ID: 900334457

View in Genome Browser
Species Human (GRCh38)
Location 1:2154747-2154769
Sequence TTCGTCCAGCTCTACTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900334452_900334457 14 Left 900334452 1:2154710-2154732 CCGAAGACAAGGGGTTGACCTAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 900334457 1:2154747-2154769 TTCGTCCAGCTCTACTTTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 117
900334455_900334457 -4 Left 900334455 1:2154728-2154750 CCTAGGAAGGCTTGAGAACTTCG 0: 1
1: 0
2: 0
3: 4
4: 101
Right 900334457 1:2154747-2154769 TTCGTCCAGCTCTACTTTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 117
900334451_900334457 15 Left 900334451 1:2154709-2154731 CCCGAAGACAAGGGGTTGACCTA 0: 1
1: 0
2: 0
3: 2
4: 117
Right 900334457 1:2154747-2154769 TTCGTCCAGCTCTACTTTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 117
900334450_900334457 16 Left 900334450 1:2154708-2154730 CCCCGAAGACAAGGGGTTGACCT 0: 1
1: 0
2: 0
3: 5
4: 52
Right 900334457 1:2154747-2154769 TTCGTCCAGCTCTACTTTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900334457 Original CRISPR TTCGTCCAGCTCTACTTTCT GGG Intronic
900334457 1:2154747-2154769 TTCGTCCAGCTCTACTTTCTGGG + Intronic
903295300 1:22339673-22339695 CTCCTCCAGCGCTGCTTTCTGGG - Intergenic
904734217 1:32617946-32617968 TCTGTCCAGTTCTCCTTTCTGGG - Intronic
906154393 1:43605600-43605622 CTCGTCCAGCTCCAGTTCCTCGG - Exonic
907846934 1:58217336-58217358 TTCATCCTTCTCTACTTTCGGGG - Intronic
907847977 1:58227077-58227099 TTTAGCCAGCTCTACTGTCTTGG - Intronic
909097003 1:71300200-71300222 TTCCTACTGCTCTCCTTTCTAGG + Intergenic
913324453 1:117614507-117614529 TTGTTCCAGCTCTCCTTCCTGGG + Intronic
918424036 1:184390007-184390029 TCCTTCCAGCTCTACTTTGAGGG + Intronic
922445427 1:225692933-225692955 TTCTACCAGCTCTACTTTCACGG - Intergenic
924377849 1:243431704-243431726 TTCACACAGCTCTATTTTCTAGG - Intronic
924447576 1:244148269-244148291 TTCATCCTTCTCTACTTTATAGG + Intergenic
924597206 1:245457297-245457319 TTCTTCCAGCTCTCCTTTCTGGG - Intronic
1067794328 10:49309829-49309851 TTCCTCTTGCTCTTCTTTCTGGG - Intronic
1068291971 10:55015258-55015280 TTAGTCTATCTCTTCTTTCTTGG + Intronic
1076255989 10:129025363-129025385 GCTGGCCAGCTCTACTTTCTAGG - Intergenic
1079453153 11:20614986-20615008 TTCATCCAGCTCTGCTTTCCAGG - Intronic
1080338583 11:31229843-31229865 TTCATCCATCTCTACTTTGTTGG - Intronic
1080479272 11:32629211-32629233 TCTGTCCCCCTCTACTTTCTGGG - Intronic
1081288108 11:41297418-41297440 TCTCTCCAGCTCTATTTTCTTGG + Intronic
1083806877 11:65079632-65079654 GGCGTCCAGCTCTCCTTCCTTGG + Exonic
1084860388 11:72014257-72014279 TTCCTCCAGCTCTTTTATCTGGG + Exonic
1088984414 11:114892887-114892909 TTTGTCCAGCTCTAATGTCTAGG - Intergenic
1093988118 12:25560479-25560501 TGCCTCCAGCTTTGCTTTCTTGG + Intronic
1095040470 12:37435251-37435273 TTACTCCAGCTCTGCTTTCAGGG - Intergenic
1098862201 12:75722577-75722599 TTTCTCCACCTCTACTTTCCTGG + Intergenic
1103159538 12:118717090-118717112 TTGGTTCGGCTCTACTCTCTGGG + Intergenic
1107528810 13:41261857-41261879 TTTCACCAGCCCTACTTTCTTGG - Intronic
1108021679 13:46134126-46134148 TTCATCCATCTCTAGTTTCAAGG - Exonic
1117541759 14:56753789-56753811 TTCATCCAGGTCTAATTTTTTGG - Intergenic
1119078356 14:71667558-71667580 TTTGCCCAGATCTGCTTTCTTGG + Intronic
1124071939 15:26403569-26403591 TGCTTCCATCTCTGCTTTCTTGG + Intergenic
1125445308 15:39748158-39748180 TTCTTCCAGTTCTTCTTTTTTGG + Intronic
