGGAAAGAAGTGGAATTGTTGG + Intergenic
1194995908 X:100591239-100591261 CTGGAATAAAGCTGAGTTGGAGG + Intronic
1196383614 X:115121742-115121764 GTGTAGAGAATCTGAATTGTTGG - Intronic
1196970570 X:121103776-121103798 CTGGAAAGATGCTTATTTGGGGG + Intergenic
1197654137 X:129097999-129098021 CTAGAAAAAAACTGAATTTGTGG + Intergenic
1197795890 X:130298385-130298407 ATGGAAAGAATCTGCAATGGTGG + Intergenic
1198205004 X:134457580-134457602 CTGGAAGGATTCTGAATTGTTGG + Intergenic
1202173686 Y:22077966-22077988 CTGGTGAGAATGTGAAATGGTGG - Intronic
1202217675 Y:22508416-22508438 CTGGTGAGAATGTGAAATGGTGG + Intronic
1202325510 Y:23687643-23687665 CTGGTGAGAATGTGAAATGGTGG - Intergenic
1202545261 Y:25982411-25982433 CTGGTGAGAATGTGAAATGGTGG + Intergenic