ID: 900337806

View in Genome Browser
Species Human (GRCh38)
Location 1:2173360-2173382
Sequence AGTCCCCCTGGTCCCTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900337806_900337815 19 Left 900337806 1:2173360-2173382 CCTCAGCAGGGACCAGGGGGACT 0: 1
1: 0
2: 4
3: 20
4: 214
Right 900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG 0: 1
1: 0
2: 3
3: 19
4: 164
900337806_900337813 10 Left 900337806 1:2173360-2173382 CCTCAGCAGGGACCAGGGGGACT 0: 1
1: 0
2: 4
3: 20
4: 214
Right 900337813 1:2173393-2173415 CAGAGACAGCTGCTGTCCTTGGG 0: 1
1: 0
2: 3
3: 32
4: 292
900337806_900337817 25 Left 900337806 1:2173360-2173382 CCTCAGCAGGGACCAGGGGGACT 0: 1
1: 0
2: 4
3: 20
4: 214
Right 900337817 1:2173408-2173430 TCCTTGGGCAAAACGGGTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 62
900337806_900337814 18 Left 900337806 1:2173360-2173382 CCTCAGCAGGGACCAGGGGGACT 0: 1
1: 0
2: 4
3: 20
4: 214
Right 900337814 1:2173401-2173423 GCTGCTGTCCTTGGGCAAAACGG 0: 1
1: 0
2: 2
3: 14
4: 199
900337806_900337812 9 Left 900337806 1:2173360-2173382 CCTCAGCAGGGACCAGGGGGACT 0: 1
1: 0
2: 4
3: 20
4: 214
Right 900337812 1:2173392-2173414 GCAGAGACAGCTGCTGTCCTTGG 0: 1
1: 0
2: 4
3: 38
4: 310
900337806_900337816 24 Left 900337806 1:2173360-2173382 CCTCAGCAGGGACCAGGGGGACT 0: 1
1: 0
2: 4
3: 20
4: 214
Right 900337816 1:2173407-2173429 GTCCTTGGGCAAAACGGGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900337806 Original CRISPR AGTCCCCCTGGTCCCTGCTG AGG (reversed) Intronic
900149442 1:1171706-1171728 GGTCCCGCTGGACCCTGGTGCGG - Intergenic
900337806 1:2173360-2173382 AGTCCCCCTGGTCCCTGCTGAGG - Intronic
900339693 1:2182225-2182247 GGCCCCCCTGGGCCCTGCAGTGG + Intronic
900798824 1:4725419-4725441 GGTCCCCCTGGTGCCTGGCGAGG + Intronic
901607289 1:10469279-10469301 AGTCACCCTGGTCCTGGCAGAGG - Exonic
902037744 1:13469915-13469937 CACCCCCTTGGTCCCTGCTGTGG + Intergenic
902439169 1:16418051-16418073 AGGGCCCCTGCTCCCTGCTCTGG - Intronic
902985393 1:20151462-20151484 AGCCGCTCTGGTCCCTGCAGGGG - Intergenic
904819373 1:33231519-33231541 AGTCCCCGATCTCCCTGCTGGGG + Intergenic
905210370 1:36369867-36369889 AGGCACCATGGTCCCTGCTGGGG + Intronic
905912375 1:41663074-41663096 AGTCACTCTGGTCCTTGCTCTGG + Intronic
906508190 1:46395335-46395357 AGTCTCTCTGGCTCCTGCTGTGG + Intronic
906698747 1:47842415-47842437 ATTCTGCCTGGTCCCTGCTGGGG + Intronic
907534239 1:55134756-55134778 ACTCCCCCTGTTCTCTACTGGGG - Intronic
911370812 1:96992840-96992862 AGTTCCCCTCATCCCTACTGAGG - Intergenic
912274732 1:108244145-108244167 AGGCCCCCTGGTCTCACCTGAGG + Intergenic