1126357723 15:47813711-47813733 TGAGTCCAGCTCTACTCTCAAGG + Intergenic
1127672974 15:61213205-61213227 TTCTTCCAACTCCACTTCCTGGG + Intronic
1129828329 15:78650388-78650410 TTCATCCAGCTCTGTTTTCCTGG + Intronic
1132977097 16:2716334-2716356 TTCCTCCTCCTCTCCTTTCTGGG + Intronic
1135108328 16:19670388-19670410 TTCTTCCAGCTCTGCGTTCTTGG + Intronic
1138723652 16:59111389-59111411 TTCATTGAGCCCTACTTTCTGGG + Intergenic
1148591647 17:48820747-48820769 TTCATCCTCCTCCACTTTCTGGG + Intergenic
1151693981 17:75704762-75704784 TTTGTCCATCTCAATTTTCTGGG - Exonic
1155834523 18:30563262-30563284 TTAATCCAACTCTACATTCTTGG + Intergenic
1156369424 18:36459404-36459426 TTCGCCCAGCTCTAAGCTCTGGG - Intronic
1157168525 18:45380979-45381001 TTTGTCCAGCTCTAGTCTCCAGG + Intronic
1159067401 18:63585638-63585660 TTTATCCATCTCTTCTTTCTAGG - Intergenic
1160751707 19:737512-737534 TTCCTCCAGCTCAACGTCCTTGG - Intronic
1163118720 19:15202999-15203021 TCCCTCCAGCTCAACTTTCAGGG - Intergenic
1165392660 19:35547328-35547350 TTCGTCCACCTCTGCTCGCTGGG + Exonic
925601168 2:5610157-5610179 ATCTTCCATCTCTACTTTCTGGG + Intergenic
931115340 2:59160605-59160627 TTAGCCCATCTCTTCTTTCTTGG - Intergenic
935586549 2:104804837-104804859 TTCCTCAAGCTCTACTTTCTGGG + Intergenic
936959833 2:118061472-118061494 TTCTTGCAACTCTGCTTTCTTGG + Intergenic
937201815 2:120208978-120209000 ATCGTCCATCTCTACTGTCCTGG + Intergenic
942297125 2:174528426-174528448 TTCAACCAGCTCCACTATCTAGG - Intergenic
945427901 2:209730038-209730060 TTTGTCCAGGTCTACAATCTGGG - Intronic
945520811 2:210824840-210824862 TTCTACCAGCTCTTCTATCTTGG + Intergenic
945592628 2:211753555-211753577 TTCATCCAACTCTTCTTTCCTGG - Intronic
946995510 2:225386488-225386510 TTCTTCCAGGTCTTCTCTCTGGG + Intergenic
947661757 2:231874755-231874777 TTTCTCCATCTCTACGTTCTTGG + Intergenic
1168874478 20:1161352-1161374 TTGTTCCAGCCCTTCTTTCTGGG + Intronic
1170551654 20:17481994-17482016 TTCCTCCAGCTCCTCTTTCTTGG - Exonic
1171535033 20:25879922-25879944 TTTCTCCAGCTCTGCTTTCAGGG - Intergenic
1171572854 20:26270034-26270056 TTACTCCAGCTCTGCTTTCAGGG + Intergenic
1171806039 20:29681028-29681050 TTACTCCAGCTCTGCTTTCAGGG + Intergenic
1171838023 20:30175406-30175428 TTACTCCAGCTCTGCTTTCAGGG - Intergenic
1172313905 20:33938835-33938857 TTCTTCTGGCTCTGCTTTCTGGG - Intergenic
1172990072 20:39028978-39029000 TTCTTCCAGTTCCATTTTCTAGG + Intronic
1175283319 20:57820008-57820030 TGCCTCCAGCTCTACTTTTCAGG + Intergenic
1178167175 21:29992430-29992452 TCCCTCAAGCTCTACTGTCTGGG - Intergenic
1180574407 22:16759451-16759473 TTACTCCAGCTCTGCTTTCAGGG - Intergenic
1180866286 22:19121908-19121930 TTCGTGCAGCTCTGCTGTCCAGG - Intronic
1182038640 22:27219079-27219101 TGGGTCCAGCTCTCCTTTCTTGG + Intergenic
950012041 3:9731105-9731127 CTAGTCCAGCTCCACTTTCCAGG + Intergenic
954364832 3:50140190-50140212 TCCGTGCAGCTCTGCTTCCTGGG + Intergenic
958669068 3:97180004-97180026 TTGGTCCAGATGTACTGTCTTGG + Intronic
958717029 3:97796422-97796444 GTCTTTCTGCTCTACTTTCTGGG - Intronic
960487129 3:118267839-118267861 TCCTTCCAGCTCTACTGTTTTGG - Intergenic
962345175 3:134613403-134613425 TTCCTCCTGCTCTCCTTTCCAGG - Intronic
962929696 3:140024984-140025006 TTCTTCCAGCTCAAAATTCTTGG - Intronic
964578838 3:158207229-158207251 TTCTTTCAGTTCTATTTTCTAGG - Intronic
966388442 3:179426784-179426806 TTCCTCCACTTCTACTGTCTGGG + Intronic
972558734 4:40206554-40206576 TTCCTCAAGCTCTACTCTTTGGG + Intronic
