ID: 900334302

View in Genome Browser
Species Human (GRCh38)
Location 1:2153962-2153984
Sequence GCTGGCGCTGCAGAATCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900334302_900334313 19 Left 900334302 1:2153962-2153984 CCCACCGATTCTGCAGCGCCAGC 0: 1
1: 0
2: 0
3: 13
4: 121
Right 900334313 1:2154004-2154026 TCAGCAGTGCTGTGTCCAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 250
900334302_900334312 16 Left 900334302 1:2153962-2153984 CCCACCGATTCTGCAGCGCCAGC 0: 1
1: 0
2: 0
3: 13
4: 121
Right 900334312 1:2154001-2154023 AACTCAGCAGTGCTGTGTCCAGG 0: 1
1: 0
2: 2
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900334302 Original CRISPR GCTGGCGCTGCAGAATCGGT GGG (reversed) Intronic
900202787 1:1418889-1418911 GCTGGAGCTGCAGGGTCAGTGGG + Exonic
900334302 1:2153962-2153984 GCTGGCGCTGCAGAATCGGTGGG - Intronic
903157214 1:21454058-21454080 GCTGGGGCTGCTGATTCGTTAGG - Intronic
903160701 1:21487111-21487133 GCTGAGGCTGGAGAATCGCTTGG - Intergenic
904336278 1:29800388-29800410 CCTGGGGCTGCAGGATTGGTGGG + Intergenic
904449684 1:30602785-30602807 GCTGGGGCAGGAGAATCGCTTGG + Intergenic
905901202 1:41583027-41583049 GCTGGCGCTTCAGCATCCGGGGG + Exonic
905908516 1:41637692-41637714 GAGGGCACTGCAGAATGGGTGGG + Intronic
906116304 1:43359352-43359374 GCCGGCGCTGTGGGATCGGTTGG - Exonic
906257892 1:44364640-44364662 GATGGGGCTGCAGAAGCGGTGGG - Intergenic
909524413 1:76606878-76606900 GCTGGTGTTGGAGAATCGGTCGG - Intronic
915201978 1:154237034-154237056 GCTGGCTCTGCATAATCAGCTGG - Exonic
915658728 1:157383214-157383236 GCTGGGGCTTCAGAAACGCTAGG - Intergenic
919453262 1:197795749-197795771 GCTGGCCTTGTAGAATGGGTTGG + Intergenic
922917393 1:229270325-229270347 GCTGAGGCAGGAGAATCGGTTGG + Intergenic
924140255 1:241014840-241014862 GCTGGCCATGAAGAATAGGTTGG + Intronic
924216891 1:241831713-241831735 GCTGAGGCAGGAGAATCGGTTGG + Intergenic
924464941 1:244291271-244291293 GCTGGGGCTGCTGAATGGGGAGG + Intergenic
924758517 1:246963748-246963770 GCTGGTGTTGGAGAATTGGTCGG - Intronic
1066279023 10:33897034-33897056 ACTGGCCCTGAAGAATAGGTGGG - Intergenic
1066422107 10:35273299-35273321 GCTGGGGCTGGAGAATCGCTTGG - Intronic
1068596933 10:58912337-58912359 GATGGCACTGCAGAAGTGGTGGG + Intergenic
1069978129 10:72232084-72232106 GCTGAGGCAGCAGAATCGCTTGG + Intronic
1071675511 10:87652020-87652042 GCTGGAGCTGGAGAGACGGTGGG + Intergenic
1072517356 10:96198796-96198818 GCTGAAGCAGGAGAATCGGTTGG - Intronic
1073293217 10:102423616-102423638 GCTGGGGATGCGGAATGGGTGGG - Intronic
