ID: 900337811

View in Genome Browser
Species Human (GRCh38)
Location 1:2173384-2173406
Sequence AGCAGCTGTCTCTGCGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900337811_900337817 1 Left 900337811 1:2173384-2173406 CCGGGGACGCAGAGACAGCTGCT 0: 1
1: 0
2: 0
3: 25
4: 271
Right 900337817 1:2173408-2173430 TCCTTGGGCAAAACGGGTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 62
900337811_900337816 0 Left 900337811 1:2173384-2173406 CCGGGGACGCAGAGACAGCTGCT 0: 1
1: 0
2: 0
3: 25
4: 271
Right 900337816 1:2173407-2173429 GTCCTTGGGCAAAACGGGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
900337811_900337815 -5 Left 900337811 1:2173384-2173406 CCGGGGACGCAGAGACAGCTGCT 0: 1
1: 0
2: 0
3: 25
4: 271
Right 900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG 0: 1
1: 0
2: 3
3: 19
4: 164
900337811_900337814 -6 Left 900337811 1:2173384-2173406 CCGGGGACGCAGAGACAGCTGCT 0: 1
1: 0
2: 0
3: 25
4: 271
Right 900337814 1:2173401-2173423 GCTGCTGTCCTTGGGCAAAACGG 0: 1
1: 0
2: 2
3: 14
4: 199
900337811_900337819 23 Left 900337811 1:2173384-2173406 CCGGGGACGCAGAGACAGCTGCT 0: 1
1: 0
2: 0
3: 25
4: 271
Right 900337819 1:2173430-2173452 GTCTCCCACCCCTCATTCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900337811 Original CRISPR AGCAGCTGTCTCTGCGTCCC CGG (reversed) Intronic
900151848 1:1182312-1182334 AGCTGCTGTCCCTTCGCCCCTGG - Intronic
900179311 1:1304338-1304360 AGCGGCTGCCTCTGCCTGCCTGG - Intronic
900186814 1:1336672-1336694 CGCAGCTGCCCCTGCGACCCTGG - Intronic
900284926 1:1894481-1894503 GGCAGAGGTCTCTGCCTCCCAGG - Intergenic
900337811 1:2173384-2173406 AGCAGCTGTCTCTGCGTCCCCGG - Intronic
900399044 1:2465452-2465474 CACAGCTGGCTCTGCGTCCCTGG + Intronic
900482315 1:2905221-2905243 TGCACCTGTCCCCGCGTCCCTGG + Intergenic
900787665 1:4658845-4658867 GACAGCTGTCTCTGGGTCCCTGG + Intronic
902385070 1:16071813-16071835 AGCAGGCGTCTCTTCCTCCCCGG + Intronic
903212762 1:21828056-21828078 ACCCGCTGCCTCTGCCTCCCTGG - Exonic
903335629 1:22622330-22622352 AGCAGCTGTCTCTAGACCCCAGG + Intergenic
903545037 1:24118695-24118717 ACCACCTGTCACTGTGTCCCAGG + Intergenic
903862912 1:26375901-26375923 AGAATCTGACTCTGCCTCCCAGG + Intergenic
904519102 1:31080508-31080530 AGCATCTGGCTCTGTGGCCCAGG + Intergenic
905387306 1:37613678-37613700 AGCTGCAGCCTCTGCCTCCCTGG - Intronic
905899816 1:41574085-41574107 AGCAGCAGTCTGTGTGTGCCCGG - Intronic
906413730 1:45602327-45602349 AGCAGCTGTCAATGCATTCCAGG + Exonic
907400011 1:54219357-54219379 AGCCTGTGTCTCTGCCTCCCAGG + Intronic
907783006 1:57584433-57584455 AGCAGATCTCTCTGGGTCCTTGG + Intronic
909349173 1:74629552-74629574 AGCAGCAGCCTCTTCATCCCAGG - Intronic
910189592 1:84581881-84581903 ATCAGCTGTCTCCTCATCCCAGG + Intergenic
912373377 1:109190853-109190875 AGCAGCTGTCTCTCCAGCACTGG - Intronic
