ID: 900337815

View in Genome Browser
Species Human (GRCh38)
Location 1:2173402-2173424
Sequence CTGCTGTCCTTGGGCAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900337806_900337815 19 Left 900337806 1:2173360-2173382 CCTCAGCAGGGACCAGGGGGACT 0: 1
1: 0
2: 4
3: 20
4: 214
Right 900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG 0: 1
1: 0
2: 3
3: 19
4: 164
900337810_900337815 7 Left 900337810 1:2173372-2173394 CCAGGGGGACTTCCGGGGACGCA 0: 1
1: 0
2: 2
3: 22
4: 67
Right 900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG 0: 1
1: 0
2: 3
3: 19
4: 164
900337811_900337815 -5 Left 900337811 1:2173384-2173406 CCGGGGACGCAGAGACAGCTGCT 0: 1
1: 0
2: 0
3: 25
4: 271
Right 900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG 0: 1
1: 0
2: 3
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900337815 Original CRISPR CTGCTGTCCTTGGGCAAAAC GGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901513745 1:9731460-9731482 CGGCTGTGCCTGGTCAAAACGGG + Intronic
901514424 1:9735419-9735441 CAAGTGTCATTGGGCAAAACAGG + Intronic
902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG + Intergenic
904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
910640502 1:89456218-89456240 AAGCTGTGCTTGGGCAAAAGAGG + Intergenic
917249317 1:173040274-173040296 CTGCTCACCTTGGGCTAAAGGGG + Exonic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917704497 1:177618344-177618366 CTGCTGTCTTTGGACATACCAGG - Intergenic
917732256 1:177886482-177886504 CTGCTGTTCTGGGGCAAACTTGG - Intergenic
922896659 1:229106052-229106074 CTCCTGTCCTTGAGCCACACTGG - Intergenic
924074248 1:240316806-240316828 ATGCTATCATTGGGGAAAACTGG - Intronic
924386730 1:243506167-243506189 CTGCGGTCCTTGGGCCTGACGGG - Intronic
924514829 1:244757211-244757233 CAGCTGTCCTTGGACTAGACTGG - Intergenic
1066196229 10:33102836-33102858 CTGCAGTCCTCAGGCAAATCTGG + Intergenic
1067786958 10:49257292-49257314 CTACTGTTTTTAGGCAAAACTGG + Intergenic
1070746829 10:78938818-78938840 CTGCAGCCCTTGGCCAACACTGG + Intergenic
1070761148 10:79025136-79025158 GAGCTGTCCTTGGGCATCACTGG - Intergenic
1073206614 10:101772804-101772826 CTGCTGACTTGGGGCCAAACCGG - Intronic
1073608627 10:104921232-104921254 CTGCTGTGCTTTGTAAAAACAGG + Intronic
1078251903 11:9623290-9623312 CTGCTGGCTCTGGGCAAAATGGG - Intergenic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1081193601 11:40134503-40134525 CTACTGTCCACAGGCAAAACTGG + Intronic
1081639782 11:44744920-44744942 CTGCTGAGCCTGGGTAAAACAGG - Intronic
1082698766 11:56402172-56402194 CTGCTGGCCCTGGGCAATAAGGG - Intergenic
1083898174 11:65630699-65630721 CAGCTTCCCTTGGACAAAACAGG - Intronic
1085333197 11:75669448-75669470 CTGCTGGAATTGGTCAAAACCGG + Intergenic
1085508443 11:77073301-77073323 CTGCAGGCCTTGGGCAGGACAGG - Intronic
1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG + Intronic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1088754301 11:112872906-112872928 CTCCTGGCCTTGGGCACAACTGG + Intergenic
1089676696 11:120095318-120095340 CTGCTGTCCTAGAGCAAGAGTGG + Intergenic
1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG + Intronic
1090259965 11:125312475-125312497 CTGCTCTCCTGGGGCACAGCAGG - Intronic
1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG + Intronic
1096599482 12:52719130-52719152 ATGCAGGCCTTGGGCTAAACTGG - Intergenic
1097093066 12:56522784-56522806 GTGCTGTCCTTGGGCACATGGGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097536843 12:60882889-60882911 CTGCTTTCTTTGGGCACAATGGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1109858280 13:68162555-68162577 CTTCTATACTTGGGCAAAATGGG - Intergenic
1113784515 13:112995508-112995530 CTGCTCTCCTGGGGCAGAAGTGG - Intronic
1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG + Intronic
1115863884 14:37720955-37720977 ATGTTGTCTTTGGGCTAAACTGG + Intronic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG + Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1138433916 16:56986512-56986534 CTGCTGACCTTGGGCAGGATGGG + Intergenic
