ID: 900338964

View in Genome Browser
Species Human (GRCh38)
Location 1:2178845-2178867
Sequence CAGCAGGAATGGATGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 669}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900338953_900338964 26 Left 900338953 1:2178796-2178818 CCTGTGGACTCAGGGTCTCTTTC 0: 1
1: 0
2: 1
3: 21
4: 209
Right 900338964 1:2178845-2178867 CAGCAGGAATGGATGGTGAAAGG 0: 1
1: 0
2: 0
3: 29
4: 669
900338951_900338964 30 Left 900338951 1:2178792-2178814 CCCACCTGTGGACTCAGGGTCTC 0: 1
1: 0
2: 2
3: 13
4: 266
Right 900338964 1:2178845-2178867 CAGCAGGAATGGATGGTGAAAGG 0: 1
1: 0
2: 0
3: 29
4: 669
900338952_900338964 29 Left 900338952 1:2178793-2178815 CCACCTGTGGACTCAGGGTCTCT 0: 1
1: 0
2: 0
3: 20
4: 251
Right 900338964 1:2178845-2178867 CAGCAGGAATGGATGGTGAAAGG 0: 1
1: 0
2: 0
3: 29
4: 669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900338964 Original CRISPR CAGCAGGAATGGATGGTGAA AGG Intronic
900338964 1:2178845-2178867 CAGCAGGAATGGATGGTGAAAGG + Intronic
900519024 1:3096717-3096739 GAGCAGGGGTGGATGGTGAGTGG + Intronic
901130719 1:6961474-6961496 CAGCAGGAACGCATGGTGGTCGG - Intronic
902107454 1:14049677-14049699 CAGAAGGAAAGGAGGGTGAGAGG - Intergenic
902381643 1:16055566-16055588 CAGCAGGAATGGGAGGAGAGGGG + Intronic
904268950 1:29336295-29336317 CAGCAGGTAGGGATGCTGTATGG + Intergenic
904581390 1:31546770-31546792 CAGGATGAAGGGATAGTGAATGG + Intergenic
904711489 1:32433571-32433593 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
905493653 1:38365511-38365533 AAGAATGGATGGATGGTGAAGGG - Intergenic
905499633 1:38426339-38426361 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
905771455 1:40640532-40640554 CAGCTGGATGGGATGGTGAGGGG - Intronic
906080772 1:43086750-43086772 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
907292478 1:53425533-53425555 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
907503710 1:54902314-54902336 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
907521101 1:55023862-55023884 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
907551858 1:55311492-55311514 CAGCAGTCATTTATGGTGAAAGG - Intergenic
907961554 1:59288186-59288208 CAGAAGGACTGAATGGTGAGGGG - Intergenic
908461854 1:64354417-64354439 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
908592098 1:65646333-65646355 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
908822287 1:68101011-68101033 AAGCAGGAATTTATGCTGAACGG - Intronic
909035322 1:70589573-70589595 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
909052207 1:70779801-70779823 CAACAGTCATGGATGGAGAATGG - Intergenic
909405136 1:75280755-75280777 AAGGAGAAATGCATGGTGAAGGG - Intronic
909612714 1:77569981-77570003 CAGGAGGAATGGGTGGGGTAGGG - Intronic
909729239 1:78873161-78873183 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
909909817 1:81246698-81246720 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
910412059 1:86956551-86956573 CAGAAGGAACTGATGGTGAGAGG + Intronic
911148192 1:94571651-94571673 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
911570259 1:99510898-99510920 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
911584428 1:99674177-99674199 GAGCAAGAATGAATGCTGAAAGG - Intronic
911686056 1:100779110-100779132 CAGGAGAAAGGGGTGGTGAATGG - Intergenic
911983706 1:104597224-104597246 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
912815470 1:112824981-112825003 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
913064133 1:115233919-115233941 CAACAGGAATCGATGGAGGAAGG + Intergenic
915594354 1:156887825-156887847 CCGCAGGAAGGGCTGGTGAGGGG - Intergenic
916076045 1:161200557-161200579 GAGCAGGAAGGGAGGGGGAAAGG - Intronic
917035891 1:170746429-170746451 CAGCAGGAAGGGATTGGGAAGGG + Intergenic
918045260 1:180937393-180937415 CAGCAGGCAAGGCTGCTGAAGGG + Intronic
918346969 1:183614908-183614930 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
919476252 1:198036054-198036076 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
919848074 1:201654209-201654231 CATCAGTGATGGATGGTAAAGGG - Intronic
920011660 1:202872382-202872404 CACCAGGTTTGGATTGTGAAGGG + Intergenic
920901683 1:210115271-210115293 AAGGAGGAATGGAGGGTGGAAGG + Intronic
920907864 1:210188566-210188588 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
921459925 1:215414392-215414414 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
921509121 1:216009263-216009285 AAGAAGGAATGGAGGGTGGAAGG - Intronic
921519986 1:216146808-216146830 AAGGAGGAATGGAGGGTGGAAGG - Intronic
921733116 1:218598238-218598260 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
922048273 1:221967232-221967254 AAGGAGGAATGGAAGGTGGAAGG - Intergenic
922049684 1:221977552-221977574 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
922154218 1:223028853-223028875 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
922906255 1:229175696-229175718 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
922934678 1:229413659-229413681 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
923075068 1:230602515-230602537 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
923175486 1:231460215-231460237 CAGGGGGAATGAATGGGGAAAGG + Intergenic
923244606 1:232119439-232119461 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
923436155 1:233969892-233969914 CAGGAGAAATGGCTGGGGAACGG + Intronic
923811957 1:237328519-237328541 GAGCAGGAATGGAAAGTGATTGG + Intronic
923977651 1:239282154-239282176 CAGCAGGAATTCATTGTGTAGGG + Intergenic
923998837 1:239528262-239528284 CAGCAGGAATTGGTGCTGCAGGG - Intronic
924180510 1:241435235-241435257 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1063106557 10:2997468-2997490 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1063135830 10:3215344-3215366 GAGCAGGAATGAGTGTTGAATGG - Intergenic
1063244377 10:4203078-4203100 CAGCAGAAATGGCTGTTAAAAGG - Intergenic
1063581137 10:7308608-7308630 CAGAAAGAATGTAAGGTGAATGG + Intronic
1064444921 10:15384592-15384614 CAGGAGGAGGAGATGGTGAAAGG + Intergenic
1064887136 10:20123612-20123634 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1065443345 10:25773656-25773678 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1065610380 10:27466352-27466374 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1067360233 10:45572351-45572373 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1067833126 10:49621666-49621688 CAGAAGGGGTGGAGGGTGAAGGG - Intronic
1067840084 10:49668737-49668759 CAGCAGGAGTGGAGGGGAAAGGG + Intergenic
1067850244 10:49749949-49749971 CAGCAGGAGAGGATGGTGCCTGG - Intronic
1068230827 10:54168016-54168038 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1068592484 10:58865449-58865471 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1068954605 10:62811428-62811450 CAGCATGAATGGGTTGTCAAAGG - Intergenic