912286533 1:108375713-108375735 AGGCCCCCTGGTCTCACCTGAGG - Intergenic
912293486 1:108450196-108450218 AGGCCCCCTGGTCTCACCTGAGG - Intronic
913280971 1:117184775-117184797 AGTCACCCTGGCTCTTGCTGTGG - Intronic
919103435 1:193121627-193121649 GCTCCCCCGGGTCCCTGCTTTGG - Intergenic
919823877 1:201490198-201490220 ACTCCCCCTTGTCAGTGCTGAGG + Exonic
920569732 1:207007615-207007637 AGTCCCAGTGATCCCTTCTGTGG - Intronic
921369636 1:214408243-214408265 AGTCCCCCAGGTCAGTGCTTGGG + Intronic
922109559 1:222543832-222543854 CGTCTCCATGGTCCATGCTGGGG - Exonic
922215302 1:223515466-223515488 TGGCCCACAGGTCCCTGCTGGGG - Intergenic
1066661919 10:37745227-37745249 TGTCCCCATTGTCCTTGCTGTGG - Intergenic
1067261516 10:44697274-44697296 ACTTCCCATGTTCCCTGCTGTGG + Intergenic
1067551018 10:47236611-47236633 AGACCCCCTGGTCCCTGCAGCGG - Intergenic
1070820132 10:79349557-79349579 TATCCCCCTGTTCACTGCTGGGG + Intronic
1072714891 10:97744441-97744463 TGTCCCTTTGGTCACTGCTGTGG - Intronic
1075220928 10:120583938-120583960 AGGTCCCCTGGTCCATGCTGAGG + Intronic
1075547565 10:123366722-123366744 AACACCACTGGTCCCTGCTGAGG - Intergenic
1075729485 10:124627765-124627787 ATTCCCGCTGGCCCCAGCTGGGG + Intronic
1075997907 10:126893164-126893186 CATCCCCCTGCTTCCTGCTGGGG + Intergenic
1076033831 10:127182186-127182208 AGTGCCCCTTTTCCCTGCTTTGG - Intronic
1076522408 10:131089368-131089390 ACTGCCCCGGGTCTCTGCTGGGG - Intergenic
1076615674 10:131752588-131752610 AGGCCACTTGGTCTCTGCTGTGG - Intergenic
1076899409 10:133329993-133330015 AGCCCCGCGGGGCCCTGCTGTGG - Intronic
1077392363 11:2305881-2305903 GGTCTCCCAGCTCCCTGCTGTGG - Intronic
1077793171 11:5462969-5462991 AGTCCTCCTATTCCCTGCAGAGG - Intronic
1078447264 11:11413653-11413675 ACTCCCTCTGCTCCATGCTGGGG - Intronic
1080836608 11:35945458-35945480 AGACCTCCTGGTGACTGCTGTGG + Intronic
1081972234 11:47207449-47207471 AATACACCTGGTCTCTGCTGTGG + Intergenic
1083311499 11:61786164-61786186 GGCACCCCTGGTCCCTGGTGTGG - Exonic
1083630308 11:64091813-64091835 AGTCCCCCAGGAGGCTGCTGAGG + Intronic
1083669136 11:64290908-64290930 AGACCCTCTGGTGCCTGCTGGGG - Intergenic
1083727533 11:64636357-64636379 AGTCGCCATGTTCCCTCCTGCGG + Intronic
1084460059 11:69292143-69292165 AGCCCACCTGGGTCCTGCTGGGG - Intergenic
1084942474 11:72620336-72620358 AGTCCCCCTTGTGGCTTCTGAGG - Intronic
1085054159 11:73394403-73394425 AGTCACCCTGTTCCCTGCTGGGG + Intronic
1085338733 11:75717728-75717750 AGGCCTCCTTGCCCCTGCTGAGG - Intergenic
1085353502 11:75815619-75815641 AGCCCTCCGGGTCCCTGCTCTGG - Intronic
1089145416 11:116326406-116326428 AGTCACCCTGCACCCTTCTGTGG + Intergenic
1089795496 11:120977332-120977354 AGTCCCCCTTGCCATTGCTGAGG + Intronic
1090243499 11:125200158-125200180 GGGCCCTCTGGTCCCTGCTCCGG - Intronic
1091375463 12:22243-22265 AGTCCCCCTAGAGGCTGCTGGGG + Intergenic
1091634694 12:2187933-2187955 AGGCACCTTGGCCCCTGCTGTGG + Intronic
1092857524 12:12688750-12688772 AGTACCCCTGGCCCCTGCTGTGG - Intronic
1096111307 12:49030853-49030875 AGTCCCCCTGGTCCCATCCCAGG - Intronic
1102017263 12:109656162-109656184 AGCACCCCTGCTTCCTGCTGAGG + Intergenic
1102146500 12:110658663-110658685 AGCCCCCCTCCTCCCTGCGGAGG + Intronic
1103923746 12:124412681-124412703 AGCCACCCTGCTCCCTGCTCAGG + Intronic
1108594358 13:51937205-51937227 TGTCTCCCAGGTTCCTGCTGGGG - Intronic
1110767256 13:79295039-79295061 AGTACCCCTGGTCTCTGAAGAGG - Intergenic
1111125423 13:83907473-83907495 ATGCCCCCTGGTTCCTTCTGGGG - Intergenic
1113328083 13:109302150-109302172 AGTCCCCCTGGCCTCAGCAGGGG + Intergenic
1113488911 13:110676915-110676937 AGTTCCCCTGGTGCCTGCTCAGG - Intronic
1113594059 13:111519146-111519168 AGTCCCCGGGGTCCCTGACGGGG + Intergenic
1114282331 14:21204441-21204463 AGTCCCCATTGGCCCTCCTGGGG - Intergenic
1117438921 14:55742503-55742525 AATCCCTCTGAGCCCTGCTGTGG - Intergenic
1118257571 14:64218464-64218486 AGTCCCCCGTCTTCCTGCTGTGG - Exonic
1118734070 14:68689845-68689867 AGGGCCACTGGGCCCTGCTGAGG + Intronic
1119071473 14:71589063-71589085 CATCTCCCTGGTCCATGCTGAGG - Exonic
1119390164 14:74286392-74286414 AGTCCTCCTGGTCTCTCCTGAGG + Exonic
1122783931 14:104155366-104155388 TGGCCGCCTGGTGCCTGCTGTGG + Intronic
1124631196 15:31338645-31338667 TGTACCCTTGGTCCCTGATGAGG + Intronic
1126112998 15:45186660-45186682 TCTCCCCCTGGTCCATTCTGAGG - Intronic
1129256386 15:74336325-74336347 CGTCTCCCTGGCCCCTGCTTTGG - Intronic
1129262215 15:74374750-74374772 AGTCCCCGGGCCCCCTGCTGGGG - Intergenic
1129686790 15:77690761-77690783 AGTCCCCTTGGCCCAGGCTGGGG + Intronic
1131461586 15:92621739-92621761 TGACCCCCTGGCCCCTTCTGTGG + Intronic
1131840805 15:96435463-96435485 AGTCACACTAGTCTCTGCTGAGG + Intergenic
1131944792 15:97608348-97608370 GCACCCCATGGTCCCTGCTGGGG - Intergenic
1132542559 16:517733-517755 AGTCCCCGTGGGCCCTGCACTGG - Intronic
1136363766 16:29798980-29799002 AGACCTCCTGGACCCTGCTTCGG + Exonic
1137476135 16:48811288-48811310 AGTCCCCCAGAGCCCGGCTGAGG - Intergenic
1138461085 16:57148145-57148167 AGCCCGTCAGGTCCCTGCTGAGG - Exonic
1141377326 16:83543709-83543731 ATACCCGCTGGTCCCAGCTGGGG - Intronic
1142339057 16:89508678-89508700 AGGCCGCCTGGCCCCTGCGGCGG + Intronic
1144630496 17:16869713-16869735 AGACCTCCTGGGGCCTGCTGAGG + Intergenic
1146186852 17:30729813-30729835 TGACCCCCTGGTCTCTGCTGGGG - Intergenic
1147945960 17:44080344-44080366 AGCCCCTCTGGGCCCTGCAGTGG - Intronic
1150392475 17:64798008-64798030 ATTCCCACTGGCCCCGGCTGTGG - Intergenic
1151135857 17:71945247-71945269 AGTCCCCAGAGTCCCTACTGGGG + Intergenic
1151448965 17:74185804-74185826 TGTCTCCCTGGTGCCTGCGGTGG + Intergenic
1152257119 17:79246602-79246624 TGTCCCCCTGCTCCCGGGTGTGG + Intronic
1152605030 17:81285315-81285337 AGTCCCTCTGGTGCAGGCTGTGG - Intronic
1152676742 17:81645206-81645228 ACTTCCCCTTCTCCCTGCTGGGG + Exonic
1152769448 17:82158157-82158179 AGTTCCCCTGTGCCCTGCTCTGG + Intronic
1152945671 17:83196194-83196216 AGTCCCCCTGGACCTTGGTTTGG + Intergenic
1156373009 18:36488412-36488434 AGACCCCCAGGGCCCAGCTGGGG + Intronic
1157733559 18:50025770-50025792 TGTCCCACGGGCCCCTGCTGGGG - Intronic
1159917180 18:74198143-74198165 AGTCCCCCTGGTCCCTGCCCAGG + Intergenic
1160439112 18:78875556-78875578 AGCCCCACTGGTTTCTGCTGAGG - Intergenic
1160532781 18:79575268-79575290 AGTTCCCCAGGTCCTTGCAGAGG - Intergenic
1160989882 19:1856153-1856175 CCTCACCATGGTCCCTGCTGTGG - Intronic
1162461248 19:10815661-10815683 AGTCCCCATGGTCCCTGGGATGG + Intronic
1162972044 19:14186684-14186706 TGACCCCCTGGTCTCTGCTGGGG + Intronic
1163281292 19:16319642-16319664 TGTCCCCCTGGGCCCAGCTGTGG - Intergenic
1163447143 19:17353364-17353386 AGTTCCTCTGGTCACTGTTGGGG - Intronic
1164678471 19:30118723-30118745 AGCACCCCTGGTCCCTGCCTTGG + Intergenic
1165076506 19:33282540-33282562 CCTCCTCCTGGTCCCTGGTGGGG + Intergenic
1165698015 19:37915771-37915793 AGGGCCCCAGGTCCCTGCTCCGG + Intronic
1166054253 19:40279236-40279258 AGAGCACCTGGGCCCTGCTGTGG + Intronic
1166753861 19:45178874-45178896 AGTCCGACTGGACTCTGCTGGGG - Intronic
1166761003 19:45224513-45224535 GGTCCCCCAGATCCCTGCTCAGG - Intronic
1167577417 19:50324427-50324449 AGAACCCGTGGACCCTGCTGGGG - Intronic
1167716317 19:51144700-51144722 GGACGCCCTGGTCCCTGATGAGG + Intronic
928158074 2:28894725-28894747 CGACCCCCTGGCCCCTGCTGGGG + Exonic
928195856 2:29215981-29216003 AGTCCCCCTGGTCTCCCATGTGG - Intronic
932330838 2:70897512-70897534 AGTCCCCCGGGTCCTTGGTGAGG - Intergenic
935187698 2:100748610-100748632 GCTCCCCCAGGTCCCTGCTGAGG - Intergenic
935697190 2:105780602-105780624 AGAGCCCCTGGTCACTGATGTGG + Intronic
935763471 2:106342692-106342714 AGAGCCTCTGGTCTCTGCTGCGG + Intergenic
936152157 2:110027800-110027822 TGTCCCCCAGGCCACTGCTGCGG - Intergenic
936192521 2:110343613-110343635 TGTCCCCCAGGCCACTGCTGCGG + Intergenic
936433281 2:112482289-112482311 CGGCCGCCTGGTCCCTGCGGCGG + Exonic
937090658 2:119204140-119204162 AGTCCCCATGGTCCCTTCCTTGG - Intergenic
937115148 2:119399483-119399505 AGGCCCCCTGGACCCAGCAGTGG - Intergenic
937223174 2:120353611-120353633 TGTCCCACTGGTCCCAGGTGGGG - Intergenic
938067508 2:128289240-128289262 AGTCCCCAGGGTCACTGCTCAGG - Intronic
940847282 2:158655838-158655860 AGTCACGCTGGGCCCTGATGGGG - Intronic
943525321 2:189008969-189008991 GGTGCCCCTGGTCCTTGCTGTGG + Exonic
944897249 2:204177798-204177820 AGAGCCCCTGGTCTCTGGTGAGG + Intergenic
946370563 2:219279228-219279250 AGTCTCCCAGGTCCCAGCTGGGG + Intergenic
948901945 2:240960579-240960601 CGTCCCCGTGGGCCCCGCTGGGG - Intronic
948932432 2:241140614-241140636 TGTCCTGCTGCTCCCTGCTGCGG - Exonic
948938641 2:241184959-241184981 AGTCCCCTGGGTTCCTGCTGAGG - Intergenic
1170808382 20:19654072-19654094 TTTCCTCCTGGTGCCTGCTGAGG + Exonic
1171351347 20:24505398-24505420 AGCCCCCCTCTTCCCCGCTGAGG - Intronic
1172865093 20:38089833-38089855 AGCCCCCCTGCCCTCTGCTGGGG + Exonic
1174046445 20:47737133-47737155 AGTCCACCTGGACACTCCTGAGG + Intronic
1174401393 20:50277927-50277949 AGTGCCCATGGGACCTGCTGGGG - Intergenic
1174447187 20:50598019-50598041 TGCCTCCCTGGTCCCCGCTGGGG - Intronic
1175138046 20:56839746-56839768 AGACCCCCTTATCCCTGTTGGGG + Intergenic
1176728543 21:10465811-10465833 AGAACCCCAGGTCCCTGGTGTGG + Intergenic
1177411574 21:20736941-20736963 AGTCTCCCTGGATCCTGCAGAGG - Intergenic
1179719238 21:43306076-43306098 AGCCACCCTGGGCCCTGCAGTGG + Intergenic
1180060681 21:45383447-45383469 CCTCCCCCTGGCCCCTGCGGTGG + Intergenic
1180075351 21:45459055-45459077 AGTCCCCCAGGACCCTGCACGGG - Intronic
1181023464 22:20115125-20115147 AGTCCCCCTGCTCTCTCCTCTGG + Intronic
1181082979 22:20426232-20426254 AGTCCCCACTGTCCCTGCCGAGG - Exonic
1181715666 22:24725824-24725846 GCTCCCCCTGGTTCCTGCTTTGG + Intronic
1182373190 22:29826722-29826744 AGGCCCCATGTTCCCTGCAGAGG + Intronic
1183279202 22:36923125-36923147 GGTCTCCCAGGTCCCTGCAGAGG - Intronic
1183379912 22:37485635-37485657 AGGCTCCCGGGTCCCTCCTGGGG - Intronic
1185071469 22:48659061-48659083 AGTCTCCGAGGGCCCTGCTGAGG + Intronic
1185153257 22:49178508-49178530 AGTCCCCAGGGGCCCTCCTGAGG - Intergenic
952979760 3:38725173-38725195 TGTTCCTCAGGTCCCTGCTGAGG - Exonic
958632340 3:96700257-96700279 ATTCCCCCTAGACACTGCTGTGG + Intergenic
958833293 3:99115251-99115273 AGTCCCCTTGGGATCTGCTGTGG + Intergenic
961651288 3:128417926-128417948 AGGCCCCCGGGTCCTGGCTGGGG - Intergenic
965664840 3:171082209-171082231 AGTCCCCCAGGTCCATACAGCGG - Intronic
967606422 3:191452231-191452253 GGTCCCCTTGGGACCTGCTGTGG + Intergenic
968701907 4:2061418-2061440 CGTCTCCCTGGCGCCTGCTGCGG + Intronic
969369781 4:6724283-6724305 AGTCTCCCGAGTACCTGCTGGGG + Intergenic
969396748 4:6926793-6926815 AGTCCTCTGGGTACCTGCTGTGG - Intronic
969690896 4:8703560-8703582 AGTGCACCTGGCCCCTCCTGGGG - Intergenic
971574231 4:28253802-28253824 AGTCTCCCTGGCACCAGCTGGGG - Intergenic
973545155 4:51973577-51973599 AGTCTCCCTGGTACCTGCAGGGG + Intergenic
973651433 4:53000662-53000684 ACTGCCCCTGGTCCTCGCTGTGG + Intronic
973902060 4:55485523-55485545 AGTCACACTTGTCCATGCTGTGG + Intronic
977181453 4:93880088-93880110 AGCTCCCCAGGGCCCTGCTGGGG - Intergenic
984443558 4:179804647-179804669 AGTCCACCTGTTCCCTGTGGGGG - Intergenic
984878804 4:184392548-184392570 TTTCCACCCGGTCCCTGCTGAGG + Intronic
986972453 5:13352975-13352997 AATGCCCCTGGTGACTGCTGTGG + Intergenic
989605998 5:43245308-43245330 AGGCCCCCACGTCCCTGCTGCGG - Exonic
990543968 5:56803763-56803785 AGTCCCTCTGGGCCCATCTGGGG - Intergenic
991968281 5:72112889-72112911 AGTCATCCTGGTCTCTGTTGGGG - Intronic
993306580 5:86282360-86282382 AGGCCCCCTGGTCTCACCTGAGG - Intergenic
993654363 5:90559029-90559051 AGCCTCCCTGGGCCCGGCTGTGG - Intronic
995615092 5:113952859-113952881 GGTCCCAATGGTCCTTGCTGCGG + Intergenic
996639056 5:125730567-125730589 AGTCTCCCTGGCTCCTGCAGGGG - Intergenic
1000629099 5:163571772-163571794 AACCCCTCTGGTCCCTGTTGGGG + Intergenic
1001330848 5:170761324-170761346 AGGACCCCTGGTCCTTGTTGAGG - Intergenic
1001401883 5:171450912-171450934 GGTGCCGCTGGCCCCTGCTGGGG - Intronic
1001594685 5:172890735-172890757 AGCCCCCCTAGTGCCTGGTGTGG + Intronic
1001960977 5:175880276-175880298 GGCCCCCCTGACCCCTGCTGGGG - Exonic
1002599413 5:180345843-180345865 TGTCCCTCTTGTCCTTGCTGTGG - Intronic
1003085367 6:3056070-3056092 AGGCAGCCTGTTCCCTGCTGGGG - Intergenic
1003355834 6:5368975-5368997 TGTCCCCCTTCTTCCTGCTGGGG - Exonic
1003669079 6:8139190-8139212 CATCCTCCTGGTGCCTGCTGGGG + Intergenic
1004171868 6:13301512-13301534 AGTCCACCTTCTCCCTGGTGTGG + Intronic
1007956293 6:45920767-45920789 AATCCTCCTGGGCCCTGCTGGGG - Intronic
1008487557 6:52052316-52052338 CCTCCTCCTGGGCCCTGCTGAGG - Intronic
1017898976 6:158704417-158704439 AATCCCCCGCGTCCCCGCTGCGG - Intronic
1018059508 6:160079354-160079376 GCTCCTCCTGCTCCCTGCTGGGG - Intronic
1018757401 6:166862361-166862383 AGCCCCCCGGGTCCCTCCTCCGG - Exonic
1019308689 7:348374-348396 AATCCCTCCAGTCCCTGCTGGGG + Intergenic
1019342176 7:513469-513491 TGGCCCCCTGGTCCCAGCTGGGG + Intronic
1019661963 7:2229543-2229565 AGTCCTTCTGCTCACTGCTGTGG + Intronic
1020091498 7:5344709-5344731 AGTTCCCCTGGCCCCAGCAGGGG - Intronic
1023050778 7:36249290-36249312 AGTGCCCCCGGCCACTGCTGGGG + Intronic
1023530609 7:41149724-41149746 AGGCCCCCTGGTGCCACCTGAGG + Intergenic
1023864418 7:44232104-44232126 GGACCCCCTGGTCCCTGCCATGG + Intronic
1026911800 7:74095348-74095370 TGCCCCCCTGGGTCCTGCTGTGG - Intronic
1029283040 7:99449028-99449050 AGTCCCCAGGGTCCCCGCTCAGG + Intronic
1029552321 7:101244053-101244075 AGTACGCCTGGTGCCTGGTGCGG - Exonic
1031361739 7:120856914-120856936 GGACCCTCTGGACCCTGCTGAGG - Intronic
1032017453 7:128389069-128389091 AGCCCTCCTGCTTCCTGCTGAGG - Intergenic
1037910743 8:22742281-22742303 TGCGCCCCTGGTCCTTGCTGTGG + Intronic
1039556918 8:38483201-38483223 GGTCCCCCTGGTCCTGGCTAAGG + Intergenic
1039890472 8:41682335-41682357 AGTCCCCCTGGCCCCGACTCCGG + Intronic
1040323386 8:46329457-46329479 AGAGCCCCAGGTTCCTGCTGAGG - Intergenic
1040674584 8:49733536-49733558 ACTCTCCCTGTGCCCTGCTGTGG + Intergenic
1041954518 8:63542823-63542845 AGACCCCACAGTCCCTGCTGAGG - Intergenic
1042155736 8:65842149-65842171 AGTCTCCCTGGGCGCTGCGGCGG - Intronic
1043501957 8:80867100-80867122 AGTGCCCATAGTCCCTGGTGTGG - Intronic
1046015486 8:108599596-108599618 GGCCTCCCTGGGCCCTGCTGAGG - Intergenic
1047502445 8:125452580-125452602 AGTCTCCTTGGTCCCTGGTTTGG - Intergenic
1049055935 8:140237652-140237674 TGTCCCCCTCCTCCCTCCTGTGG - Intronic
1049446041 8:142632135-142632157 AGTGCCCCTGGGCCCCCCTGGGG - Intergenic
1049449913 8:142655045-142655067 AGCCCCCATGGTTCCAGCTGTGG - Intergenic
1049584251 8:143425659-143425681 TGTCACCTGGGTCCCTGCTGTGG + Intronic
1054737518 9:68770389-68770411 AGTCCTCCTGCACCTTGCTGGGG + Intronic
1057904158 9:98971555-98971577 AGTCCACATGGTCCCTGGGGTGG + Intronic
1058945073 9:109848319-109848341 AGTCCTCCTGCTCTCAGCTGTGG + Intronic
1059754391 9:117278845-117278867 AGGCCCCTTGCTCCATGCTGAGG - Intronic
1061363701 9:130159296-130159318 GGTGCCCCGGGTGCCTGCTGTGG - Intergenic
1061417125 9:130453168-130453190 GGTCCCCATGGGCCCTACTGGGG - Intronic
1061536745 9:131255053-131255075 AAGCCCCTTGGTCCCTTCTGTGG + Intergenic
1061800979 9:133113298-133113320 AGTCTACCTGGCTCCTGCTGGGG - Intronic
1062267896 9:135695757-135695779 ACTCCCCTCGGCCCCTGCTGTGG - Intronic
1062274817 9:135725752-135725774 TGTCCGCCTGGACCCGGCTGAGG - Intronic
1062286403 9:135774912-135774934 AGTCCCCCAAGGCCCTGATGGGG + Intronic
1185735379 X:2491864-2491886 AGTCCCCAGGGTTCCTGTTGAGG + Intronic
1185737049 X:2502084-2502106 AGTCCTTGTGGTCCCTGCTGAGG - Intronic
1185755851 X:2652349-2652371 TTCCCCCCTGGTGCCTGCTGTGG + Intergenic
1187819487 X:23271394-23271416 ACTCCCACTGTTCCATGCTGAGG + Intergenic