ID: 900334303

View in Genome Browser
Species Human (GRCh38)
Location 1:2153963-2153985
Sequence GGCTGGCGCTGCAGAATCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900334303_900334313 18 Left 900334303 1:2153963-2153985 CCACCGATTCTGCAGCGCCAGCC 0: 1
1: 0
2: 0
3: 14
4: 192
Right 900334313 1:2154004-2154026 TCAGCAGTGCTGTGTCCAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 250
900334303_900334312 15 Left 900334303 1:2153963-2153985 CCACCGATTCTGCAGCGCCAGCC 0: 1
1: 0
2: 0
3: 14
4: 192
Right 900334312 1:2154001-2154023 AACTCAGCAGTGCTGTGTCCAGG 0: 1
1: 0
2: 2
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900334303 Original CRISPR GGCTGGCGCTGCAGAATCGG TGG (reversed) Intronic
900114182 1:1021476-1021498 GGCTGGGGCTGCCGGATGGGGGG - Intronic
900202786 1:1418888-1418910 GGCTGGAGCTGCAGGGTCAGTGG + Exonic
900214278 1:1472921-1472943 GGCTGCGGCAGGAGAATCGGAGG - Intronic
900334303 1:2153963-2153985 GGCTGGCGCTGCAGAATCGGTGG - Intronic
901175100 1:7293179-7293201 GGATTGCGCTGCAGAAGCTGGGG + Intronic
902534234 1:17110016-17110038 GGCTGGTGCTGGGGAATAGGAGG - Intronic
903110447 1:21128407-21128429 GGCTGAGGCAGCAGAATCGCTGG + Intronic
904013728 1:27405092-27405114 AGCTGGCACTGCAGAGTCAGAGG + Exonic
904683922 1:32247519-32247541 AGCTGCAGCTGCAGACTCGGCGG + Exonic
905901201 1:41583026-41583048 GGCTGGCGCTTCAGCATCCGGGG + Exonic
905908515 1:41637691-41637713 GGAGGGCACTGCAGAATGGGTGG + Intronic
906257893 1:44364641-44364663 GGATGGGGCTGCAGAAGCGGTGG - Intergenic
914921754 1:151852115-151852137 GCCTGGGGCTGCAGCATCAGGGG + Intronic
915340662 1:155175005-155175027 GCATGGAGCTGCAGAATGGGCGG + Intronic
916818894 1:168379110-168379132 GGCTGGCACTGCAGATTCAGAGG + Intergenic
918403059 1:184183531-184183553 GGCTGAGGCAGGAGAATCGGTGG + Intergenic
919213963 1:194527017-194527039 GGCTGAGGCAGGAGAATCGGTGG - Intergenic
920505358 1:206511860-206511882 GGATGGGTCTGCAGGATCGGGGG - Intronic
1064634287 10:17347832-17347854 GGCTGAGGCAGGAGAATCGGAGG + Intronic
1064723847 10:18257626-18257648 GGCTGGCCTTGCAGAATGGACGG - Intronic
1066279024 10:33897035-33897057 GACTGGCCCTGAAGAATAGGTGG - Intergenic
1066370315 10:34814544-34814566 GGCTGGGTCTGCAGACTCCGGGG + Intronic
1068596932 10:58912336-58912358 GGATGGCACTGCAGAAGTGGTGG + Intergenic
1071063503 10:81602467-81602489 GGCTGAGGCTGGAGAATCGCTGG + Intergenic
1084412827 11:69013992-69014014 GGGTGGGGGTGCAGAGTCGGGGG + Intergenic
1084636837 11:70398561-70398583 GGCTGGCGCGGCGGAATCCAGGG + Exonic