1069285858 10:66714580-66714602 AAGCAGAGGTGGATGGTGAATGG - Intronic
1070503548 10:77093592-77093614 CATGAGGGATGGATGGTGAATGG + Intronic
1070729236 10:78813862-78813884 CAGCAGGGATGGAGGCAGAATGG - Intergenic
1070953102 10:80446568-80446590 AAGCAGGAATGTTTGGGGAAGGG - Intergenic
1071283995 10:84127537-84127559 GAGAAGGAATGGATGTTGATGGG - Intergenic
1071417756 10:85457086-85457108 AAGCGGGAATGCATGCTGAACGG + Intergenic
1071960976 10:90808704-90808726 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1072011425 10:91305961-91305983 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1072055285 10:91749273-91749295 CAACAGGAATACATTGTGAATGG - Intergenic
1072372459 10:94778202-94778224 CATCAAGAATGGATGATCAAAGG + Intronic
1073013734 10:100381890-100381912 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1073105562 10:101030584-101030606 GAGCAGGAATGAGGGGTGAAAGG - Intronic
1073558102 10:104473038-104473060 CAGCAGAGATGGAGGGTCAAGGG - Intergenic
1074280670 10:112048633-112048655 AAGCAGGAAGGGATGGGAAAAGG + Intergenic
1075397881 10:122141069-122141091 CAGCAGGAAGGGGTGATGAGGGG + Intronic
1075488109 10:122843749-122843771 CAGGAGAAATGGAGAGTGAATGG + Intronic
1075650329 10:124123826-124123848 CAGTAGGAATGGCTGGTGACTGG + Intergenic
1075707334 10:124509489-124509511 CAGCAGGTCAGGAAGGTGAACGG - Intronic
1075993440 10:126857481-126857503 CAGCAGGAATGGATTCTCACAGG + Intergenic
1076676738 10:132151013-132151035 GAGAAGGAATGGATGGAGGATGG - Intronic
1077630392 11:3807807-3807829 CAACAGGGAAGGAGGGTGAAGGG - Intronic
1077679268 11:4224070-4224092 AAGGAGGAATGGAGGGTGAAAGG + Intergenic
1077688701 11:4320712-4320734 AAGGAGGAATGGAGGGTGAAAGG + Intergenic
1077767472 11:5175801-5175823 CAGCAGGAAGGGAAAGGGAAAGG - Intronic
1078046270 11:7916612-7916634 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1079230375 11:18644267-18644289 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1080018432 11:27532518-27532540 CAGCAGGAATAGCTGGTGCTTGG - Intergenic
1080028054 11:27633527-27633549 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1080930555 11:36805614-36805636 CAGCAGTAATGAATGCTTAAGGG + Intergenic
1081358477 11:42143734-42143756 CAATAGGAGTGGAAGGTGAAGGG + Intergenic
1081729101 11:45355899-45355921 CAGCAGGAGTGGGTGGTGGCTGG - Intergenic
1081770712 11:45649208-45649230 CAGGAGGCAGGGATGGGGAAAGG + Exonic
1084613416 11:70218747-70218769 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1084689941 11:70719350-70719372 CAGCAGGCATGGATAGTGGGTGG - Intronic
1085934118 11:81123076-81123098 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1086133007 11:83420354-83420376 GAGGAGGAGTGGAGGGTGAAAGG - Intergenic
1086550054 11:88044413-88044435 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1087168057 11:95023995-95024017 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1087314534 11:96589187-96589209 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1088435791 11:109811875-109811897 AAGCAGGGATGGATGGAGAGAGG + Intergenic
1089441141 11:118518299-118518321 CTGCTGGCATTGATGGTGAAAGG - Intronic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1089867205 11:121642400-121642422 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1089953105 11:122547823-122547845 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1089987289 11:122825877-122825899 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1090107743 11:123870058-123870080 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1090250993 11:125251697-125251719 CAGCAGGAATGGAGGAAGAGAGG - Intronic
1091768446 12:3136941-3136963 CAGCAGGACTGGACGGGGCAGGG - Intronic
1092626891 12:10337379-10337401 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1092723859 12:11466621-11466643 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1092924990 12:13264406-13264428 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1093071305 12:14709320-14709342 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1093268154 12:17026134-17026156 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1093812995 12:23510491-23510513 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1094316204 12:29139487-29139509 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1094613413 12:32015227-32015249 GGGCAGGAAGGGTTGGTGAAAGG + Intergenic
1094723585 12:33089847-33089869 AGGGAGGAATGGATGGTGGAAGG + Intergenic
1095999234 12:48114956-48114978 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1096907335 12:54947401-54947423 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1097555149 12:61127492-61127514 CAGCAGTGATGGATGGAGCAAGG + Intergenic
1098173781 12:67771083-67771105 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1098604111 12:72369399-72369421 CAGGAGTAAAGGATGGAGAAAGG + Intronic
1099188566 12:79541132-79541154 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1099762448 12:86940059-86940081 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1100561198 12:95750350-95750372 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1100785532 12:98074022-98074044 CTGCAGGGAGAGATGGTGAAGGG - Intergenic
1100807742 12:98305013-98305035 TAGCAGGAAGGGAGGGAGAAAGG - Intergenic
1101217343 12:102597260-102597282 CAGCAGGAAGGGGAGCTGAAAGG + Intergenic
1101685565 12:107016588-107016610 CAGAAGGAAAGGATGATGGATGG - Intronic
1101700738 12:107171498-107171520 CAGAAGGAGTGGATGGGGGATGG - Intergenic
1102416210 12:112765115-112765137 CAGCAGGAGTGTTTGATGAATGG - Intronic
1102513489 12:113431187-113431209 CGTCAGGGAGGGATGGTGAAAGG + Intronic
1102604274 12:114056719-114056741 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1103444114 12:120982831-120982853 CAGCAGGAATGACTGGGGAGGGG - Intronic
1103865408 12:124047860-124047882 TAGGAGGAATGGATGCTCAATGG + Intronic
1104180348 12:126373671-126373693 CAGCAAGAATGTATTGTGAGAGG - Intergenic
1104365420 12:128172404-128172426 CAGCAGCACTGGAAGCTGAAAGG + Intergenic
1105978562 13:25495303-25495325 CAGCAGGATTGGATCTGGAAGGG + Intronic
1106318611 13:28617873-28617895 GAGCAGGACTGGCTGGTGCAAGG - Intergenic
1106921660 13:34570614-34570636 AAGTAGGAATGGATTGAGAAGGG + Intergenic
1107075436 13:36317705-36317727 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1107294834 13:38897586-38897608 CAGCAGGAAGGGGAGCTGAAAGG - Intergenic
1108804016 13:54132149-54132171 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1108919691 13:55659425-55659447 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1109499151 13:63214385-63214407 AAGGAGGAATGGAGGGTGTACGG - Intergenic
1110650663 13:77938143-77938165 CAGGAGGAATGGAGGGTGGAAGG + Intergenic