1078671425 11:13369189-13369211 GCTGGCACTGAAGGATGGGTAGG - Intronic
1083712495 11:64557895-64557917 GCTGAGGCTGGAGAATCGCTTGG - Intronic
1083953153 11:65967737-65967759 GCTGGAGCTGCAGAAGCAGCTGG + Exonic
1085888375 11:80547917-80547939 GCTGGCTTTGTAGAATCAGTTGG - Intergenic
1087638324 11:100728028-100728050 GCTGGTGTTGGAGAATTGGTTGG + Intronic
1092165087 12:6337401-6337423 GCTGGGGCTGCAGAGTGGGGAGG + Intronic
1100356998 12:93840664-93840686 GCTGAGGCTGGAGAATCGCTTGG - Intronic
1100655067 12:96635467-96635489 GCTGGTGCTGGAGAATTGGTTGG - Intronic
1101664943 12:106804312-106804334 GCTGGGGCAGGAGAATCGCTTGG - Intronic
1104654827 12:130566651-130566673 GCTGGGGCTGCAGAGTCCGGAGG - Intronic
1105394125 13:20012273-20012295 GCTGACGCAGAAGAATCGCTTGG - Intronic
1106142881 13:27025866-27025888 GCTGAGGCTGGAGAATCGCTTGG + Intergenic
1106908754 13:34439769-34439791 GCTGGTGTTGGAGAATTGGTTGG - Intergenic
1111622423 13:90741373-90741395 GCTGAGGCAGGAGAATCGGTTGG - Intergenic
1112303512 13:98251945-98251967 GCTGACGCAGGAGAATCGCTTGG - Intronic
1117156820 14:52950635-52950657 GCCGGCGCTGCGAATTCGGTGGG - Intronic
1119806321 14:77484721-77484743 GCTGGAGCTGCAGAAGCTGCCGG - Exonic
1122544551 14:102514962-102514984 GATGGGGCTGCAGACGCGGTGGG - Intergenic
1122866271 14:104605342-104605364 GCTGGCGCTGCAGAAGCTCCCGG - Intronic
1123023046 14:105411222-105411244 GCTGGCGCTGGAGCAGCGGGAGG + Intronic
1124514502 15:30354947-30354969 GCTGGTGCTGGCGAATGGGTGGG + Intergenic
1124728418 15:32175818-32175840 GCTGGTGCTGGAGAATGGGTGGG - Intergenic
1129831476 15:78673847-78673869 CCTGGGGCTGCAGCATGGGTTGG - Intronic
1132732000 16:1367256-1367278 GCTGGCGCTGCAGAAGAAGGAGG - Intronic
1132866280 16:2094158-2094180 GCTGGCGCTGCAGAGGCTGGGGG - Exonic
1135362385 16:21826041-21826063 GCTGAGGCTGGAGAATCGCTTGG + Intergenic
1136235473 16:28911054-28911076 GCTGGGGCTGCAGCAGCGGCAGG + Intronic
1137458008 16:48633049-48633071 GCTGAGGCTGGAGAATCGCTTGG - Intergenic
1137982289 16:53080138-53080160 GCTGGTGTTGGAGAATTGGTTGG + Intronic
1138553395 16:57759124-57759146 GCTGGGGCTGCAGAGTCTCTAGG - Intronic
1139277577 16:65742043-65742065 GCTGAGGCAGCAGAATCGCTCGG + Intergenic
1139686022 16:68604416-68604438 GCTAGCGCAGGAGAATCGCTTGG - Intergenic
1141125108 16:81395533-81395555 GCTGGCCCTGGACAATCGCTGGG - Intergenic
1141966626 16:87449499-87449521 GGTGGCGTTGCTGAATTGGTCGG - Intronic
1142135765 16:88451453-88451475 GCTGGCGCTGCTGGAACGGGCGG - Intergenic
1150713139 17:67548489-67548511 GCTGAGGCTGGAGAATCGCTTGG + Intronic