1085153011 11:74267259-74267281 GGCTGGAGCTGCAGGGTCTGCGG + Exonic
1087518653 11:99201123-99201145 GGCTGACGCAGGAGAATCGCTGG - Intronic
1088259564 11:107931075-107931097 GGCTGAGGCTGCAGAATTGCTGG - Intronic
1096503929 12:52081266-52081288 GGGAGGGGCTCCAGAATCGGGGG - Intergenic
1097126290 12:56778386-56778408 GGCTGAGGCAGCAGAATCGCTGG - Intronic
1102768328 12:115452039-115452061 AGCGGCCGCTGCAGACTCGGCGG + Intergenic
1103400557 12:120640621-120640643 GGCTGGCGGTGCAGATCTGGGGG - Exonic
1104752040 12:131245975-131245997 TGCTGGGGCTGCAGTATCAGAGG + Intergenic
1106603434 13:31206651-31206673 GGCTGAGGCAGGAGAATCGGAGG + Intronic
1112506854 13:99980845-99980867 GGCTGCCGCTGCAGCGTTGGCGG + Intergenic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1118316059 14:64726777-64726799 GGGTGGGGCTGCGGAGTCGGGGG + Intronic
1119661130 14:76452517-76452539 GGCTGAGGCTGGAGAATCGCTGG + Intronic
1120994029 14:90401754-90401776 GGCTGACGCAGGAGAATCGCTGG - Intronic
1121769372 14:96518954-96518976 GGCTGAGGCAGGAGAATCGGTGG + Intronic
1122790510 14:104182363-104182385 GGCTGGGGCTGGAGGATCAGGGG - Intergenic
1124728419 15:32175819-32175841 AGCTGGTGCTGGAGAATGGGTGG - Intergenic
1129161753 15:73751726-73751748 GGCTGGTGCTGCAGCCTGGGAGG - Intronic
1129796627 15:78382340-78382362 GGCTGGGGCTGCACACTCCGTGG + Intergenic
1129860963 15:78861001-78861023 GGCTGAGGCAGGAGAATCGGAGG + Intronic
1130150215 15:81306113-81306135 GGCTGAGGCTGCAGAGTCAGTGG - Exonic
1131438529 15:92441473-92441495 GCCTGGCACTGCAGGATCGTGGG - Intronic
1131525644 15:93150431-93150453 GGCTGACGCAGGAGAATCGCTGG + Intergenic
1132234367 15:100207992-100208014 TGCTAGCTCTGAAGAATCGGAGG + Intronic
1132866281 16:2094159-2094181 CGCTGGCGCTGCAGAGGCTGGGG - Exonic
1134571089 16:15291745-15291767 GGCTGGGGCAGGAGAATCGCTGG + Intergenic
1136590389 16:31214828-31214850 GGCAGGCGCGGCAGAAACTGTGG - Exonic
1138534006 16:57650180-57650202 GGCTGGCCCTGCAGAAGAGGAGG - Intronic
1138564641 16:57824254-57824276 GGCTGGTGGTGCAGACTCAGTGG - Intronic
1139554627 16:67699239-67699261 GGCTGAGGCAGCAGAATCGCTGG + Intronic
1143020587 17:3915456-3915478 GGCTGGGAGTGCAGAATCAGAGG - Intronic
1144269018 17:13600490-13600512 GGCTGGGGCTGAAGGATCCGGGG - Intronic
1144565326 17:16354513-16354535 GGCTGACGCAGGAGAATCGCTGG - Intergenic
1144578421 17:16444182-16444204 GGCTGGCACTGCAGCTTCTGGGG - Intronic
1146059696 17:29597988-29598010 GGCTGCGGCTGCAGCATCTGGGG + Intronic
1146062212 17:29613361-29613383 GGCTGGCGCTGCGGCGTGGGCGG - Exonic
1148431138 17:47644623-47644645 GGCTTGCACTGCAGAATGGGTGG - Intergenic