1110765326 13:79275395-79275417 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1110845185 13:80184819-80184841 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1111126183 13:83912717-83912739 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1111630307 13:90840721-90840743 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1112090493 13:96078232-96078254 AAGCTGGTATGGATGGGGAAGGG - Intergenic
1112211225 13:97379702-97379724 AAGAAGGAATGGAAGGAGAAAGG + Intronic
1112381195 13:98892231-98892253 CAGCAGAAATGGATGGGCAGTGG - Intronic
1112388144 13:98959128-98959150 CAGCAGGACTGGATTGGGACAGG + Intronic
1113307105 13:109090550-109090572 GGGCAGGAGTGCATGGTGAAAGG + Intronic
1114805638 14:25833285-25833307 CAGGAGAAATGTATGGGGAAAGG + Intergenic
1116179534 14:41517218-41517240 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1116987209 14:51233361-51233383 CAGAAGGAAAGGAGGGAGAAAGG + Intergenic
1118201672 14:63679870-63679892 CAGGAGGAAGAGAAGGTGAAGGG + Intergenic
1118895436 14:69941813-69941835 AAGTAGGAAGGGATGTTGAAAGG - Intronic
1118937452 14:70300641-70300663 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1119022277 14:71125555-71125577 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1119317054 14:73704753-73704775 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1119442948 14:74640989-74641011 CAGCAGGTATGGATGCAGAGGGG + Intergenic
1119560477 14:75585481-75585503 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1119638133 14:76293255-76293277 CATCAGGAATGCATAGTGCAGGG - Intergenic
1120660105 14:87239474-87239496 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1120745967 14:88152176-88152198 CAGCAGGAATGGAGGAGGCAGGG + Intergenic
1121289211 14:92760753-92760775 AAGAAGGAATGGAGGGTGGAAGG - Intergenic
1122040850 14:98986465-98986487 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1122381487 14:101310130-101310152 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1122639028 14:103146437-103146459 CTGGAGGCATGGATGGGGAAGGG + Intergenic
1122900733 14:104781370-104781392 CAGCAGGACTGGGTGGTGGGTGG - Intronic
1122977824 14:105178213-105178235 CACCAGGAGTGGATGGGGAAGGG + Intronic
1202946276 14_KI270726v1_random:29658-29680 CAGCTGGGATGGATTGTGGATGG - Intergenic
1123882633 15:24689995-24690017 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1124491872 15:30163160-30163182 CAGCTGGAGTGGATGGAGCATGG + Intergenic
1124751664 15:32375157-32375179 CAGCTGGAGTGGATGGAGCATGG - Intergenic
1125478319 15:40062716-40062738 CAGTAGAACAGGATGGTGAAAGG + Intergenic
1125629018 15:41132384-41132406 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1125724654 15:41862122-41862144 CATCAGGAGTGCAAGGTGAATGG - Exonic
1125848945 15:42885781-42885803 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1125930503 15:43596250-43596272 CAGCAGGAATGGCTCGAGACTGG + Exonic
1125943671 15:43696082-43696104 CAGCAGGAATGGCTCGAGACTGG + Exonic
1126843603 15:52739852-52739874 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1127680696 15:61294689-61294711 CAGGAGGAAGGGAAGGGGAAGGG + Intergenic
1130381729 15:83377852-83377874 CAGCAGGAATGGCAGGTGGTGGG - Intergenic
1130854971 15:87832534-87832556 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1130947622 15:88560925-88560947 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1131439996 15:92452508-92452530 CAGGAGGAAAGGATGGACAATGG + Intronic
1131684032 15:94752002-94752024 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1132861196 16:2072643-2072665 CACCAGGAATGTGAGGTGAACGG - Intronic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133651252 16:7815964-7815986 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1134784196 16:16925987-16926009 CAGGAGGAAAGGAGGATGAAGGG + Intergenic
1135253845 16:20924419-20924441 CAGCTGGCATGTGTGGTGAATGG - Exonic
1135893337 16:26376442-26376464 AAGGAGGAATGCATGGTGGAGGG + Intergenic
1136088555 16:27902633-27902655 CAGCAGGGAGGGATGGGGAGGGG + Intronic
1137363288 16:47839759-47839781 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1137386134 16:48044143-48044165 CTGGATGGATGGATGGTGAATGG - Intergenic
1137556412 16:49473181-49473203 CACCAGGGATGGCTGGAGAAGGG - Intergenic
1137570073 16:49559444-49559466 CATCAGGGATGGATGGAGACTGG - Intronic
1137704741 16:50526729-50526751 AATCTGGAATGGATGGGGAAAGG + Intergenic
1138759254 16:59522082-59522104 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1138804797 16:60080095-60080117 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1139039376 16:62983603-62983625 AAGGAGGAATGGAGGGTGCAAGG + Intergenic
1139943857 16:70625215-70625237 AAGGAGGAATGGATGGTGGAAGG + Intronic
1140137552 16:72220977-72220999 CAGCAGGAAAGGAAGGGAAAGGG - Intergenic
1140304753 16:73792684-73792706 CAGCATGAACGAATGGAGAATGG + Intergenic
1142490964 17:279307-279329 TAGCAGGAATGGATGGGGCTGGG - Intronic
1143097634 17:4486869-4486891 AAGCAGGAAAGGAAGGAGAAAGG + Intronic
1143175249 17:4951389-4951411 CAGCAGGGATGGATAGAAAAGGG + Intronic
1144087444 17:11823453-11823475 CAAAAGAAATGAATGGTGAAAGG + Intronic
1144254086 17:13448390-13448412 CCCCAGGCATGGATGGGGAATGG + Intergenic
1146268723 17:31470548-31470570 AAGCAGGAATGGATGATACATGG + Intronic
1146429079 17:32773604-32773626 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1146498839 17:33347080-33347102 AAGGAGGAATGGACGGTGAGTGG + Intronic
1146597749 17:34184537-34184559 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1146975704 17:37109767-37109789 CAGAAGGACTGGATGGTGAGGGG - Intronic
1147050788 17:37793145-37793167 CAGTAGGGGTGGGTGGTGAATGG + Intergenic
1149783984 17:59420430-59420452 CAGCAGGAGTGAATGGTGTTAGG + Intergenic
1150637105 17:66921098-66921120 CAGCAAGAAGGGAAGGTGCAGGG - Intergenic
1150860644 17:68797068-68797090 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1152453747 17:80400787-80400809 AAGGAGGAATGGAGGGTGAAAGG - Intergenic
1152466603 17:80470072-80470094 CAGCAGGGATGGATGCTGTCTGG + Exonic
1152546196 17:81001155-81001177 TAGCAGGGATGGATGGTTATTGG - Intronic
1155173673 18:23285301-23285323 AAGGAGGAATGGAAGGTGGAAGG - Intronic
1155892846 18:31288710-31288732 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1155941398 18:31805037-31805059 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1155961803 18:32001513-32001535 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1156252079 18:35360774-35360796 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1156302103 18:35845126-35845148 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1157051953 18:44176514-44176536 GAGCAGGAATGGAAGGTAGACGG + Intergenic
1157906551 18:51574520-51574542 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1158019216 18:52821523-52821545 AAGCCGGAATGAATGATGAAGGG - Intronic
1159301601 18:66578994-66579016 CAGGAGGGAAGGATGATGAAGGG + Intronic
1159332051 18:67008423-67008445 GAGCAGTAATAGATGTTGAAAGG + Intergenic