912469550 1:109897024-109897046 CACATCTGTCTCTGAGTCCCAGG - Intergenic
914096473 1:144548410-144548432 AGCGTCTGTCTCTGTGTCCCAGG + Intergenic
914302036 1:146385530-146385552 AGCATCTGTCTCTGTGGCCTAGG - Intergenic
915651291 1:157312912-157312934 AGTAGCTCTTTCTGAGTCCCTGG + Intergenic
918057372 1:181033661-181033683 AGCTGCTGCCTCTGCTTCCCTGG - Intronic
918197196 1:182233560-182233582 AGGAGCTGGCTCTGTTTCCCTGG - Intergenic
921118859 1:212119354-212119376 TGCAGGTGTCTCTGTGCCCCTGG - Intergenic
921189415 1:212696570-212696592 ACCTGTTGTCTCTGTGTCCCTGG - Intronic
922109833 1:222546288-222546310 AGCATCTGGCTCTGTGCCCCAGG + Intronic
922240364 1:223751581-223751603 AGCAGGTGTCTCTCTGTCCACGG - Intronic
923227668 1:231954231-231954253 CACAGCTATCTCTGTGTCCCTGG + Intronic
1063409715 10:5828021-5828043 AGCAGCTGTCTCTGCTGGACAGG + Intronic
1063495215 10:6501448-6501470 AGCAGCTGTCTCTGAGGCAGAGG + Intronic
1065647834 10:27854728-27854750 AGAATCTGTCTCTGTGGCCCAGG - Intronic
1066987142 10:42477485-42477507 AGCAGGAGTCTCGGCCTCCCGGG + Intergenic
1069714803 10:70513900-70513922 AGCAGCGGTCCCTGGGTCACCGG - Intronic
1069988753 10:72301009-72301031 AGCAGCTCTACCTGCGGCCCTGG + Intergenic
1071525857 10:86357860-86357882 AGCAGCTCTCTGTGGGACCCCGG + Intronic
1072552778 10:96492107-96492129 AGCAGCACTCACTGTGTCCCTGG + Intronic
1073291085 10:102413710-102413732 AGCAGCTGTTTCTGGAGCCCTGG + Intronic
1075391114 10:122092859-122092881 TGAGGCTGTCTCTGAGTCCCAGG - Intronic
1075527817 10:123200965-123200987 CCCAGCAGTCTCTCCGTCCCTGG + Intergenic
1075673621 10:124281187-124281209 AGCTGCTGGGTCTGCATCCCAGG - Intergenic
1076461006 10:130647426-130647448 AGCAGCTGTCTCGGCTCCACAGG + Intergenic
1076478761 10:130770163-130770185 AGCAGGTGGCCCTGCGACCCTGG + Intergenic
1076568242 10:131413294-131413316 AGCAGCACTCTCTGTGTCCACGG + Intergenic
1077052054 11:571394-571416 GGCAGGTGTCTGTGTGTCCCAGG - Intergenic
1077159202 11:1105024-1105046 ACCCGCCATCTCTGCGTCCCTGG - Intergenic
1077563397 11:3280568-3280590 AGCAGCTGCCTCTGTGTTCTGGG - Intergenic
1077569289 11:3326383-3326405 AGCAGCTGCCTCTGTGTTCTGGG - Intergenic
1080973110 11:37302787-37302809 AGCAACTGGCTCTGCTGCCCAGG + Intergenic
1081374636 11:42344291-42344313 GGCAGCTCTGTCTGCGGCCCTGG - Intergenic
1082672930 11:56057792-56057814 AGCACATGTCTCTGCGACACAGG - Intergenic
1083393075 11:62369295-62369317 AGCACATGTCTCTGCGACACAGG + Intronic
1084494720 11:69497282-69497304 AGCAGCTGCCTGAGAGTCCCAGG + Intergenic
1089092974 11:115893634-115893656 CTTAGCTGTCTCTGAGTCCCTGG + Intergenic
1089620935 11:119721780-119721802 AGCATCTGTCTCTGGGTATCTGG - Intronic
1090227007 11:125077669-125077691 AGGAGCAGTCTCTGCGACCGCGG - Intronic
1090454310 11:126834766-126834788 TGCAGCTGGCCCTGCGGCCCTGG + Intronic