1150707135 17:67497301-67497323 GGCTGAGGCTGGGGAATCGGAGG - Intronic
1151704394 17:75758931-75758953 GGCTGGGGCTCCAGAAGAGGGGG + Intronic
1152583037 17:81177025-81177047 GGCTGAGGCAGCAGAATCGCTGG - Intergenic
1152598980 17:81252114-81252136 GGCAGGGGCAGCAGAATCGATGG - Intronic
1155075280 18:22348877-22348899 TCCTGGCGCTGGAGAAGCGGTGG + Intergenic
1155243075 18:23882004-23882026 GGCAGGCCCTGCAGGATCCGTGG - Exonic
1155276472 18:24192681-24192703 GGATGGGGCTGCAGACACGGGGG + Intronic
1155990283 18:32272722-32272744 GGCTGAGGCAGCAGAATCGCTGG - Intronic
1158434963 18:57428867-57428889 GGGCGGCGCTGCCGACTCGGAGG - Intergenic
1160453186 18:78979294-78979316 GGCGGGCGCTCCGGAGTCGGTGG + Intergenic
1160592548 18:79952223-79952245 CGCTGTCGCTGCAGAAACGCGGG + Intergenic
1161307688 19:3577009-3577031 AGCTGGCGCTGGAGGAGCGGAGG + Exonic
1161599273 19:5170937-5170959 GGCTGAGGCTGGAGAATCGCTGG + Intronic
1162104081 19:8359534-8359556 GGCTGGGGCAGGAGAATCGCTGG - Intronic
1162202978 19:9034679-9034701 GGCTGAGGCTGGAGAATCGCTGG + Intergenic
1163185765 19:15638374-15638396 GGCTGAGGCAGGAGAATCGGAGG + Intronic
1165682642 19:37790679-37790701 GGCTGGGGCTGCAGAAGCTCCGG - Intronic
1166955361 19:46460781-46460803 GGCTGAGGCTGGAGAATCGCTGG - Intergenic
925911453 2:8575954-8575976 GGCTGGGGCTGCCGAAAAGGGGG + Intergenic
927072765 2:19547941-19547963 GGCTGGGGCTGCACACTCCGTGG + Intergenic
927173777 2:20391429-20391451 GGCTGGGGGTGCAGAGTGGGAGG + Intergenic
928196075 2:29217707-29217729 GGCTTGAGGTGCAGAATCAGAGG - Intronic
932722512 2:74148071-74148093 GGCAGGCGCTGCAGTGTCGGGGG - Intergenic
933580787 2:84124381-84124403 GGCTGAGGCAGCAGAATCGCTGG + Intergenic
936113640 2:109684972-109684994 GGCTGAGGCTGGAGAATCGCTGG - Intergenic
936348187 2:111691094-111691116 GGCAAGCGCTGCAGAATCCCAGG - Intergenic
944525994 2:200620297-200620319 GGCTGAGGCTACAGAATCGCTGG - Intronic
944811230 2:203328765-203328787 GGCTGGGGCTGGTGAATGGGTGG + Intronic
945226757 2:207539139-207539161 GGCTGGGGCAGCAGAATCGCTGG - Intronic
946902712 2:224387725-224387747 GGGTGGAGCTGGAGAATGGGAGG + Intronic
949040073 2:241844019-241844041 GGGCGGCGCTGCAGGGTCGGGGG + Intergenic
1169328768 20:4699556-4699578 GGCTGGTGCTGCAGCAGCTGGGG + Exonic
1172771864 20:37386728-37386750 GGCTGACGGGGCAGAATGGGAGG - Intronic
1175247083 20:57588731-57588753 GGCTGGAGATGCAGTATAGGTGG - Intergenic
1175382800 20:58575347-58575369 GGCTGGGGCAGGAGAATCGCTGG + Intergenic
1175767272 20:61600178-61600200 GGCCGCTGCTGCAGAACCGGAGG + Intronic