1159929070 18:74293714-74293736 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1159949642 18:74473520-74473542 CAACAGGATTTGATGATGAATGG - Intergenic
1160072052 18:75637355-75637377 CAGCAGGAATCGACAGGGAAGGG + Intergenic
1160550206 18:79690004-79690026 CAGCAGGATTTGTTGGAGAATGG - Intronic
1160709644 19:545074-545096 AAGGAGGAATGGATGATGGATGG - Intronic
1160843297 19:1155888-1155910 CAGCAGGAAGGGGTGCTGACAGG - Intronic
1161058003 19:2200275-2200297 CAGAAGGGATGGATGGAGACAGG - Intronic
1161141154 19:2648751-2648773 CAGCAGGGATGAGTGATGAAAGG + Intronic
1161709448 19:5839633-5839655 CTGCAGGAGTGGGTGGGGAAAGG - Exonic
1161711062 19:5848314-5848336 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1161975141 19:7604438-7604460 CAGGAGGAATGGGAGGTGAAGGG - Intronic
1162787729 19:13046100-13046122 CAACAGGAATGAATGGTGGAAGG - Intronic
1163900431 19:20095444-20095466 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1164459372 19:28434321-28434343 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1164661615 19:29976476-29976498 CAGCAAGAATGGAAGCTGCAAGG + Intronic
1164741191 19:30576635-30576657 CAGGGGGTATGGATGGTGCATGG - Intronic
1165027016 19:32969572-32969594 CTGCAGGGATGGAGGGTGAAGGG + Intronic
1165510455 19:36263917-36263939 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1165950268 19:39470357-39470379 CAGCTGCCAGGGATGGTGAAAGG - Exonic
1166042507 19:40212518-40212540 CCGCCAGAATGAATGGTGAAGGG + Intronic
1166064504 19:40349325-40349347 CATGAGGAGTGGATGGTGACTGG - Intronic
1166770084 19:45276489-45276511 CAGCAGGCATGGCTGGGGGAGGG + Intronic
1166905946 19:46108529-46108551 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1166917024 19:46202441-46202463 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1167099261 19:47393940-47393962 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1167483732 19:49748049-49748071 ACGCAGGAATGGATGGGGAGAGG - Intronic
1167874722 19:52402256-52402278 CAGCAGACATGGATGGAGACGGG + Intronic
1167900908 19:52621645-52621667 TAGGAGGAATGGAGGGTGGATGG - Intronic
1167966103 19:53148492-53148514 CAGCACCACTGGAAGGTGAAAGG + Intronic
1168212267 19:54899361-54899383 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1168228127 19:55011211-55011233 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1168332858 19:55579939-55579961 CAGAAAGACAGGATGGTGAAAGG + Intronic
925097269 2:1216980-1217002 CAGCAACAATGAAGGGTGAAGGG - Intronic
925260902 2:2527684-2527706 CAGCAGGCAGGGCTGGTGGAGGG - Intergenic
925544406 2:5002243-5002265 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
926407632 2:12571036-12571058 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
926413454 2:12627780-12627802 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
926464227 2:13168421-13168443 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
926971010 2:18467476-18467498 CAGTAGGAATTAAGGGTGAAAGG - Intergenic
927174185 2:20393836-20393858 CAGCAGGTATGGATGGACCATGG - Intergenic
927443204 2:23134563-23134585 CTGCAGGACTGGCTGCTGAAAGG - Intergenic
927527493 2:23759493-23759515 CAGCAGGAATTAAAGATGAAAGG - Intronic
928334481 2:30384668-30384690 GAGCAGGAATAGATGCTGATAGG + Intergenic
928429179 2:31203776-31203798 CTGCAGGTATCGATGGTGATGGG + Intronic
928857020 2:35814333-35814355 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
928941350 2:36730507-36730529 CAGTAGGAAGGGATGAAGAAGGG + Intronic
929684682 2:44023514-44023536 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
929793218 2:45038878-45038900 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
929960843 2:46495177-46495199 CAGCAAAAATGGAAGCTGAAAGG - Intronic
931948116 2:67332856-67332878 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
932225616 2:70037930-70037952 CAGCAGGAAAGGATAGTGTTAGG - Intergenic
932309600 2:70729059-70729081 CAGCAGGAAAGGCTGAGGAATGG - Intronic
932340470 2:70960095-70960117 CAGCAGGCATGGCTGGGGGAGGG + Intronic
932435523 2:71700708-71700730 GACCAGGAATGGCTGGGGAAGGG + Intergenic
932792134 2:74662811-74662833 CAGCTGTAATGGCTGGTGAGTGG + Exonic
933012948 2:77089640-77089662 AAGGAGGAATGGAGGGTGGAAGG - Intronic
933137790 2:78759128-78759150 AAGGGGGAATGGAGGGTGAAAGG - Intergenic
933179911 2:79216277-79216299 AAGGAGGAATGGAGGGTGGAAGG + Intronic
933522281 2:83389157-83389179 CAGGACTCATGGATGGTGAATGG - Intergenic
933549559 2:83758765-83758787 CAGTGGGAATGAATGGGGAAAGG - Intergenic
933682670 2:85116424-85116446 CACCAGGAATGGAAGCTGAGGGG - Intergenic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
935059703 2:99596512-99596534 AAACAGGAATGGATGCTGAAGGG + Intronic
935782255 2:106518670-106518692 AGGAATGAATGGATGGTGAATGG - Intergenic
935958301 2:108400089-108400111 CTGCAGGTATGCATGGTGTATGG + Intergenic
936762952 2:115808419-115808441 CAAGAGGAATGGAAGGTGTAAGG + Intronic
937232194 2:120404747-120404769 CAGCACGACTGGGTGATGAATGG - Intergenic
938001621 2:127744906-127744928 CATCAGTCATGCATGGTGAAAGG - Intronic
938582766 2:132662196-132662218 AAGCAGGTATGGATAGTGAATGG + Intronic
939085522 2:137714410-137714432 CAACAGGAAGGGATGGGGCAAGG + Intergenic
939460879 2:142494315-142494337 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
939490807 2:142874184-142874206 CAGCAGGAAAGGAAGGAGAGGGG + Intergenic
939549037 2:143590589-143590611 CAGGAGGAATGGATGGTTGGGGG - Intronic
941000835 2:160202290-160202312 CGGCAAGATTGGAAGGTGAATGG + Intronic
941456342 2:165714942-165714964 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
942068600 2:172295053-172295075 AAGCAGGAAGGGATAGTAAAAGG + Intergenic
943413074 2:187564925-187564947 AAGGAGGAATGGAGGGTGGAAGG + Intronic
943865212 2:192919326-192919348 AAGAAGGAATGGAGGGTGGAAGG - Intergenic
943951442 2:194135356-194135378 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
944387302 2:199180638-199180660 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
944393987 2:199248189-199248211 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
945153249 2:206811288-206811310 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
945375963 2:209079339-209079361 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
945938166 2:215923635-215923657 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
946002470 2:216494143-216494165 CAGCAGTAATGTCTGTTGAATGG - Intergenic
946537650 2:220648642-220648664 CAGGTGGAATAGATGGTGAGAGG - Intergenic
946672496 2:222121231-222121253 AAGAAGGAATGGATGGAGGAAGG + Intergenic
946863334 2:224020911-224020933 CACTATGAATGGATGGTCAAAGG + Intronic
946886351 2:224226550-224226572 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
946893135 2:224297951-224297973 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
948046087 2:234946426-234946448 CCTCAGGGATGGATGATGAAGGG - Intergenic
948458434 2:238118001-238118023 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458442 2:238118030-238118052 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458469 2:238118129-238118151 GAGAAGGAATGGATGGAGGAGGG + Intronic
948458503 2:238118255-238118277 ATGGAGGAATGGATGGTGGAGGG + Intronic
948458512 2:238118284-238118306 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458630 2:238118715-238118737 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458661 2:238118815-238118837 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458740 2:238119140-238119162 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458754 2:238119183-238119205 GAGGAGGAATGGATGGAGGAGGG + Intronic
1168739199 20:173772-173794 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1168870741 20:1126057-1126079 CAGGATGAAGGAATGGTGAAGGG - Intronic
1170069005 20:12344710-12344732 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1170106092 20:12755148-12755170 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1170762457 20:19262921-19262943 CAGGATGAGTGGGTGGTGAAAGG - Intronic
1171040592 20:21758920-21758942 CAGCAGGAAGGGAGGGTCAGCGG - Intergenic
1171428066 20:25060860-25060882 TAGCAGGAGGGGATGGTGATGGG - Intergenic
1172416447 20:34772630-34772652 CAGCAGAAATGCCTGGTTAAAGG + Intronic
1172882445 20:38210851-38210873 CAACAGGCATGGATGGAGATGGG + Exonic
1173395897 20:42679029-42679051 CAGCAGGAATGAGGGGTTAAAGG + Intronic
1173564922 20:44031789-44031811 CAGCAGAAGTGGAGGGTGAAGGG + Intronic
1173853314 20:46232741-46232763 CAGCAGGGGTGGATGTTGAGAGG - Intronic
1174243288 20:49155991-49156013 AAGAAGGCATGGCTGGTGAAGGG - Intronic
1174746976 20:53073030-53073052 AAGGAGGAATGGATGGAGGAAGG - Intronic
1175211183 20:57356976-57356998 CAGCAGCAATGGCAGGAGAAGGG - Intronic
1175329712 20:58155195-58155217 CAGCAGGAGGGGATGGAGATGGG + Intronic
1175688001 20:61045319-61045341 ATGCATGGATGGATGGTGAAAGG - Intergenic
1175700619 20:61134327-61134349 CAGCAGGAAAGGAGGAAGAATGG - Intergenic
1177031330 21:15984271-15984293 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1177100481 21:16893432-16893454 AAGCAGGAATGGAGGGTGGAAGG - Intergenic
1177119417 21:17122730-17122752 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1177178999 21:17724847-17724869 GAGCAGGAGTGAATGGTGACGGG - Intergenic
1178001051 21:28162427-28162449 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1178058962 21:28830905-28830927 CAGAAAGAATAGAAGGTGAAAGG + Intergenic
1178627224 21:34228173-34228195 CAACAGGAGAGGATGGCGAAGGG + Intergenic
1178662192 21:34516892-34516914 CATCAGGAATGAATGGGGAAAGG + Exonic
1178817966 21:35948987-35949009 CAGGAGGAATGGATAGGGATGGG - Intronic
1179421992 21:41243782-41243804 CAAGATGAATGAATGGTGAAAGG - Intronic
1179650519 21:42805501-42805523 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1180560747 22:16612518-16612540 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1180842475 22:18965785-18965807 CAGCAGGAGTGGGTGGGGAGTGG - Intergenic
1181059011 22:20273071-20273093 CAGCAGGAGTGGGTGGGGAGTGG + Intronic
1182998459 22:34835609-34835631 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1183635816 22:39061968-39061990 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1183945762 22:41324932-41324954 CAGGAGGAGAGGATGGTGCAGGG - Intronic
1184095210 22:42312688-42312710 CAGCAGGGATGGGGGGTGACCGG - Intronic
1184369968 22:44076025-44076047 AAGCAGGAGAGGATGCTGAAGGG + Intronic
1184379244 22:44134711-44134733 CAGATGGAATGGTTGGTGTAAGG + Intronic
1185063944 22:48621322-48621344 AAGCAGGGATGGATGATGGATGG - Intronic
949190542 3:1244225-1244247 AAGGAGGAATGGAGGGTGGAAGG + Intronic
949671009 3:6398918-6398940 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
950203861 3:11062977-11062999 CAGCAGGGGTGGGTGGTGCAGGG + Intergenic
951273779 3:20659843-20659865 AAGAAGGAAGGGAAGGTGAAGGG - Intergenic
951298954 3:20971975-20971997 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951894720 3:27599972-27599994 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
952296670 3:32068472-32068494 AAGGAGGAATGGAGGGTGGAAGG - Intronic
952379792 3:32795894-32795916 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
952522103 3:34171616-34171638 AAGCAGGAATGGTTGGGGGATGG + Intergenic
952895409 3:38075487-38075509 AAGGAGGAATGGAGGGTGGAAGG + Intronic
952896202 3:38080707-38080729 AAGGAGGAATGGAGGGTGGAAGG + Intronic
953077276 3:39582247-39582269 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
953272656 3:41460515-41460537 CAGCAGGAATCAAGGGAGAAAGG - Intronic
953603513 3:44390954-44390976 CTGCAGGAGTGGGTGGTGACGGG - Intronic
953739372 3:45523864-45523886 AAGCAGAAATGGATGGCAAAGGG + Intronic
953834610 3:46331882-46331904 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
954161948 3:48729217-48729239 AAGGAGGAATGGAGGGTGGAAGG + Intronic
954574120 3:51665631-51665653 TCCCAAGAATGGATGGTGAAGGG + Exonic
954837091 3:53479421-53479443 CAGCAGGGAGGGATGCTGGAAGG + Intergenic
955236514 3:57144340-57144362 GAGGAGGAAGAGATGGTGAACGG - Intronic
955253214 3:57304933-57304955 AAGGAGGAATGGAGGGTGGAAGG - Intronic
955417313 3:58704707-58704729 CTGCAGGAATGGATGCTGGTGGG - Intergenic
956233654 3:67043178-67043200 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
957816061 3:85298545-85298567 AAACAGGAATGGATTGAGAAAGG + Intronic
958689893 3:97450932-97450954 CAGCACACATGGGTGGTGAAAGG + Intronic
958755329 3:98244875-98244897 AGGGAGGAATGGATGGTGGAAGG - Intergenic
959485914 3:106927165-106927187 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
960310259 3:116109751-116109773 GAGGAGGAATGGAGGGTGGAAGG + Intronic
961343862 3:126248289-126248311 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
961474937 3:127140558-127140580 CAGCAGGGATGGGTGGTGCCTGG + Intergenic
961730434 3:128960991-128961013 GAGGAGGAATGGAGGGTGGAAGG - Intronic
961829909 3:129618148-129618170 CCGCAGGACTTGTTGGTGAAAGG - Intergenic
961880911 3:130060535-130060557 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
962144101 3:132821872-132821894 CAGCAGGAGTGGACGATGAAAGG - Intergenic
962401247 3:135060912-135060934 GAGGAGGTAGGGATGGTGAATGG - Intronic
962428638 3:135298567-135298589 CAGCTGGCATGGCTGGTGATGGG + Intergenic
962524174 3:136222724-136222746 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
963027129 3:140931092-140931114 CAGCAGGAATAGGTGGTGGGAGG + Intergenic
963468463 3:145711626-145711648 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963520295 3:146354808-146354830 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963521475 3:146363309-146363331 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963663192 3:148152913-148152935 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963684185 3:148415610-148415632 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
964125611 3:153231165-153231187 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
964406869 3:156358354-156358376 CAGCAAGAAGGGAAGGAGAAGGG + Intronic
964983493 3:162713636-162713658 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
965286876 3:166828539-166828561 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
965620970 3:170642061-170642083 AAGCAGGAATGGAAGGAGAGTGG - Intronic
965626463 3:170687799-170687821 AAGGAGGAATGGAAGGTGGAAGG + Intronic
965640194 3:170822435-170822457 AAGGAGGAATGGAAGGTGGAAGG + Intronic
965713254 3:171577681-171577703 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
965862128 3:173160382-173160404 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
966066695 3:175828985-175829007 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
966232987 3:177670279-177670301 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
966327054 3:178768612-178768634 CAGGAGGTATGGATTTTGAAAGG + Intronic
966642219 3:182203947-182203969 CACCAGGTACTGATGGTGAATGG + Intergenic
967212313 3:187179960-187179982 AAGGAGGAATGGAGGGTGGAAGG + Intronic
967658258 3:192075527-192075549 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
967881156 3:194302677-194302699 AAGGAGGAATGGGTGTTGAACGG + Intergenic
968665437 4:1819157-1819179 CAGCCGGAATGGCTGTGGAAAGG + Intronic
968993242 4:3928640-3928662 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
969277768 4:6148581-6148603 CACCAGGAAATGCTGGTGAATGG - Intronic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969556751 4:7916764-7916786 CAGCAGAAAGGGATGTTGCAAGG + Intronic
970041950 4:11807523-11807545 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
970256569 4:14174958-14174980 AAGAAGGAATGGAGGGTGGAAGG + Intergenic
970399737 4:15705684-15705706 CTACAGAAATGGATGGTGCATGG + Intronic
970484790 4:16514016-16514038 CAGGAGGAAGGAATGCTGAACGG + Intronic
970491027 4:16573735-16573757 CAGAATGCATGAATGGTGAATGG + Intronic
970770038 4:19601489-19601511 CAGAAGGAAGGGAGGGTGAAAGG - Intergenic
971343556 4:25792071-25792093 CAGCAGGAATGGCTGCTGGCTGG - Intronic
971384095 4:26127271-26127293 CAGCAGCAACGGAAGCTGAAAGG - Intergenic
972071284 4:35021256-35021278 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
975865236 4:78718309-78718331 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
975934038 4:79558429-79558451 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
976502651 4:85809722-85809744 GAGGAGCAATGCATGGTGAAAGG + Intronic
976593192 4:86869816-86869838 CAGCAAGAATGGAGGGAAAAAGG - Intergenic
977041868 4:92027105-92027127 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
977075358 4:92443411-92443433 AAGGAGGAATGGAGGGTGGAAGG + Intronic
977668156 4:99664933-99664955 CAGCAGCCATGGGTGATGAAGGG + Intergenic
978728565 4:111999029-111999051 AAGGAGGAAAGGATGGTGAGAGG + Intergenic
979054773 4:115980104-115980126 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
979379788 4:119995181-119995203 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
979640823 4:123011760-123011782 AAGGAGGAATGGAGGGTGGAAGG + Intronic
980112074 4:128645279-128645301 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
980204279 4:129697686-129697708 CAGTAGCAAGGGATGGAGAACGG + Intergenic
980388778 4:132119462-132119484 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
980903788 4:138929133-138929155 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
981525059 4:145700386-145700408 AAGGAGGAATGGAGGGTGGAAGG - Intronic
981539578 4:145834002-145834024 AAGGAGGAATGGAGGGTGGAAGG - Intronic
982241729 4:153306577-153306599 AAGAAGGAATAGATGGGGAATGG + Intronic
982414340 4:155112899-155112921 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
982535299 4:156601557-156601579 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
983023721 4:162710361-162710383 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
983055338 4:163094364-163094386 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
983360272 4:166717559-166717581 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
983883917 4:172960860-172960882 AAGGAGGAATGGAGGGTGGAAGG + Intronic
985072122 4:186176584-186176606 GAGAAAGAATGGCTGGTGAAGGG + Intergenic
985390023 4:189483914-189483936 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
985514271 5:331675-331697 CAGCAGGAGTGAGTGGTGGACGG + Intronic
985582206 5:704050-704072 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
986370639 5:7077226-7077248 AATCAGGAAAGGAGGGTGAAGGG - Intergenic
986388734 5:7264860-7264882 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
986553281 5:8982617-8982639 AAGGAGGGATGGAGGGTGAAAGG - Intergenic
986840316 5:11688852-11688874 CAGCAGCACTTGGTGGTGAAAGG + Intronic
987026930 5:13936850-13936872 CAGCAGAAGTGGATGGAGGATGG + Intronic
987281892 5:16421267-16421289 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
987541238 5:19258892-19258914 CAGCTGGAAGGGCTGGTGACTGG + Intergenic
987842946 5:23244519-23244541 CAGGAGGAAGGGAAAGTGAAGGG + Intergenic
988133866 5:27142595-27142617 CACCAGCAATGGATGAGGAAAGG + Intergenic
988596318 5:32594806-32594828 CAGCAGGTAGGGAAGGGGAAAGG - Intronic
988838016 5:35052748-35052770 CAGAAGGAAGGAATGGTGAGAGG + Intronic
990415520 5:55582487-55582509 CAGCAGGAGTGGGTGGGGGAGGG - Intergenic
990565271 5:57021455-57021477 AAGAAGGAATGGAGGGTGGAAGG + Intergenic
991977023 5:72193580-72193602 GGGCAGGAATAGATGGTGGAGGG + Intronic
992253212 5:74896249-74896271 AAGCAGTAATGGATGGGGCAGGG + Intergenic
992394517 5:76358614-76358636 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
993074171 5:83206346-83206368 CAGCAGGATTTGCTGATGAAGGG + Intronic
994126271 5:96171359-96171381 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
994381652 5:99078886-99078908 AAAGAGGAGTGGATGGTGAAGGG + Intergenic
994775541 5:104032885-104032907 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
994779156 5:104068986-104069008 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
994989399 5:106979641-106979663 TAGGAGGAATGGAGGGTGGAAGG - Intergenic
995899517 5:117050811-117050833 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
996052818 5:118951693-118951715 AAGGAGGAATGGAGGGTGGAAGG + Intronic
996344969 5:122478060-122478082 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
997746260 5:136302562-136302584 AAGGAGGAATGGAGGGTGCAAGG - Intronic
997769821 5:136544065-136544087 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
997772786 5:136569785-136569807 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
998557926 5:143143727-143143749 CACCAGGAATGGATGGCTAATGG + Intronic
1000606778 5:163335276-163335298 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1000885478 5:166743562-166743584 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1000935791 5:167302350-167302372 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1001229506 5:169973906-169973928 GAGGAGGAATGGATGATGGACGG - Intronic
