ID: 900337810

View in Genome Browser
Species Human (GRCh38)
Location 1:2173372-2173394
Sequence TGCGTCCCCGGAAGTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900337810_900337812 -3 Left 900337810 1:2173372-2173394 CCAGGGGGACTTCCGGGGACGCA 0: 1
1: 0
2: 2
3: 22
4: 67
Right 900337812 1:2173392-2173414 GCAGAGACAGCTGCTGTCCTTGG 0: 1
1: 0
2: 4
3: 38
4: 310
900337810_900337817 13 Left 900337810 1:2173372-2173394 CCAGGGGGACTTCCGGGGACGCA 0: 1
1: 0
2: 2
3: 22
4: 67
Right 900337817 1:2173408-2173430 TCCTTGGGCAAAACGGGTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 62
900337810_900337815 7 Left 900337810 1:2173372-2173394 CCAGGGGGACTTCCGGGGACGCA 0: 1
1: 0
2: 2
3: 22
4: 67
Right 900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG 0: 1
1: 0
2: 3
3: 19
4: 164
900337810_900337816 12 Left 900337810 1:2173372-2173394 CCAGGGGGACTTCCGGGGACGCA 0: 1
1: 0
2: 2
3: 22
4: 67
Right 900337816 1:2173407-2173429 GTCCTTGGGCAAAACGGGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
900337810_900337814 6 Left 900337810 1:2173372-2173394 CCAGGGGGACTTCCGGGGACGCA 0: 1
1: 0
2: 2
3: 22
4: 67
Right 900337814 1:2173401-2173423 GCTGCTGTCCTTGGGCAAAACGG 0: 1
1: 0
2: 2
3: 14
4: 199
900337810_900337813 -2 Left 900337810 1:2173372-2173394 CCAGGGGGACTTCCGGGGACGCA 0: 1
1: 0
2: 2
3: 22
4: 67
Right 900337813 1:2173393-2173415 CAGAGACAGCTGCTGTCCTTGGG 0: 1
1: 0
2: 3
3: 32
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900337810 Original CRISPR TGCGTCCCCGGAAGTCCCCC TGG (reversed) Intronic
900161841 1:1227597-1227619 GGCGTGCCCGTGAGTCCCCCAGG - Intronic
900337810 1:2173372-2173394 TGCGTCCCCGGAAGTCCCCCTGG - Intronic
903070971 1:20726874-20726896 TGCTTCCCCTGGGGTCCCCCTGG - Intronic
907405623 1:54251835-54251857 TGTGTCCCAGGAACTCCTCCCGG + Exonic
912164670 1:107029308-107029330 TGCTTCCCCAAAAGTCCCCAAGG + Intergenic
913113869 1:115679392-115679414 GGCGTCCCAGGAAGTGCCCAGGG - Intronic
913485823 1:119332116-119332138 TGAATCCCCTGAATTCCCCCTGG + Intergenic
921708124 1:218346875-218346897 TGAGCCCGAGGAAGTCCCCCCGG + Exonic
922620255 1:226984366-226984388 TGTGTCCCCCTAAGTCCCACTGG - Intronic
1075675840 10:124295235-124295257 TGGGCCCCAGGAAGTGCCCCTGG - Intergenic
1076001983 10:126919728-126919750 TGCTTCCCCTCCAGTCCCCCTGG + Intronic
1076406276 10:130214305-130214327 TGGGTCCCAGAAAGTCCCTCAGG - Intergenic
1076735770 10:132458268-132458290 TGGGTCCCGGGAACACCCCCTGG - Intergenic
1081521013 11:43881001-43881023 TGAGGCCCCGGAGGTCGCCCAGG - Exonic
1083308491 11:61772751-61772773 TGCAGCCCCGGAAGTGGCCCAGG + Intronic
1083820216 11:65166203-65166225 TCAGGACCCGGAAGTCCCCCTGG + Intergenic
1089841666 11:121424197-121424219 TTCATCCCCAGAATTCCCCCTGG + Intergenic
1090593099 11:128293176-128293198 TGGGGCCCCAGAAGTCCTCCAGG - Intergenic
1101754120 12:107607678-107607700 TGCGTCCCAGCAGCTCCCCCTGG + Intronic
1104735948 12:131136171-131136193 TGCCTCCCCGCCAGTCCCCGCGG - Intronic
1104760502 12:131295229-131295251 TGCGTCCCCAGAAATCCCCCTGG + Intergenic
1104819273 12:131665556-131665578 TGCGTCCCCAGAAATCCCCCTGG - Intergenic
1111676972 13:91399335-91399357 AGCATCCCCGGAAGCCTCCCCGG - Intronic
1114484888 14:23056667-23056689 TGCCTGCCCGGAACTGCCCCCGG - Intronic
1122999752 14:105286989-105287011 TGCGTCCCCTGCAGTCCAGCAGG - Intronic
1132787116 16:1663233-1663255 TGAGTCCCTGGCTGTCCCCCAGG - Intronic
1136288546 16:29258257-29258279 TGCTACCCTGGAAGTCCCCCAGG - Intergenic
1141173790 16:81706472-81706494 TGCTTCCACTGGAGTCCCCCGGG + Intronic
1142094260 16:88231163-88231185 TGCTATCCTGGAAGTCCCCCAGG - Intergenic
1151476259 17:74345786-74345808 TGCCTTCCAGGAAGCCCCCCAGG - Intronic
1154529415 18:15329887-15329909 TTCTTCCCGGGAAGGCCCCCAGG - Intergenic
1160738804 19:676591-676613 CGCGCCCCCCGACGTCCCCCCGG - Intronic
1160828944 19:1093868-1093890 GGCTTCACCGGAACTCCCCCGGG + Intronic
1162344987 19:10113691-10113713 TGGGCCACAGGAAGTCCCCCTGG - Exonic
1163762852 19:19146554-19146576 TTCCTCCCCGGAGGCCCCCCAGG - Exonic
1167578477 19:50328914-50328936 CGCGTCCCCGGCGGGCCCCCCGG - Exonic
932563438 2:72891377-72891399 TGGGTCCACGGAGGTCTCCCGGG - Exonic
932793341 2:74674494-74674516 TCCGGCCCCCGAGGTCCCCCTGG - Exonic
938273216 2:129993389-129993411 TGTGTCCCAGGAACTCCTCCCGG - Intergenic
938443003 2:131352707-131352729 TGTGTCCCAGGAACTCCTCCCGG + Intronic
943068700 2:183116093-183116115 TGGGTCCCCAGAAGTTGCCCAGG + Intergenic
943990022 2:194676784-194676806 TCTGGCCCCTGAAGTCCCCCAGG - Intergenic
1169214786 20:3786642-3786664 GGCGTCCCCGGAGGTGCCCCCGG - Exonic
1173671529 20:44802474-44802496 TCCGTCCATGGAAGTTCCCCAGG + Intronic
1175222766 20:57426815-57426837 TGGGTCCTCGGAAGTCACCGTGG + Intergenic
1184354560 22:43970322-43970344 TTCGTTCCCTGAAGTCACCCTGG + Intronic
955327408 3:58019989-58020011 GGTGTCCCTGGAACTCCCCCTGG + Intronic
955348865 3:58179829-58179851 TGGGACCCCCCAAGTCCCCCAGG + Intergenic
961715909 3:128857356-128857378 AGCTTCCCCTGATGTCCCCCTGG + Intergenic
962282115 3:134059943-134059965 GGAGTCCCTGGAAGACCCCCAGG - Intergenic
963174172 3:142281121-142281143 TGGGTCACCTGAAGTCACCCAGG - Intergenic
963768426 3:149363295-149363317 TGAGTGACTGGAAGTCCCCCAGG + Intergenic
969568026 4:7991752-7991774 AGCCTCCCCGGATCTCCCCCAGG - Intronic
972710598 4:41590709-41590731 AACGTCCCCAGAATTCCCCCAGG + Intronic
980908389 4:138971593-138971615 TGCTTCCTCCGAAGTCTCCCGGG - Intergenic
985835386 5:2268145-2268167 GACGCTCCCGGAAGTCCCCCTGG - Intergenic
996555342 5:124772703-124772725 TACTTCCTGGGAAGTCCCCCTGG - Intergenic
997265339 5:132491645-132491667 TGCCTCCCTGGGACTCCCCCTGG + Intergenic
1001686731 5:173598987-173599009 TGCCTCCCCACAAGTCCCCGAGG - Intergenic
1003604064 6:7542984-7543006 GGCGCCCCGGGAAGACCCCCCGG + Intronic
1019485973 7:1289339-1289361 TGCGTCCAAGGAGGTCCTCCTGG + Intergenic
1019556839 7:1636114-1636136 TGGGGCCCAGGAAGTCACCCTGG + Intergenic
1024543303 7:50496856-50496878 TGCCTCCCAGGACGCCCCCCAGG - Intronic
1036390250 8:8318759-8318781 CGCCTCCCCGGAAGGGCCCCGGG - Exonic
1042530043 8:69805320-69805342 TGAATCCCCTGAAATCCCCCAGG + Intronic
1042846526 8:73174454-73174476 TGCTTTCCCAGACGTCCCCCTGG + Intergenic
1045499163 8:102731886-102731908 TGCTTCCCAGGAACTCACCCTGG - Intergenic
1048286025 8:133142435-133142457 AGGGTCCCAGGAAGTACCCCTGG - Intergenic
1048306733 8:133289754-133289776 TGTGTCCCCCTCAGTCCCCCAGG - Intronic
1062521267 9:136958984-136959006 CTCCTCCCCGCAAGTCCCCCAGG + Intergenic
1189257399 X:39651115-39651137 TGCCTCCCTGGGAGGCCCCCTGG - Intergenic
1190798287 X:53764263-53764285 TGAGTCCCGGGAAATCACCCGGG + Intergenic
1196442186 X:115727840-115727862 GGGGTCCCCGGAAGGCCCCCAGG + Intergenic
1196442846 X:115730794-115730816 GGGGTCCCCGGAAGGCCCCCAGG + Intergenic
1196443376 X:115733074-115733096 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196444146 X:115736863-115736885 GGGGTCCCCGGAAGGCCCCCAGG + Intergenic
1196444611 X:115738888-115738910 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196445700 X:115844994-115845016 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196446371 X:115847975-115847997 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196447042 X:115850956-115850978 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196447711 X:115853939-115853961 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196448381 X:115856918-115856940 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196449050 X:115859909-115859931 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196449721 X:115862900-115862922 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196450390 X:115865883-115865905 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196451060 X:115868868-115868890 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196451731 X:115871847-115871869 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196452402 X:115874834-115874856 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196453072 X:115877803-115877825 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196453742 X:115880796-115880818 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196454411 X:115883805-115883827 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic
1196455486 X:115888867-115888889 GGGGTCCCCGGAAGGCCCCCAGG - Intergenic