1179012219 21:37564611-37564633 GCCTGGCGCTGCAGAGCTGGAGG - Intergenic
1180796750 22:18609572-18609594 GGCTGGCGGAGGAGAATGGGCGG - Exonic
1181104619 22:20566593-20566615 GGCTGTGGCTGCTGCATCGGTGG - Exonic
1181224974 22:21385699-21385721 GGCTGGCGGAGGAGAATGGGCGG + Exonic
1181253658 22:21549114-21549136 GGCTGGCGGAGGAGAATGGGCGG - Exonic
1181403437 22:22665652-22665674 GGCTAGAGCTGGAGAATCTGTGG - Intergenic
1181408439 22:22701636-22701658 GGCTGGAGCTGGAGAATCTGTGG - Intergenic
1183300673 22:37057562-37057584 GGCTGGGGCTGCAGGAAGGGAGG - Intronic
1183445110 22:37848494-37848516 GGCTGAAGCAGGAGAATCGGTGG - Intronic
1184168705 22:42745804-42745826 GGCTGGGGCAGGAGAATCGCTGG + Intergenic
1184283070 22:43449961-43449983 AGATGGGGCTGCAGAATGGGCGG + Intronic
1184466084 22:44669382-44669404 AGCTGGCCCTGCAGAGTGGGTGG + Intronic
952627501 3:35424687-35424709 GTGTGGCGCTGCAGAAAGGGAGG + Intergenic
953421666 3:42758414-42758436 GGCTGGGGCTGCAGACAGGGCGG - Intronic
954684306 3:52362108-52362130 GGCTGGAGCTGGGGAATTGGGGG + Intronic
955180424 3:56663080-56663102 GGCTGAGGCTGGAGAATCGCTGG + Intronic
957646540 3:82938838-82938860 GGCTGGCTCCGCAGAATGCGCGG - Intergenic
959791600 3:110368325-110368347 GGCTGTGGCTGCAGAATCAAGGG - Intergenic
961237436 3:125379326-125379348 GGCTTCAGCTGCAGAATCTGTGG - Intergenic
961592147 3:127988991-127989013 GACGGGCCCTGCAGAATCCGGGG + Intergenic
962558913 3:136585339-136585361 GGCTGAGGCAGCAGAATCGTTGG + Intronic
963868342 3:150386505-150386527 GGCTGAGGCAGCAGAATCGCTGG + Intergenic
963904438 3:150762563-150762585 GCCTGGCACTGCAGAATAGGAGG + Exonic
963938467 3:151077783-151077805 GGCTTGCCCTGCAGAATGGTTGG - Intergenic
964367554 3:155966163-155966185 GGCTGGTGCTCCAGAATCTTAGG - Intergenic
967071880 3:185969392-185969414 GGCTGAGGCAGGAGAATCGGTGG + Intergenic
967488798 3:190065007-190065029 GGCTGGCTCTCCATAATTGGAGG + Intronic
968045981 3:195624170-195624192 GCCTGGCTCTGCAGGAACGGAGG - Intergenic
968224570 3:196965691-196965713 GGCTGGCTGTGCAGAATCTTTGG + Intronic
968308673 3:197665917-197665939 GCCTGGCTCTGCAGGAACGGAGG + Intergenic
968650356 4:1757917-1757939 GGCTGGCCCTGGAGGATGGGGGG - Intergenic
969874294 4:10124473-10124495 GGCTGGTGCCCCAGAATGGGTGG - Intergenic
972221478 4:36960696-36960718 GGCTGAGGCTGGAGAATCGCTGG + Intergenic
972344711 4:38182955-38182977 GGCTGGCGCTGCGGGACTGGCGG + Intergenic
973097624 4:46222860-46222882 GGCTGAGGCAGCAGAATCGCTGG - Intergenic
973632875 4:52835698-52835720 GGCTGAGGCAGCAGAATCGCTGG + Intergenic
977055671 4:92187421-92187443 GGCTGAGGCTGGAGAATCGCTGG - Intergenic
977698138 4:99990383-99990405 GGCTGGGGCAGGAGAATCGCTGG - Intergenic
977984517 4:103366236-103366258 GGCTGGCATTGCAGCATTGGAGG + Intergenic
980054490 4:128066576-128066598 GGCTGAGGCAGGAGAATCGGGGG - Intronic
980738103 4:136917410-136917432 GGCTGGGGCTGCACACTCTGTGG + Intergenic
980869825 4:138598127-138598149 GGCAAGGGCTGCAGAATCTGAGG - Intergenic
981719978 4:147791683-147791705 GGCTGAGGCTGGAGAATCGCTGG - Intronic
983095946 4:163562194-163562216 GGCTGGGGCAGGAGAATCGCTGG + Intronic
985064197 4:186105175-186105197 TGCTGCCGCTGCAGGGTCGGGGG + Intronic
985616049 5:922639-922661 GGCAGGCGGTGCAGAGGCGGGGG + Intergenic
986560567 5:9056619-9056641 GGCTGAGGCAGCAGAATCGCAGG + Intronic
986707614 5:10464372-10464394 GGATGGCGGTGCAGAAGCAGAGG - Intronic
989598747 5:43182400-43182422 GGCTGACGCAGGAGAATCGCTGG - Intronic
992578881 5:78151017-78151039 GGCTGAAGCAGGAGAATCGGTGG - Intronic
994247059 5:97489615-97489637 GGCTGGGGCTGCACACTCCGTGG - Intergenic
996354124 5:122577890-122577912 GGCTGGAGTTGAAGAATGGGTGG - Intergenic
998379189 5:141711919-141711941 GGCTGGGGCTGCAGAGGTGGAGG - Intergenic
1002862961 6:1096111-1096133 CCCTGGCCCTGCAGAATCTGTGG + Intergenic
1005515155 6:26547625-26547647 GGCTGAGGCAGGAGAATCGGGGG - Intergenic
1006303647 6:33207034-33207056 GACTGGTGCTGCAGAACCAGTGG - Intergenic
1006418539 6:33919397-33919419 GGCTGTTACTGCAGAGTCGGTGG + Intergenic
1007431700 6:41780607-41780629 GCCTGGAGCTGCAGATTGGGGGG - Intronic
1013236221 6:108199407-108199429 GGCTGGGGCTGCACACTCCGTGG - Intergenic
1013709534 6:112880427-112880449 GGCTGGGGCTGCACACTCTGTGG - Intergenic
1014737081 6:125106035-125106057 GGCTGGAGCTGGAGAATCACTGG - Intergenic
1015385527 6:132618537-132618559 GGCTGAGGCAGCAGAATCGCTGG + Intronic
1017311611 6:152982899-152982921 GGCTGGCGCTGCAGGAGCAGCGG + Exonic
1018682395 6:166275267-166275289 GGCTGGGGCTGGGGAATTGGGGG + Intergenic
1019170696 6:170131674-170131696 GGCTGGCCCAGCAGCCTCGGAGG + Intergenic
1020098674 7:5382380-5382402 CGTTAGCGCTGCAGACTCGGGGG - Intronic
1020234881 7:6348009-6348031 GGCTGAGGCGGCAGAATCGCTGG - Intronic
1020286665 7:6686998-6687020 GGCTGGGGCAGGAGAATCGCTGG + Intergenic
1021284648 7:18765516-18765538 GGCTGAGGCAGAAGAATCGGTGG + Intronic
1022573447 7:31475222-31475244 GACTGGCCCTGCAGAATCCTTGG + Intergenic
1024590018 7:50872917-50872939 TGCTGGCTCTGAAGAATCTGGGG + Intergenic
1027232988 7:76282762-76282784 GGCTGGAGCTCCAGGAGCGGGGG - Exonic