975257092 4:72250163-72250185 TTCCTCCTCTTCTACTTTCTTGG + Intergenic
981102356 4:140843204-140843226 GTCCTGCAGCTCTGCTTTCTGGG - Intergenic
981761212 4:148197063-148197085 TTCTTCCAACTCTACCTTTTTGG - Intronic
982385125 4:154792712-154792734 ATAGTCCTTCTCTACTTTCTTGG - Intronic
982480286 4:155900536-155900558 TTAGTCCCTCACTACTTTCTGGG - Intronic
983758189 4:171368982-171369004 TTCCCCCATCTCCACTTTCTTGG + Intergenic
986331713 5:6721197-6721219 CTCCTCCTGCTCTTCTTTCTTGG - Intronic
988216809 5:28285868-28285890 TACCTCGTGCTCTACTTTCTAGG - Intergenic
990602202 5:57370521-57370543 TTCCTCCAGCTATTATTTCTGGG + Intergenic
991157001 5:63449856-63449878 TTCTGGCAGCTCTATTTTCTGGG - Intergenic
996410706 5:123155932-123155954 CTCATCCAGCTCGACTTACTAGG - Exonic
996580773 5:125029697-125029719 TGCCTCAAGCTCTGCTTTCTGGG + Intergenic
998521559 5:142805696-142805718 TCTGTCCAGCTCATCTTTCTGGG - Intronic
1000643731 5:163736288-163736310 TTCTTCCATCTCTAGTTTCACGG + Intergenic
1002673274 5:180887546-180887568 TTCTCCCAGCTCTATTTTCTGGG + Intergenic
1003245189 6:4377017-4377039 TGCCTCCAGCTCTACCTGCTGGG + Intergenic
1005734592 6:28733833-28733855 TTTCTGCAGCTCCACTTTCTAGG - Intergenic
1008866909 6:56223119-56223141 TTCTTCCAACATTACTTTCTGGG + Intronic
1014031504 6:116710759-116710781 TTCTTCCAGCTTATCTTTCTTGG + Intronic
1020941522 7:14544878-14544900 TTCCTCTATCTCTGCTTTCTAGG + Intronic
1022032319 7:26503725-26503747 ATCTTCCAGCTCTCCTTTCCGGG + Intergenic
1022089880 7:27101176-27101198 CTCGTCCTCCTCTACTTTCTCGG + Exonic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1024526184 7:50351430-50351452 TTCCTCCATATCTACTTTCCCGG + Intronic
1024884992 7:54130710-54130732 TCCATTTAGCTCTACTTTCTGGG + Intergenic
1028410994 7:90530272-90530294 TTGGTCCTCCTCTACTATCTTGG - Intronic
1032524496 7:132569366-132569388 TTCCTTGAGCTCTACTTTCTAGG + Intronic
1032856083 7:135834718-135834740 TTTCTCCAGCTCTTTTTTCTAGG - Intergenic
1035828460 8:2669154-2669176 CTCTTCCAGCTCTGCTGTCTTGG + Intergenic
1036687688 8:10922920-10922942 TCCTTCCAGCTCTCCTCTCTAGG + Intronic
1038990070 8:32858325-32858347 TTTCTCCAGCTATAATTTCTAGG - Intergenic
1042349368 8:67761500-67761522 TCCGTCCAGTTCTACCTTCCTGG - Intergenic
1044825707 8:96194942-96194964 TTCGGACAGCTCTGCTTTCCTGG + Intergenic
1050760465 9:9063175-9063197 TTCATAAAACTCTACTTTCTAGG + Intronic
1051287523 9:15511454-15511476 TTCGTACAGCTCCTCTTTTTTGG - Intergenic
1053705180 9:40746138-40746160 TTTGTCCATGTCTCCTTTCTTGG - Intergenic
1054415257 9:64869745-64869767 TTTGTCCATGTCTCCTTTCTTGG - Intergenic
1056897327 9:90563229-90563251 CTCATCCTACTCTACTTTCTTGG + Intergenic
1057750626 9:97789759-97789781 TGCCTCAAGCTCTGCTTTCTGGG - Intergenic
1059658547 9:116378670-116378692 TTGATCTAGCTCTATTTTCTTGG + Intronic
1060331570 9:122675915-122675937 TTTGTCCAGCTATACTGTCAAGG + Exonic
1060505588 9:124195728-124195750 TTCCTCTAGCTCTATTTTTTTGG - Intergenic
1061752207 9:132787047-132787069 TTTGTTTGGCTCTACTTTCTGGG - Intronic
1185782667 X:2862711-2862733 TTTCTCCAGCTCCAATTTCTAGG + Intronic
1190413359 X:50158515-50158537 TTGTACCAGCTCTACATTCTAGG + Intergenic
1190638852 X:52463584-52463606 TTCATCCAGCTCTATAGTCTAGG - Intergenic
1190680096 X:52819161-52819183 TTCATCCAGCTCTACAGCCTGGG - Intergenic
1191193393 X:57691449-57691471 TTCTTCCAACTTTACTTTTTTGG + Intergenic
1195458592 X:105098241-105098263 TTCTTCCACTTGTACTTTCTAGG + Intronic