1001276222 5:170353648-170353670 CAGCAGGAGTGGGTGGAGAGAGG + Intronic
1001544001 5:172558759-172558781 CCGCAGGGAGGGATGGAGAAGGG + Intergenic
1001656109 5:173351585-173351607 CAGCAGGAATGGACTGAGACAGG + Intergenic
1003387750 6:5684727-5684749 GAGGTGGAATGGATGTTGAAAGG + Intronic
1004051209 6:12081489-12081511 CAGAAGGAATGTTAGGTGAAAGG - Intronic
1004106112 6:12668644-12668666 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1004283672 6:14301402-14301424 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1004508143 6:16263444-16263466 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1005407804 6:25509470-25509492 CAGCAGCAATGGCTAGTGATAGG + Intronic
1006706533 6:36025671-36025693 AAGAAGTAATGGAGGGTGAAGGG - Intergenic
1008476374 6:51939410-51939432 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1009378999 6:63006538-63006560 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1009750455 6:67873427-67873449 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1010069124 6:71722831-71722853 CAGCAGGAAGGAATGTTGAAGGG - Intergenic
1010071875 6:71753029-71753051 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1010586843 6:77664986-77665008 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1010870787 6:81035527-81035549 CAGCAGATATGGAAAGTGAAGGG - Intergenic
1011240364 6:85265963-85265985 CAGCAGAAAGGGATTTTGAAAGG - Intergenic
1011493522 6:87916520-87916542 CAGCAGGAAGGGGAGCTGAAAGG - Intergenic
1011771090 6:90674660-90674682 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1011809414 6:91113213-91113235 GAACAGGAATTGATGCTGAATGG - Intergenic
1012014536 6:93834528-93834550 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1012247512 6:96942268-96942290 TAGCTGGAAAGGATGGTGAGGGG - Intronic
1012315675 6:97780855-97780877 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1013408029 6:109860194-109860216 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1013448210 6:110252364-110252386 CACCAGGAATGCATGCAGAAAGG - Intronic
1013657800 6:112263663-112263685 TTGAATGAATGGATGGTGAATGG - Intergenic
1013808285 6:114017150-114017172 AAGTAGGAATGGAGGGTGGAAGG + Intergenic
1014069970 6:117169417-117169439 TAGCAGGAATGGAAAGTGAGTGG - Intergenic
1014115493 6:117664168-117664190 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1014276317 6:119394249-119394271 CAGCAGGAAAGGGAGCTGAAAGG + Intergenic
1014395861 6:120926100-120926122 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1014455014 6:121624875-121624897 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1014614813 6:123586729-123586751 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1015217566 6:130767696-130767718 CAGCAGCAATGGATGCAAAAGGG - Intergenic
1015288182 6:131508732-131508754 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1016114293 6:140261859-140261881 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1016248712 6:142017073-142017095 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1017779479 6:157705121-157705143 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1017923050 6:158887858-158887880 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1018077443 6:160229717-160229739 AAGGAGGAATGGAAGGTGGAAGG - Intronic
1018084644 6:160291022-160291044 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1018495555 6:164343191-164343213 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1018521621 6:164656603-164656625 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1018738488 6:166708544-166708566 CAGGAGGAATGGAAGTTGCAAGG - Intronic
1019157313 6:170047962-170047984 CAGAAGGACTGGAGGTTGAAGGG + Intergenic
1019850930 7:3556421-3556443 CAGCAAGTAGGGATGGTTAATGG + Intronic
1020532857 7:9357855-9357877 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1021314057 7:19124306-19124328 AAGCATGAATGGAGGATGAATGG + Intergenic
1021345242 7:19519452-19519474 CAGTAGCAAAGGAAGGTGAAGGG - Intergenic
1021390393 7:20085911-20085933 CAGCATGTCTGGATGCTGAAGGG + Intergenic
1021873915 7:25030943-25030965 AAGCAGGAATGGATATTAAATGG - Intergenic
1022973174 7:35535755-35535777 CTGCAAGAATGCATGATGAAAGG - Intergenic
1023139592 7:37088111-37088133 CAACAGGAATGGATGCTGATTGG + Intronic
1023575509 7:41622210-41622232 AAGCAGGAATGGAGGGAGAAAGG + Intergenic
1023699038 7:42875059-42875081 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1023881217 7:44322758-44322780 CAGCAGAAAAGGATGGGGCAAGG + Intronic
1024016909 7:45325520-45325542 CAGCAGGACTGGAAGGGGGAGGG + Intergenic
1025789867 7:64679615-64679637 GAGGAGGAATGGAGGGTGGAAGG - Intronic
1026182123 7:68050831-68050853 CAACTGCAATCGATGGTGAAGGG + Intergenic
1026336652 7:69399454-69399476 CAGAAGGGATAGATGGGGAAAGG - Intergenic
1029500065 7:100923397-100923419 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1030163768 7:106532885-106532907 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031004527 7:116456781-116456803 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1031296462 7:120010130-120010152 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1031364895 7:120890095-120890117 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031399842 7:121316845-121316867 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1031422611 7:121568466-121568488 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031525446 7:122818179-122818201 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1031728076 7:125263354-125263376 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031776181 7:125911247-125911269 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1032997716 7:137466335-137466357 CAGCAGGAGTGTATGGTAAGTGG + Intronic
1033421002 7:141204493-141204515 CAGCCGGAATCGGAGGTGAACGG + Intronic
1033676101 7:143541675-143541697 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1033695733 7:143787764-143787786 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1033909606 7:146247811-146247833 AAGGAGGAATGGAGGGTGGATGG + Intronic
1034333927 7:150308244-150308266 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1034816135 7:154173606-154173628 GAGCAAGAAGGGATGGGGAACGG - Intronic
1035257195 7:157638204-157638226 CACAAGGAATGGATCTTGAAGGG + Intronic
1035740587 8:1925390-1925412 CAGCAGGAGTTCAAGGTGAAGGG + Exonic
1037824696 8:22154443-22154465 CCGCAGGAAGGGAAGGTGATGGG - Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1038009697 8:23465307-23465329 CAGTAGGGAAGGATGGTGAGAGG - Intergenic
1039347004 8:36716228-36716250 CGAAGGGAATGGATGGTGAATGG - Intergenic
1040499223 8:47992526-47992548 GTGCAGGAATAGATGGGGAATGG + Intergenic