1027245215 7:76362284-76362306 GGCTGACGCAGGAGAATCGCTGG + Intergenic
1028391746 7:90325127-90325149 GGCTGCGGCAGGAGAATCGGTGG + Intergenic
1030699856 7:112626535-112626557 GGCTGAGGCTGGAGAATCGCTGG - Intergenic
1030974578 7:116105634-116105656 GGCTTGCGCTGCTGAGTCTGTGG - Intronic
1035543847 8:463556-463578 TCCTGGCCCTGCAGAGTCGGTGG - Intronic
1036200884 8:6770924-6770946 GGCTGAGGCAGCAGAATCAGTGG + Intergenic
1036418815 8:8576509-8576531 GGCTGAGGCTGCAGAATGGATGG + Intergenic
1038292399 8:26261573-26261595 GGCTGAGGCAGGAGAATCGGTGG + Intergenic
1041081394 8:54218276-54218298 GGCTGGCGCAGCAGAAGTGGTGG - Intergenic
1042495624 8:69451895-69451917 GGCTGGGGCAGGAGAATCGCTGG + Intergenic
1043589744 8:81816288-81816310 GGCTGACGCAGGAGAATCGCTGG - Intronic
1045003960 8:97901351-97901373 GGCTGAGGCAGCAGAATCGCTGG - Intronic
1046195598 8:110859974-110859996 GGCTGGGGCTGCAGGCTCAGTGG + Intergenic
1047292854 8:123544910-123544932 GGCTGGGGCAGGAGAATCGCTGG + Intergenic
1048370796 8:133774439-133774461 GGCTGGAGCGGCAGCATCGGTGG + Intergenic
1049527642 8:143136456-143136478 GGCGGGCGGTGCAGAGCCGGGGG - Intergenic
1049828608 8:144685781-144685803 GGCTGCCGCGGCAGCAGCGGCGG - Intergenic
1053508151 9:38663436-38663458 AGCTGGCGCTGCAGCAACTGAGG + Intergenic
1055815522 9:80200610-80200632 GGCTGGGGCAGCAGAATCACTGG - Intergenic
1060606541 9:124919728-124919750 GGATGGCACTGCCGAATAGGGGG + Intronic
1061144625 9:128790471-128790493 GGCTGAGGCTGGAGAATCGCTGG + Intronic
1061286417 9:129625909-129625931 GGCTGACGCAGGAGAATCGCTGG + Intronic
1061732037 9:132623027-132623049 GGCTGAGGCAGGAGAATCGGTGG + Intronic
1062091505 9:134680924-134680946 GCCTGGCACTGCAGCCTCGGGGG + Intronic
1062478138 9:136739688-136739710 GGCTGTGGCTGCAGGATCGGGGG - Intronic
1187152020 X:16689949-16689971 GGCTGACGCAGGAGAATCGCTGG + Intronic
1187471697 X:19575475-19575497 GGCTGGTGCTTTAGAATCTGGGG - Intronic
1187509078 X:19901367-19901389 GGCTGAGGCAGCAGAATCGCTGG + Intergenic
1190129580 X:47734805-47734827 GGCTGAGGCTGGAGAATCGCTGG - Intergenic
1190137202 X:47807841-47807863 AGCTGGTGCTGCAGAGTCGGAGG - Intergenic
1191990001 X:67024942-67024964 GGCTGAGGCAGGAGAATCGGTGG - Intergenic
1192376129 X:70564126-70564148 GGCTGAGGCTGGAGAATCGCTGG + Intronic
1193819276 X:86142569-86142591 GGCTGGGGCAGGAGAATCGCTGG + Intergenic
1194713902 X:97268955-97268977 GGCTGGGGCAGGAGAATCGCTGG - Intronic
1196619300 X:117804517-117804539 GGCTGAGGCAGCAGAATCGCTGG - Intergenic
1197296338 X:124723699-124723721 GGCTGAGGCTGGAGAATCGCTGG - Intronic