1090570155 11:128036936-128036958 TGAAGCTGTCTCTGAGTCCAGGG - Intergenic
1091197798 11:133746848-133746870 AGCTGCTGTCTCTGCAACTCTGG - Intergenic
1095526634 12:43133852-43133874 AGCAGCTCCATCTGCATCCCTGG - Intergenic
1096807513 12:54149453-54149475 AGCACCTTTCTCTGCATCCAGGG + Intergenic
1101959680 12:109239508-109239530 AGAAGCTGTCTCTGGTTCTCAGG + Intronic
1102931851 12:116868417-116868439 AGCAGCTATCTCTGGGCCCCAGG + Intronic
1103216148 12:119202798-119202820 AGGAGCTGTCTCTGCTTCTCTGG - Intronic
1103917973 12:124385659-124385681 AGGAGATGTCTCTGCACCCCAGG - Intronic
1104079292 12:125416176-125416198 ATCACCTCTCTCTGGGTCCCAGG - Intronic
1104912867 12:132248027-132248049 CGCCGCTGTCTCTGCCTCCCAGG - Intronic
1105026476 12:132852643-132852665 AGCAGCTCTGTCTGGGTCACTGG - Intronic
1105600898 13:21886018-21886040 ACCAGCTCTCCCTGCTTCCCAGG - Intergenic
1106310075 13:28546306-28546328 AGCAGCTTCCTCTTGGTCCCTGG - Intergenic
1109412141 13:61984219-61984241 AGCTGATTTCTCTGCCTCCCAGG - Intergenic
1111122623 13:83873607-83873629 AGAAGCAGTCTTTGCTTCCCAGG - Intergenic
1112393703 13:99009036-99009058 AGCAGTTGTCTCTGTGTTCCTGG + Intronic
1113092238 13:106628070-106628092 TGCTGCTGCCTCTGCTTCCCTGG - Intergenic
1113415155 13:110123341-110123363 AGCAGCGCTCTTTGTGTCCCTGG - Intergenic
1113548186 13:111170764-111170786 AGCAGCAGGCTCTGCTTCCAGGG - Intronic
1114318375 14:21526476-21526498 AGCACCTGTCACTGCGCCTCCGG - Intronic
1117538315 14:56722385-56722407 ACCAGCTTCCTCTGCTTCCCCGG - Intronic
1119240656 14:73056782-73056804 AGGAGGTGTCTCTGTTTCCCAGG - Intergenic
1121512333 14:94521695-94521717 AGCAGCTCTATCTGCCACCCTGG + Intergenic
1123024605 14:105418907-105418929 AGGAGCTGTCTCGGGGTTCCAGG - Intronic
1123048509 14:105529822-105529844 ACCCGGTGTCTCTGCGCCCCAGG - Exonic
1124216050 15:27807858-27807880 AGCAGGTGCCTCTGGGTCCAGGG - Intronic
1127255057 15:57283333-57283355 AACTGCAGTCTCTGCTTCCCAGG + Intronic
1127735763 15:61837924-61837946 AGCAACAGTCTCTGCTTCTCTGG - Intergenic
1128497001 15:68204423-68204445 AGCAGCTGGCTGTGCCTCCTGGG + Intronic
1131432894 15:92400831-92400853 AACAGCTGGCCCTGCGTTCCTGG - Intronic
1131990433 15:98088438-98088460 AGGAGCTGTCGCTGCGCTCCGGG + Intergenic
1132099711 15:99014859-99014881 AGGAGCTGTCGCTGCGCTCCGGG - Intergenic
1132225010 15:100133613-100133635 AGCAGCAGCCCCTGCCTCCCAGG + Intronic
1134028432 16:10972460-10972482 AGCAGCTCTCTCACCTTCCCAGG + Intronic
1134604226 16:15557626-15557648 ACCAGCTGTCTCTGTTTGCCTGG + Intronic
1138647148 16:58433991-58434013 ATCAGGTGTCTCTGCAGCCCAGG + Intergenic
1138895476 16:61198981-61199003 AACAGCTGGCACTGTGTCCCTGG + Intergenic
1139513601 16:67440873-67440895 GGCAGCTGTCTCTGCCACCCAGG - Intronic
1139659678 16:68412074-68412096 AGCAACTGCCTCTGCCTCCCTGG - Intronic
1140645023 16:77020543-77020565 AGCACCTGTCTCTGCGCACATGG + Intergenic
1140718480 16:77748706-77748728 ACAAGCTTTCTCTGCTTCCCAGG - Intergenic
1140738363 16:77919197-77919219 AGCAGCTTTCTCTGCAACCTAGG + Intronic
1141027689 16:80563551-80563573 AGCATCTGTCTCTGTTGCCCAGG + Intergenic
1142810756 17:2394581-2394603 ACCGGCTGCCTCTGAGTCCCAGG - Intronic
1143259071 17:5584780-5584802 AGCAGTTGTGTCTGCAGCCCAGG + Intronic
1144025241 17:11271511-11271533 AACTGCTATCTCTGCCTCCCAGG + Intronic
1144199231 17:12924538-12924560 ACCAGCTGCCTCTGGGTCCTAGG + Intronic
1144867167 17:18343892-18343914 AGTATCTGGCTCTGCCTCCCAGG - Intronic
1145778924 17:27549293-27549315 AGGAGCTCTCCCTGGGTCCCTGG + Intronic
1145783143 17:27577294-27577316 AGCTGCTGTCTCTGGGAGCCTGG + Intronic
1145786670 17:27598164-27598186 AGCTGCTGCCTCGGCCTCCCTGG + Intronic
1145927969 17:28662063-28662085 GGCAGCTGTCACTGAGCCCCTGG - Exonic
1147119585 17:38328139-38328161 AGCAGCTTCCTGTGCTTCCCAGG + Exonic
1149991480 17:61385956-61385978 AGCAGGTGTCTCTGCCATCCAGG - Intronic
1151579921 17:74972113-74972135 ACCAGCTGTTTCTCCGACCCGGG + Intronic
1152235399 17:79135791-79135813 AGCATCTATCTCTGAGTCCTTGG - Intronic
1152649345 17:81484676-81484698 AGCAGCTCCCTCTGGTTCCCAGG - Intergenic
1152749078 17:82054331-82054353 AGCAGTTCTCTCTGTGGCCCTGG + Intronic
1153680913 18:7500356-7500378 CACAGCAGTCTCTGCCTCCCTGG + Intergenic
1156257071 18:35408946-35408968 AGCAGCAGCCTCTGGCTCCCGGG + Intergenic
1160696196 19:485764-485786 ACCTGCTGTTTCTGTGTCCCTGG + Intergenic
1161416215 19:4148446-4148468 AGAAGCTTTCTCTGTGGCCCAGG + Intergenic
1162804640 19:13130972-13130994 ACCAGCTTTCTTTGGGTCCCTGG + Intronic
1162827998 19:13265918-13265940 CACAGCAGTCTCTGCCTCCCGGG + Intronic
1163018379 19:14470403-14470425 GGCTGCTGGCTCTGCTTCCCTGG + Intronic
1167699371 19:51033538-51033560 CACTGCTGTCTCTGCCTCCCAGG - Intronic
926705680 2:15835826-15835848 AGAAGCTCACTCTGCCTCCCTGG + Intergenic
928118884 2:28567289-28567311 CGCAGCTGTGCCTGCGCCCCAGG - Intronic
928412275 2:31064268-31064290 CGCAGCTGTCACTGGCTCCCAGG + Intronic
928914081 2:36453224-36453246 ACCAGCTGTCTCTACCTCCTGGG - Intronic
930784237 2:55255950-55255972 AGCTGCAGCCTCTGCCTCCCAGG + Intronic
930895823 2:56444780-56444802 TGCAGCTGTCACTGCTGCCCAGG - Intergenic
931228121 2:60351524-60351546 GGCAGCTGCCTCTGGGGCCCGGG - Intergenic
931359832 2:61568926-61568948 AGGATCTGACTCTGTGTCCCAGG - Intergenic
931632075 2:64310735-64310757 AGCAGCTGCCTCTGCTTCCTTGG - Intergenic
932691137 2:73914756-73914778 AGCAGCTTCCTCTTCCTCCCTGG + Exonic
934616154 2:95772518-95772540 AGCAGCTGCCTCTGTCTCCAAGG + Intergenic
935594274 2:104867460-104867482 GTCAGCGGGCTCTGCGTCCCGGG - Intergenic
936450762 2:112632378-112632400 AGCTGCAGCCTCTGCCTCCCGGG + Intergenic
937863284 2:126730006-126730028 AGGAGCTGGCTCTCCGTTCCAGG - Intergenic
937865281 2:126746480-126746502 AGCGGCTGGCTCTGCCTGCCTGG + Intergenic
938765074 2:134455540-134455562 AGCAGCTGTCCCTCGGTGCCAGG + Intergenic
940903387 2:159147140-159147162 AGCTGCTCTCTCTGCCTCCACGG + Intronic
941217732 2:162735006-162735028 AGAACCTGTCTCTTCCTCCCTGG + Intronic
941644298 2:168023867-168023889 AGCAGCTGCTCCTGGGTCCCTGG - Intronic
944483199 2:200178221-200178243 AGCAGCTGCCACCGCTTCCCAGG - Intergenic
945868001 2:215197918-215197940 AGCAGATGCCTCTGCCTCCGTGG + Intergenic
948270558 2:236670298-236670320 AGCAGCTGCCTCCGCCTCTCTGG - Intergenic
948754475 2:240150961-240150983 TGCACCTGACTCTGAGTCCCCGG + Intergenic
948754499 2:240151055-240151077 TGCACCTGACTCTGAGTCCCCGG + Intergenic
948907616 2:240987203-240987225 CACAGCTGGCTCTGCGTCCCCGG - Intronic
949019963 2:241735314-241735336 AGCAGCAGCCTCTGCGGGCCAGG - Exonic
1169232228 20:3898273-3898295 AACTGCAGTCTCTGCCTCCCGGG + Intronic
1170658370 20:18312815-18312837 AGCACCTGCCTCAGCGTCCTGGG + Intronic
1171085431 20:22234248-22234270 AGCATCCGTCTCTGCGTGCAGGG + Intergenic
1171258050 20:23706478-23706500 AGCATCTAGCTCTGCTTCCCTGG - Intergenic
1171275266 20:23851509-23851531 AGCATCTAGCTCTGCTTCCCTGG - Intergenic
1172294167 20:33796699-33796721 AGCAGGTGTCCCTGTGGCCCAGG + Intergenic
1173466344 20:43285019-43285041 AGCAGGTGTCTTTTCTTCCCTGG - Intergenic
1174075367 20:47931746-47931768 AGCTGGTGTCTCTGTGTTCCAGG + Intergenic
1174299403 20:49570573-49570595 AGCAGCTGCCTCTCCTTCCCTGG - Intergenic
1174557199 20:51404237-51404259 CCCAGCTGTCTGTGTGTCCCTGG - Intronic
1174872710 20:54198547-54198569 AGCAGCTTTCTACGCCTCCCTGG - Intergenic
1175108933 20:56632035-56632057 AGGAGCTGTCTCTTCATCTCCGG + Intronic
1175261191 20:57675223-57675245 AGCACCGGGCTCTGTGTCCCAGG - Intronic
1175331470 20:58167714-58167736 AGCAGCTCTCTCTGGGTGCCGGG - Intergenic
1175932600 20:62499727-62499749 AGCAGCTGCCTCTGAGAACCTGG + Intergenic
1176071605 20:63229540-63229562 AGCGGCTGCCGCTGCCTCCCTGG + Intergenic
1177425615 21:20918740-20918762 AGCTGCAATCTCTGCCTCCCAGG - Intergenic
1178516187 21:33249501-33249523 AGCATCTGTCGCTGCCTCTCTGG + Intronic
1178992781 21:37368139-37368161 AGCCGCTGCCTCGGCGGCCCTGG + Intronic
1179316246 21:40246803-40246825 ACCAGCTGTCTCAGTTTCCCTGG - Intronic
1179442329 21:41403988-41404010 AGGGGCTGTGTCTGAGTCCCGGG + Intronic
1180226649 21:46397382-46397404 AACAGCTGTCTCAGCATCGCGGG + Exonic
1180715873 22:17871972-17871994 AGCATGTGTCGCTGCCTCCCAGG + Exonic
1180948502 22:19709731-19709753 AGCAGCTGTCTCTGCCTGGAGGG - Intergenic
1183098272 22:35567690-35567712 AAAAGCTGTCTCTGTGTGCCAGG + Intergenic
1183188292 22:36305002-36305024 AGCTGCTGTCCCTGCCTCTCTGG - Intronic
1183922043 22:41177384-41177406 AGCTGCTGGCCCTGTGTCCCAGG + Exonic
1185142775 22:49112662-49112684 AGCAGCCTTCTCAGTGTCCCCGG - Intergenic
1185349555 22:50327317-50327339 TGCAGCTTGCTCTGCCTCCCTGG - Intergenic
949841481 3:8324964-8324986 AGCTGCAGTGTCTGAGTCCCAGG - Intergenic
952301779 3:32109759-32109781 TCCAGCTGTGTCTGCATCCCTGG - Intronic
953547235 3:43872540-43872562 AGCAGCTTTCTCTGCAGTCCTGG + Intergenic
953679543 3:45029112-45029134 AGTAGGTGTCTCTACGGCCCTGG - Intronic
954712179 3:52510575-52510597 AGCACCTGACTCTGCATTCCAGG - Intronic
957187082 3:76955850-76955872 AACACCTGTCTCCGCCTCCCGGG - Intronic
958927791 3:100178041-100178063 AACTGCTATCTCTGCTTCCCAGG - Intronic
960092833 3:113659116-113659138 ACCATCTGTCTCTGTGTCTCAGG - Exonic
960715044 3:120566768-120566790 AGCAGAAGTCTCTGTGTCCAAGG - Intergenic
962091073 3:132244961-132244983 AGCAGGTGTCACTGCCTCTCTGG + Intronic
965619500 3:170628558-170628580 AACTGCAGTCTCTGCCTCCCAGG - Intronic
966345800 3:178978436-178978458 AGAAGCTATGTCTGCGTCTCAGG + Intergenic
966613179 3:181888546-181888568 AGGAGCTCTCTCTGTCTCCCAGG - Intergenic
966685456 3:182689133-182689155 TGCTGCAGTCTCTGCCTCCCAGG - Intergenic
968184560 3:196623315-196623337 ACCAGCTGTCTGGGCTTCCCAGG + Intergenic
968869476 4:3234384-3234406 GGCAACTGTCTCTGCATCCCTGG + Intronic
968966793 4:3772854-3772876 TGCAGTTGACTCTGCTTCCCAGG - Intergenic
969248824 4:5954092-5954114 AAGAGCTGGCTCTGCCTCCCTGG + Intronic
970913296 4:21304389-21304411 AGGAGATGGCTCTGCGCCCCGGG + Intronic
971802786 4:31314521-31314543 AGCAGATGTCTCTAAGACCCTGG - Intergenic
972541987 4:40047287-40047309 AGCAGCTTCCTCTGCTACCCTGG + Intergenic
973826365 4:54710913-54710935 AGCATCTGTCTCTGTCACCCAGG + Intronic
975991580 4:80264505-80264527 AGCAGGTGTCTTTGCCTTCCTGG + Intergenic
983463532 4:168057017-168057039 CGCTGCAGTCTCTGCTTCCCGGG - Intergenic
983577904 4:169278130-169278152 CACAGCAGTCTCTGCCTCCCAGG + Intergenic
984626071 4:182009340-182009362 GGCAGCAGTCTCTGCATACCAGG - Intergenic
985616281 5:923604-923626 AGCCGCTGGCTGTGCGTCTCTGG - Intergenic
985624795 5:979735-979757 AGCAGCTGTGGCTGGGACCCTGG + Intronic
986276020 5:6275747-6275769 AGCTGCTCTCTCTGGGTCCTGGG - Intergenic
986573052 5:9184951-9184973 AGCATCTTACTCTGCTTCCCAGG + Intronic
988414873 5:30933745-30933767 AGCAGCTGTCTCTTTGTATCTGG - Intergenic
992221149 5:74574906-74574928 AACAACTGTCTCTGGATCCCTGG - Intergenic
997322637 5:132991147-132991169 TGCAGATGACTCTGCTTCCCAGG - Intergenic
998106271 5:139471269-139471291 TGCAAGTGTCTCTGGGTCCCAGG - Intergenic
998382785 5:141737563-141737585 AGCAGCAGTCTCTCCCTGCCAGG - Intergenic
999427672 5:151501461-151501483 AGAGGCTGACTCTGGGTCCCAGG + Intergenic
999427915 5:151503646-151503668 AGAGGCTGACTCTGGGTCCCAGG + Intergenic