1151245200 17:72789132-72789154 GCTGACGCAGGAGAATCGCTTGG - Intronic
1151865095 17:76796504-76796526 GCTGGTGCTGCAGAGTCGGCTGG - Intergenic
1155075282 18:22348878-22348900 CCTGGCGCTGGAGAAGCGGTGGG + Intergenic
1157524571 18:48371179-48371201 CCTGGGGCTGCAGAAACTGTAGG - Intronic
1160453187 18:78979295-78979317 GCGGGCGCTCCGGAGTCGGTGGG + Intergenic
1160592549 18:79952224-79952246 GCTGTCGCTGCAGAAACGCGGGG + Intergenic
1164020267 19:21296400-21296422 GCTGAGGCAGGAGAATCGGTTGG + Intronic
1165376669 19:35447809-35447831 GCTGACGCAGGAGAATCGCTTGG + Intronic
1165909882 19:39219040-39219062 GCTGAGGCAGGAGAATCGGTTGG - Intergenic
1166016032 19:39980095-39980117 GCTGGAGCTGCTGAATCAGATGG + Exonic
1168121541 19:54254793-54254815 GATTGCGCTGTAGCATCGGTAGG + Exonic
928468581 2:31549210-31549232 GCTGAGGCAGCAGAATCGCTTGG - Intronic
929149124 2:38732154-38732176 GCTGGGGCAGGAGAATCGCTTGG - Intronic
930656606 2:54013398-54013420 GCTGAGGCAGAAGAATCGGTTGG - Intronic
938440749 2:131330283-131330305 GCTGACGCAGGAGAATCGCTTGG - Intronic
941805965 2:169712590-169712612 GGTGGTGCTGCAAAATCGGATGG - Intronic
942635001 2:177994028-177994050 GCTGAAGCAGCAGAATCGCTCGG - Intronic
944811231 2:203328766-203328788 GCTGGGGCTGGTGAATGGGTGGG + Intronic
946539953 2:220673304-220673326 GATGGCGGTGCAGAAGGGGTGGG + Intergenic
948162465 2:235836356-235836378 GATGGCCCTGCAGAATCCTTTGG + Intronic
1169054933 20:2612800-2612822 GCTGGCACTTCAGAATAAGTGGG + Intronic
1173785849 20:45792199-45792221 GCTGGAGCTGCAGAGGGGGTTGG + Intronic
1175160703 20:57005563-57005585 GCTGGAGAGGCAGAATCAGTAGG + Intergenic
1175258911 20:57662897-57662919 GCTGGGGCTGCAGGGCCGGTGGG + Intronic
1175304656 20:57967561-57967583 GCTGGTGCTACAGAATCGTAAGG + Intergenic
1179151531 21:38812987-38813009 GCTGGCGCTGCAAAAACAGATGG - Exonic
1179782297 21:43709480-43709502 GCTGAGGCTGGAGAATCGCTTGG - Intergenic
1181403436 22:22665651-22665673 GCTAGAGCTGGAGAATCTGTGGG - Intergenic
1181408438 22:22701635-22701657 GCTGGAGCTGGAGAATCTGTGGG - Intergenic
1181413758 22:22745134-22745156 GCTAGAGCTGGAGAATCTGTTGG - Intronic
1184283071 22:43449962-43449984 GATGGGGCTGCAGAATGGGCGGG + Intronic
1184447611 22:44559377-44559399 GCTGGGGCAGAAGAATCGCTTGG - Intergenic
1184466085 22:44669383-44669405 GCTGGCCCTGCAGAGTGGGTGGG + Intronic
949440961 3:4079847-4079869 GCTGAAGCTGCAGAAACTGTGGG + Intronic
961390951 3:126552025-126552047 GCTGCCCCTGCAGAAGAGGTTGG - Exonic
966415720 3:179687557-179687579 GCTGGCGCAGGAGAATCGCTTGG + Intronic
966840945 3:184087030-184087052 GCTGAGGCAGGAGAATCGGTTGG - Intergenic
970984762 4:22144061-22144083 GGTGGCTCTGGAGAAACGGTGGG - Intergenic
971474461 4:27059046-27059068 GATGGCCCTGCAGAACCAGTTGG + Intergenic
972536324 4:40002865-40002887 GCTGAGGCAGCAGAATCGCTTGG - Intergenic
977491024 4:97711767-97711789 GCTGGGGCAGGAGAATCGCTTGG - Intronic
982831444 4:160066057-160066079 GCTGGTTCTGCAGAATGAGTTGG + Intergenic
985064198 4:186105176-186105198 GCTGCCGCTGCAGGGTCGGGGGG + Intronic
985967271 5:3347340-3347362 GCTGGCGCTGGAGAAATTGTGGG - Intergenic
995674461 5:114647496-114647518 GCTGGCTCTGCAGAATATTTGGG - Intergenic
999286844 5:150399240-150399262 GCTGGCACTGCAGCATCAGAAGG + Intronic
1002878680 6:1233557-1233579 GCTGGGGCAGGAGAATCGCTTGG + Intergenic
1017311612 6:152982900-152982922 GCTGGCGCTGCAGGAGCAGCGGG + Exonic
1017513127 6:155131677-155131699 GCTGAGGCAGCAGAATCGCTTGG - Intronic
1018777183 6:167028306-167028328 GCTGGGGCTGCAGAGTTGCTGGG + Intronic
1025221763 7:57116486-57116508 GCTGGGGCAGGAGAATCGCTTGG - Intergenic
1025632543 7:63288155-63288177 GCTGGGGCAGGAGAATCGCTTGG - Intergenic
1025650012 7:63458049-63458071 GCTGGGGCAGGAGAATCGCTTGG + Intergenic
1025787019 7:64652814-64652836 GCTGAGGCAGCAGAATCGCTTGG + Intergenic
1029594149 7:101528033-101528055 GCAGGCGCTCCAGAACCGGACGG - Intronic
1035477410 7:159153000-159153022 GCTGGCACTGCCCAATCGGCTGG - Intergenic
1035543845 8:463555-463577 CCTGGCCCTGCAGAGTCGGTGGG - Intronic
1035551568 8:531519-531541 GCTGGTACTGAAGAATTGGTTGG + Intronic
1039931525 8:41994954-41994976 GCTGACGCAGGAGAATCGCTTGG + Intronic
1041921479 8:63187052-63187074 GCAGCAGCTGCAGAATCGCTGGG + Exonic
1041970054 8:63730219-63730241 GCTGGCCTTGAAGAATAGGTTGG + Intergenic
1048370797 8:133774440-133774462 GCTGGAGCGGCAGCATCGGTGGG + Intergenic
1050415659 9:5414264-5414286 GCTGAGGCAGCAGAATCGCTTGG - Intronic
1053508152 9:38663437-38663459 GCTGGCGCTGCAGCAACTGAGGG + Intergenic
1056220777 9:84449134-84449156 GTTGGTGCTGGAGAATTGGTTGG - Intergenic
1056481557 9:87011791-87011813 GCTGGCGCTGTGGGATCGGTTGG - Intergenic
1057470310 9:95350705-95350727 GCTGAGGCAGCAGAATCGCTTGG - Intergenic
1058687482 9:107490764-107490786 GCTGACGCAGGAGAATCGCTTGG - Intergenic
1059756340 9:117297151-117297173 GCTGGTGCTGTAGAATCAGAAGG - Intronic
1062426649 9:136509127-136509149 GCTGGCGAGGCAGAATCTGCTGG - Intronic
1186638131 X:11427755-11427777 GCTGCCGCTGCGGAGCCGGTGGG + Intronic
1197755808 X:129993882-129993904 GCTGAGGCAGCAGAATCGCTTGG - Intronic
1198223287 X:134622499-134622521 GCTGGAGCTCCAAAATCGGATGG + Intronic