1140979542 16:80093623-80093645 CTGCTTTCTTGGGGCAAACCTGG - Intergenic
1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG + Intergenic
1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG + Intronic
1144287772 17:13795076-13795098 CTGCTGTTGTTGGACAAAACTGG - Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG + Intergenic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1150270715 17:63862708-63862730 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150274344 17:63886229-63886251 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150276487 17:63901057-63901079 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1152651023 17:81493022-81493044 CTGCTGTCCTGGGTCAGAAAAGG - Intergenic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1156700691 18:39820862-39820884 CTGCTGACCTTGGGCTGAACTGG + Intergenic
1160067283 18:75587453-75587475 CTGGTGAACTTGGGCACAACTGG - Intergenic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG + Intronic
927579887 2:24233128-24233150 GTTCTGTCCTTGGGCAATACGGG + Intronic
929407216 2:41656551-41656573 CTGCTGTCCTTGCGATAAAGAGG + Intergenic
930219774 2:48734750-48734772 CTGCTGTCCAGGGTCAAAAAAGG + Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935684294 2:105669933-105669955 CTGCTGCTCCTGGGCAAAGCTGG + Intergenic
937093509 2:119222191-119222213 GTGCTGTCCTTGGGCATTAAAGG + Intergenic
940881286 2:158949351-158949373 CTGCTTTCCGTAGTCAAAACAGG - Intergenic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
944046159 2:195414181-195414203 CTGCTTTTCTTGGGCACAAGGGG - Intergenic
944648660 2:201806571-201806593 CTGCTGACCTCTGGCAAAAAGGG + Exonic
946295105 2:218777789-218777811 CTGCTGCCCTTGGGCAACATGGG + Intergenic
946892545 2:224293161-224293183 CATCTGTCCTTGGCCAAAAGAGG + Intergenic
947502380 2:230680815-230680837 CTGTTGTCCTCGGGCAGAGCCGG - Intergenic
947746791 2:232512088-232512110 CTCCTGTCCTTGGCCTAAAACGG + Intergenic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1176905317 21:14493373-14493395 CTATTGTCCTTGGGGAAAATGGG - Intronic
1177438229 21:21083805-21083827 ATGCTGTCATTGGGAGAAACTGG - Intronic
1177927983 21:27242737-27242759 CTCCTGTCCTTGGACAAATCTGG + Intergenic
1178970046 21:37166232-37166254 CTGGTGTACTGGGGCAAACCTGG - Exonic
1179078533 21:38147704-38147726 CTGCTGTCATAGAACAAAACTGG - Intronic
1181963254 22:26638295-26638317 CTCAGGTCCTTGGGCAAAGCGGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950266280 3:11575506-11575528 CTCCTTTCCTTGGGCACAATCGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG + Intergenic
951174227 3:19580227-19580249 CTGCTGTCCTTAGGCTTAAGTGG - Intergenic
952793153 3:37216450-37216472 CTGCTGGCCTTGTCCAGAACTGG + Intergenic
952965043 3:38615939-38615961 CTGCTGTCCTTAGCCACACCCGG - Intronic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG + Intronic
955121552 3:56064798-56064820 CTGCAGCCCATGGGCCAAACTGG + Intronic
955865387 3:63377035-63377057 CAGTTGTACTTGGGAAAAACGGG - Intronic
957803883 3:85121332-85121354 TTGCTGTCTGTGGGAAAAACAGG + Intronic
961059941 3:123820185-123820207 CTGTTGTAGTTGGGCAGAACAGG + Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
962743837 3:138382869-138382891 CTGGTGTGCTTGGCCCAAACTGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG + Intronic
969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG + Intronic
971543400 4:27851690-27851712 CTGCATTCCATTGGCAAAACGGG + Intergenic
973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
975415551 4:74100076-74100098 GTGCTGTCCCTGGGCAGAAAAGG + Intergenic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
979869140 4:125794695-125794717 CTGGTGTCTATGGGCAAAATTGG + Intergenic
981550181 4:145936111-145936133 CTGCCGTGCTTGGACAAAATGGG - Intronic
983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG + Intronic
983928566 4:173429156-173429178 CAGCTGTCCCTGGGGAAATCAGG - Intergenic