1000165685 5:158646396-158646418 AGAAGCTGTCTTGGTGTCCCAGG - Intergenic
1001750965 5:174131161-174131183 ATCAGCTGTCTCAGCCTGCCTGG + Intronic
1002134341 5:177098633-177098655 TGCAGCTGTCCCTGCCTGCCTGG + Intergenic
1002441428 5:179266419-179266441 TGCTGCAGTCTCTGCCTCCCTGG - Intronic
1002556856 5:180048610-180048632 AGCATCTCTCTCTGCCTCCCAGG - Intronic
1002893954 6:1363879-1363901 CGCAGCTTTCTCTCCGTTCCTGG + Intergenic
1003863691 6:10344536-10344558 GGCATCTGTCTGTGTGTCCCTGG - Intergenic
1005593389 6:27352076-27352098 AGCCGCCATCTCTGCATCCCTGG - Intergenic
1006218209 6:32464576-32464598 AGCATCTGTCTCTGGTTCACAGG + Intergenic
1007986801 6:46215432-46215454 AGCATCTGCATCTGCATCCCGGG - Intergenic
1008436029 6:51477722-51477744 AGCAGCTGACTCTGCGAACTCGG + Intergenic
1010921765 6:81691031-81691053 AGCATCTGTCTCTGTCACCCAGG - Intronic
1011003736 6:82620823-82620845 AGGAGGTGTCTCTGAGCCCCAGG + Intergenic
1011309594 6:85967351-85967373 AGTAGCTGTGTCTGCATCCCAGG + Intergenic
1012413607 6:98988201-98988223 GTCAGCTGTCTCTGCTTTCCTGG - Intergenic
1013421214 6:109968672-109968694 AGAGGCTGACTCTGCGTCCAAGG - Intergenic
1013846823 6:114463357-114463379 AACAGTTGTCTCTCCATCCCTGG + Intergenic
1016864921 6:148756444-148756466 AGCAGCTATATCTGGTTCCCTGG - Intronic
1017029884 6:150211694-150211716 AGGTGCTGTCTTTGCTTCCCAGG + Intronic
1017094811 6:150795312-150795334 AGCCTCTGCCTCTGCCTCCCCGG - Intronic
1017945687 6:159094697-159094719 AGCTGCTGTTTGTGCCTCCCCGG + Intergenic
1018698255 6:166407344-166407366 AGATGCTGCCTCTGCCTCCCAGG - Intergenic
1024249939 7:47498400-47498422 AGCATCTGTATCTGTGTCCTGGG - Intronic
1024672903 7:51612779-51612801 AGCAGCTGTCTCTTATTTCCAGG + Intergenic
1025091706 7:56069675-56069697 CGCTGCAGCCTCTGCGTCCCAGG + Intronic
1025986630 7:66458602-66458624 AGCCTCTGCCTCTGCCTCCCAGG - Intergenic
1027183191 7:75953712-75953734 AGCAGCTGGGACTGGGTCCCTGG - Intronic
1027185090 7:75966295-75966317 AGCAGCTGTCTCTGCGGACAGGG - Intronic
1028877715 7:95842232-95842254 ATTAGCTGTCTCTCCGTCCACGG - Intronic
1030288995 7:107853957-107853979 CTCAGCTGCCTCTGCTTCCCAGG - Intergenic
1031544423 7:123034238-123034260 AGCATCTGTCTCTGCCTCCATGG - Intergenic
1031706802 7:124991075-124991097 AGCAGCTCTCTCTGCAGCCGAGG - Intergenic
1033101637 7:138478500-138478522 AGCATCTTACTCTGCGGCCCAGG + Intronic
1034442319 7:151092208-151092230 ACCAGCTGTCAGTGCGTCCCTGG + Intronic
1034985861 7:155515147-155515169 TGCAGCGGTCTCTGCCTCCCCGG - Intronic
1035155202 7:156906588-156906610 AGCATCTCTCTCTGTGGCCCAGG + Intergenic
1035314753 7:157990890-157990912 AGCAGCTCTCTCTGCCTGACTGG - Intronic
1035392006 7:158510342-158510364 AGCAGCTGTCTATGAGCACCTGG - Intronic
1035785608 8:2258023-2258045 TGCAGCTGTCCCTGAGGCCCAGG - Intergenic
1035807199 8:2463693-2463715 TGCAGCTGTCCCTGAGGCCCAGG + Intergenic
1036780408 8:11642948-11642970 AGCAGCTGTGTCTGGGTTGCCGG - Intergenic
1038927444 8:32156291-32156313 AGCAGCCTTCTCAGCCTCCCTGG + Intronic
1040491509 8:47927512-47927534 AGCAGCTGTCTCTGTGGCTGTGG + Intronic
1044957440 8:97495832-97495854 AGCATCTGGCTCTGCCACCCAGG - Intergenic
1045444461 8:102246079-102246101 CACTGCTGTCTCTGCATCCCAGG + Intergenic
1047105201 8:121724314-121724336 CTCAGCTGTGTCTGCGTCACTGG + Intergenic
1047486321 8:125334232-125334254 GGCAGCTGTCTGTGCCTCACTGG + Intronic
1048488483 8:134870112-134870134 AGCAGCTCTCTCTGTGCCCCTGG - Intergenic
1048506529 8:135026881-135026903 AGGAGCTGTCTGTCAGTCCCTGG + Intergenic
1049225461 8:141448621-141448643 ATCAGCTGACTCTGCCTTCCAGG - Intergenic
1049366885 8:142243491-142243513 AGCATTTGTCTCTGTGTGCCTGG - Intronic
1049465410 8:142749197-142749219 AGCAGCTGTTTCTGGGCCCCTGG - Intergenic
1053003829 9:34591643-34591665 GACAGCAGCCTCTGCGTCCCCGG - Intergenic
1053436610 9:38079642-38079664 AGCAGCTGGCTCAGCGACACTGG - Intergenic
1054463072 9:65476366-65476388 TGCAGCTTTCTCTGTGACCCAGG - Intergenic
1054775552 9:69121305-69121327 AGCAGCTGCGTCTCCCTCCCGGG + Intronic
1055253168 9:74333054-74333076 AGCACCTGCCTCTGCTCCCCTGG - Intergenic
1057030675 9:91773038-91773060 TGCAGCTGTTTCTGCCTCGCAGG + Intronic
1057526948 9:95811293-95811315 AGGAGCTGCCTCTGGGTCTCTGG - Intergenic
1059467069 9:114475751-114475773 AGCTGATGTCTCTGGATCCCTGG - Intronic
1060213262 9:121723375-121723397 AGCTGCAGTCCCTGCCTCCCTGG + Intronic
1060555505 9:124505435-124505457 AGCAGCTCTCTCCCCGTCTCGGG + Intronic
1061660326 9:132125839-132125861 AGCAGCTGTTTCTGCATCAGGGG + Intergenic
1061849758 9:133407467-133407489 AGCAGCTGGCTCTGCCTCTGTGG - Intronic
1062339678 9:136088429-136088451 AGCAGCTGCCCCTGAGCCCCTGG + Intronic
1062350380 9:136135792-136135814 AGCAGCTGACCCTGCCTCCCCGG - Intergenic
1062388667 9:136325381-136325403 AGCAGCTCTCGCTGTGTGCCAGG + Intergenic
1186171855 X:6885239-6885261 AGCTGCTGTCTCTATGTCCATGG + Intergenic
1189008316 X:37018157-37018179 AGACCCTGTCTCTGCTTCCCTGG - Intergenic
1189040406 X:37536850-37536872 AGACCCTGTCTCTGCTTCCCTGG + Intronic
1189918665 X:45882062-45882084 AGCAACTGTCTCTCCAACCCTGG + Intergenic
1191739534 X:64422344-64422366 AGCAGCAGGCACTGCCTCCCAGG + Intergenic
1195852386 X:109296852-109296874 CGCAGCTGTGTCTGCATCACAGG + Intergenic
1198285506 X:135186228-135186250 AGCATCTGTCGCTGTGTCCCTGG + Intergenic
1198309880 X:135420665-135420687 CACTGCTGTCTCTGCCTCCCAGG - Intergenic
1200085687 X:153603509-153603531 AGCAGCTGGCTCCCCGTCTCGGG + Intergenic
1201647223 Y:16248200-16248222 AGATGCTGTCTCTGTCTCCCAGG - Intergenic
1201655588 Y:16337102-16337124 AGATGCTGTCTCTGTCTCCCAGG + Intergenic