1040647865 8:49420708-49420730 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1041652002 8:60310999-60311021 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1041917686 8:63152786-63152808 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1042340077 8:67669626-67669648 CATCAGGAAGGGAAGGGGAAAGG - Intronic
1042501481 8:69514246-69514268 CAGGAAGCATGGATGGGGAAGGG + Intronic
1042707214 8:71676171-71676193 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1043718042 8:83509580-83509602 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1044541719 8:93415979-93416001 CAGCTAGACTGGATGGAGAATGG + Intergenic
1044906721 8:97012144-97012166 GACCAGGAATAGTTGGTGAATGG + Intronic
1045542436 8:103099710-103099732 CAGCAGGGATGAAGGGAGAAAGG - Intergenic
1045561162 8:103264469-103264491 CAGCAGGGAAGGATGAAGAATGG + Intergenic
1046074748 8:109302071-109302093 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1046439916 8:114242900-114242922 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1046443105 8:114283251-114283273 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1046778135 8:118185738-118185760 CACCAGCCATGGATGGAGAAGGG - Intergenic
1046884983 8:119356473-119356495 CATCAGTAAAGGGTGGTGAAAGG + Intergenic
1047699208 8:127433001-127433023 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1048135331 8:131741972-131741994 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1048617189 8:136089986-136090008 CAGAAGTAATGAATGATGAATGG + Intergenic
1049069518 8:140345825-140345847 GAGCAGGAAGGGATGGGAAACGG + Intronic
1049850686 8:144828539-144828561 CAGCAGGAATAGCATGTGAAAGG - Intronic
1050474010 9:6021209-6021231 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1052191681 9:25670174-25670196 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1052622060 9:30925268-30925290 CAGGAGGAAGGGAGAGTGAAGGG + Intergenic
1053057872 9:35004719-35004741 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1055232914 9:74086926-74086948 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1055809905 9:80138679-80138701 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1056044888 9:82705147-82705169 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1056061017 9:82885042-82885064 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1056091255 9:83208069-83208091 CAGCTCCAATGGATGGAGAAAGG - Intergenic
1056100159 9:83293418-83293440 CAGCTGGCATGGATGGTCAGAGG - Intronic
1056323737 9:85459905-85459927 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1056427125 9:86488542-86488564 CAGCAGGAAGGGGAGCTGAAAGG - Intergenic
1057746664 9:97757750-97757772 CAGCATGAATGGAATATGAATGG + Intergenic
1057812732 9:98270297-98270319 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1058026359 9:100145155-100145177 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1059260914 9:112975757-112975779 AAGCAAGAATGGATTGTGATGGG + Intergenic
1059720219 9:116952694-116952716 CAGCAGGTGTGGATGATGAATGG - Intronic
1059903284 9:118953064-118953086 CAGCAAGCATATATGGTGAATGG + Intergenic
1060225994 9:121791227-121791249 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1061726629 9:132585577-132585599 CAGCAGGCAGGGTCGGTGAATGG + Intronic
1061746853 9:132746409-132746431 CACCAGGAATGCATGGCCAAGGG + Intronic
1185566249 X:1097605-1097627 AAGCAGGAATGGCTGAAGAATGG - Intergenic
1186163865 X:6806070-6806092 CAGTGGGAATGGATGGAGATAGG + Intergenic
1186463485 X:9766128-9766150 CACCAGGAAGGCTTGGTGAATGG - Intronic
1187086671 X:16049123-16049145 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1187103917 X:16221277-16221299 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1188056287 X:25544481-25544503 CAGTAGGAAGGGATGGAGGAAGG - Intergenic
1188062903 X:25622610-25622632 CAGGAGGAAAGGATGGCCAATGG - Intergenic
1188201159 X:27293978-27294000 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1188301215 X:28506881-28506903 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1188532382 X:31156456-31156478 CCTCAGCCATGGATGGTGAAAGG - Intronic
1188552502 X:31378773-31378795 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1189431046 X:40947581-40947603 CGGCAGAAATGGATGGGAAAGGG + Intergenic
1189750652 X:44217723-44217745 CAGCAGGTGGGGATGGTTAATGG + Intronic
1189960344 X:46318585-46318607 CAGAAGGAAGGGATGGAGGAAGG + Intergenic
1190335154 X:49257647-49257669 CACCAGGTATGGACGGTGAATGG - Exonic
1190712440 X:53080434-53080456 GATCAGGAATGGGTGATGAAGGG - Exonic
1191014347 X:55792759-55792781 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1192454439 X:71265434-71265456 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1193885787 X:86983065-86983087 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1194308681 X:92277481-92277503 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1194351144 X:92825761-92825783 AAGGAGGAATGGAAGGTGGAAGG - Intergenic
1194366957 X:93024193-93024215 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1194503133 X:94703269-94703291 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1194792446 X:98167739-98167761 CAGTGGGAGAGGATGGTGAAAGG + Intergenic
1195118442 X:101723799-101723821 CAGAAGGAATGGAAGGTGAGAGG - Intergenic
1195291315 X:103434015-103434037 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1195328833 X:103779980-103780002 CAGCAGCCATGGTAGGTGAATGG + Intronic
1196072936 X:111545177-111545199 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1196221125 X:113113160-113113182 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1196330676 X:114468023-114468045 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1196341865 X:114605752-114605774 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1196584966 X:117418892-117418914 AAGGAGGAATGGAAGGTGGAAGG - Intergenic
1196773998 X:119322198-119322220 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1196992850 X:121347466-121347488 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1197064766 X:122223298-122223320 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1197352206 X:125393301-125393323 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1197932928 X:131713313-131713335 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1198599536 X:138268744-138268766 AAGGAGGAATGGAAGGTGGAAGG + Intergenic
1199523846 X:148769332-148769354 CAGCAGGCATGGAGTGTGAGTGG + Intronic
1199557705 X:149126982-149127004 CAGCAGGTGGGGATGGTGATTGG + Intergenic
1199576332 X:149316936-149316958 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1200675177 Y:6140449-6140471 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1200812663 Y:7501619-7501641 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1201936941 Y:19419842-19419864 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1202076709 Y:21043904-21043926 AAGGAGGAATGGAGGGTGGAAGG + Intergenic