986758022 5:10855854-10855876 CTGCTCTCCTTGTGCAAATGGGG + Intergenic
986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG + Intergenic
988990031 5:36661678-36661700 CAGCTGTTCTTTGGCAAAGCAGG + Intronic
990326079 5:54676634-54676656 GTGCTGTACTTGGGCAACTCAGG - Intergenic
992263432 5:74993206-74993228 CTGATGACCCTGGGCAAGACAGG - Intergenic
993328586 5:86569775-86569797 CTGCTGGCCCTGGGCAAAGAGGG - Intergenic
995491235 5:112693463-112693485 CTGATGTGCTTGGAAAAAACCGG + Intergenic
997717571 5:136053389-136053411 CTGCTGTGCATGGGCAAAGAGGG + Intronic
998050315 5:139026983-139027005 CTGCTCTCCTTAGGCAAGGCAGG - Exonic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1003172457 6:3730616-3730638 CTGCTGTCCGTGGTTGAAACGGG - Intronic
1003253638 6:4455548-4455570 CTGCTGTGCTTGGGAAACCCTGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004901146 6:20195318-20195340 CTGCTGTCAGTGGCCAAAGCTGG - Intronic
1005143181 6:22657746-22657768 CTGCCATCCTTGGGCAACAAAGG + Intergenic
1007034304 6:38658981-38659003 CTGCTGTCCTAGGGTAGAAGTGG + Intergenic
1007244271 6:40448882-40448904 CTTCCTTCCTTTGGCAAAACAGG - Intronic
1013274314 6:108569713-108569735 CTGCAGTCCTAGGGCACATCTGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019745930 7:2700390-2700412 CTGCTGTCCATGGGCCACCCGGG - Exonic
1020543593 7:9493730-9493752 CTGCTGGTCATGGGCAGAACAGG - Intergenic
1022952743 7:35354061-35354083 CTGCTTTCCTTTTGCAAATCAGG - Intergenic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1023618445 7:42045169-42045191 CTGGTATCCTTGAGCTAAACAGG + Intronic
1023640376 7:42251120-42251142 GTACTGTCCTGGGGCAACACTGG + Intergenic
1024104696 7:46071180-46071202 CTACCGTCCTTGGGGAAAGCTGG + Intergenic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1024757298 7:52549952-52549974 CTGCTGTCCAGGGTCAAAGCTGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026509790 7:71018444-71018466 CTGCAGTCCTATGGCAATACAGG + Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030400736 7:109046444-109046466 CTGGTTTCCTTGGACAATACAGG + Intergenic
1031316885 7:120269635-120269657 GTGCTGTACTTGTGCAAGACTGG - Intergenic
1032154908 7:129459704-129459726 CTGCAGTCCTTTGGCCAAATAGG + Intronic
1032268394 7:130383806-130383828 CTCCTGTCCTTGGGGGAAGCAGG + Intronic
1033416693 7:141167836-141167858 CTGCTTCCCTGGGGCACAACGGG - Intronic
1033824317 7:145170897-145170919 GTTCTGTCATTGGGCTAAACTGG + Intergenic
1041025949 8:53687125-53687147 GTGTTATCCTTGGGGAAAACTGG + Intergenic
1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG + Intergenic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1045649525 8:104329015-104329037 ATGCTGTCTTGGGGCAGAACTGG - Intergenic
1048871719 8:138804429-138804451 CTGCTGTGCTTGAGCAGAGCAGG - Intronic
1050106775 9:2174044-2174066 CTGCTGTACGTGGGCATAACTGG - Intronic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1051500808 9:17775829-17775851 CTGATGCACTTGGGCAGAACAGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053288801 9:36866615-36866637 CTCCTGTCCTTGTGCAGAACTGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1060144757 9:121242438-121242460 CTGCTGTCCTCTGGAAAAAGGGG + Intronic
1060979509 9:127784590-127784612 AGGCTGTCCTTGGGCAGAGCTGG + Intergenic
1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG + Exonic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1186307058 X:8273245-8273267 ATGCTCTCCATGGGCAAGACTGG - Intergenic
1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG + Intronic
1187790723 X:22947189-22947211 CTGCTTTCCTTGGTCAAGACTGG + Intergenic
1188741656 X:33790760-33790782 CTCCTGTCCCAGGGAAAAACTGG + Intergenic
1192924651 X:75742875-75742897 CTGGTGTACTGGGGCAAACCTGG + Intergenic
1197891462 X:131274379-131274401 CTCCTTTCCTTGGGGAAAAGAGG + Intronic
1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199737542 X:150697660-150697682 CGTGTGACCTTGGGCAAAACTGG + Intronic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic