ID: 900339175

View in Genome Browser
Species Human (GRCh38)
Location 1:2179745-2179767
Sequence GCTGCTGGTGGGAGGCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 365}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900339166_900339175 -10 Left 900339166 1:2179732-2179754 CCCCGGGCCCAGGGCTGCTGGTG 0: 1
1: 0
2: 3
3: 49
4: 447
Right 900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 58
4: 365
900339164_900339175 -7 Left 900339164 1:2179729-2179751 CCACCCCGGGCCCAGGGCTGCTG 0: 1
1: 2
2: 5
3: 77
4: 616
Right 900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 58
4: 365
900339156_900339175 21 Left 900339156 1:2179701-2179723 CCTCAGGGCCAGGAGTGGTTTGC 0: 1
1: 1
2: 1
3: 16
4: 201
Right 900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 58
4: 365
900339162_900339175 -3 Left 900339162 1:2179725-2179747 CCTCCCACCCCGGGCCCAGGGCT 0: 1
1: 0
2: 6
3: 101
4: 745
Right 900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 58
4: 365
900339163_900339175 -6 Left 900339163 1:2179728-2179750 CCCACCCCGGGCCCAGGGCTGCT 0: 1
1: 1
2: 4
3: 46
4: 486
Right 900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 58
4: 365
900339157_900339175 13 Left 900339157 1:2179709-2179731 CCAGGAGTGGTTTGCTCCTCCCA 0: 1
1: 0
2: 4
3: 37
4: 302
Right 900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 58
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900339175 Original CRISPR GCTGCTGGTGGGAGGCCCCA GGG Intronic
900117448 1:1034606-1034628 CCTGCTGGTGCGAGGCTTCATGG + Intronic
900127287 1:1074164-1074186 GCTGCTGGTGGCCGGCCCCGGGG - Exonic
900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG + Intronic
900569406 1:3351017-3351039 GCTGCTGGTTGGCGGCCCTCTGG + Intronic
900611475 1:3546388-3546410 GGTGTTGGTGGGAGGCACCTTGG - Intronic
900701909 1:4053772-4053794 GCTTCTGGTGGCAGGCACCCGGG - Intergenic
901005923 1:6171455-6171477 GCTTCTGGTGGGTGGCCCTGAGG + Intronic
901020710 1:6253951-6253973 GCTGCTGGTGGGCGGCAGCGTGG - Exonic
901447043 1:9314858-9314880 GCAGCCAGTGGGAGGCTCCAGGG + Intronic
901488126 1:9579567-9579589 GCTCCTGGAGGGTGGCCCCCGGG - Intronic
901686795 1:10947761-10947783 CCTGCTGGAGTGAGGCCCCCCGG + Exonic
901916904 1:12507066-12507088 GCTTCTGGTGGGAGGGGCCGGGG - Exonic
902359075 1:15932208-15932230 GCAGCTGGTGGTGGACCCCAAGG + Exonic
902361535 1:15944873-15944895 GCAGCCGGTGGGAGGCCGGAGGG + Intronic
902843752 1:19093185-19093207 GAAGCGGTTGGGAGGCCCCAAGG + Intronic
902957476 1:19935334-19935356 GCTGCTGCAGGTGGGCCCCAGGG - Intergenic
903165469 1:21517491-21517513 CATGGGGGTGGGAGGCCCCAGGG + Intronic
903684108 1:25118766-25118788 GATGCTCGTGGGAGGCCTCCTGG + Intergenic
904455138 1:30642962-30642984 GTTGCTGGGGGGCAGCCCCACGG - Intergenic
904655390 1:32041963-32041985 TCTGCTGGTGGAGGGCCCCATGG + Intronic
905106442 1:35565979-35566001 CCTGCAGGAGGGAGGCTCCAGGG + Exonic
905347542 1:37321341-37321363 TCAGCTGGTGTGAGGCTCCAGGG - Intergenic
905849148 1:41260003-41260025 GCGGATGTTGGGAGGCCACACGG + Intergenic
906380284 1:45327997-45328019 GCTGCTGGTAGTATGCCCCAGGG - Exonic
906797550 1:48710128-48710150 GCTGCTTGTGAGAGGCCCTGTGG - Intronic
907892133 1:58646630-58646652 GGTCCTGGTGGGAGGCCCCAGGG + Intergenic
908746324 1:67380075-67380097 GCTGCTGGTGAAAGTTCCCACGG + Exonic
909083714 1:71147010-71147032 GCTGCAGGGGTGAGCCCCCATGG + Intergenic
909805850 1:79873489-79873511 TCTGCCTGTGGGTGGCCCCAGGG + Intergenic
910937099 1:92493359-92493381 GCTGCAGGAGGTAGGCCTCAAGG + Intergenic
911087707 1:93992954-93992976 GCTGCTAGTGGGATGGCCCGGGG + Exonic
913168511 1:116211309-116211331 TCTGGTGGTGGGAGGTCACATGG - Intergenic
914249088 1:145907128-145907150 GATGCTGGTGGGCGCCCCCTGGG - Exonic
915166568 1:153951382-153951404 GGTGGTGGGGGGAGGCCCCAGGG + Exonic
917498448 1:175564231-175564253 GCAGCAGGAGGGAGGCCCCAGGG - Intronic
917646182 1:177030869-177030891 GCTGGTGGTTGGAGTCCACAGGG + Exonic
919371908 1:196738880-196738902 GCTGCAGGGGGGAGCCCACATGG - Intronic
920547370 1:206829599-206829621 CCTGCTACTGGGAGGCCCCAGGG + Intronic
920642169 1:207763179-207763201 GCTGGAGGTGGGAGGCCGGACGG - Intronic
921196140 1:212759907-212759929 CTTGCTGCTGGGTGGCCCCAGGG - Intronic
922253491 1:223871389-223871411 GCTGCGGGAGGGAGGTCCCCTGG + Intergenic
922903550 1:229156895-229156917 GGAGCTGGTGGGAGGCCGGAAGG - Intergenic
924200881 1:241657296-241657318 GCTGCTGCTAGGAGGCCAGATGG - Intronic
1063099138 10:2934610-2934632 GTTGCAGGTGGGTGGCCCCAGGG - Intergenic
1063369517 10:5512100-5512122 GCTGCGGGTCGCAGGCTCCAGGG - Intergenic
1064060071 10:12129764-12129786 GCTGCTGCTGGGGAGGCCCAGGG - Exonic
1064667686 10:17673612-17673634 GCTGCTGAAGGCAGGGCCCAGGG - Intronic
1065750282 10:28879795-28879817 GCCTCTGATTGGAGGCCCCATGG - Intronic
1067090716 10:43264735-43264757 GCTGCTGGGGGTAGGTGCCAGGG - Intronic
1067217753 10:44316745-44316767 GAGGGTGGTGGGAGGGCCCAGGG - Intergenic
1067764661 10:49075828-49075850 GCTTCTGGTGGGTGGCACCAAGG + Intronic
1068707692 10:60094997-60095019 ACAGCTGGAGAGAGGCCCCAAGG + Intronic
1070601722 10:77870816-77870838 ACTGTAGGTGGGAGGCCCCTGGG + Intronic
1070657834 10:78283377-78283399 GCTGCAGGTGGGAGGCCTGCAGG + Intergenic
1071124564 10:82319210-82319232 GCTGCTGTGGGGAGTCCCCTTGG + Intronic
1071522538 10:86340107-86340129 GCAGCAGTTGGGAGGCTCCAGGG + Intronic
1072741372 10:97911990-97912012 GCTGGTTGTGGGAGACACCACGG + Intronic
1073116703 10:101095504-101095526 GAGGCTGTTGGGTGGCCCCAGGG + Intronic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1074188275 10:111115238-111115260 GCTACTGATGGGAGTCCACATGG - Intergenic
1075075167 10:119345739-119345761 GCTGCTGCTGGGTTTCCCCAAGG - Intronic
1075702701 10:124479405-124479427 ACATCTGGTGGCAGGCCCCACGG + Intronic
1076113433 10:127878886-127878908 GCTGCTGGGGAGAGGTCCCAGGG + Intronic
1076469068 10:130705968-130705990 GCTGCTGCAGGGAGTCCCCCAGG + Intergenic
1076634648 10:131874260-131874282 GCTGGGGGTGGGAGGGCCCAGGG + Intergenic
1076669588 10:132112186-132112208 GATGTTGGTGTGAGGCTCCACGG - Intronic
1076730859 10:132438268-132438290 GCTGCAGGAGGGAGGCCCTGTGG - Intergenic
1076745200 10:132509515-132509537 GCTGCTGGTGCCAGTGCCCAGGG + Intergenic
1076803400 10:132843471-132843493 GCTGCTGGTGGGCGTTCCCAGGG + Intronic
1076803409 10:132843506-132843528 GCTGCTGGTGGGCGTTCCCAGGG + Intronic
1076803461 10:132843689-132843711 GCTGCTGGTGGGTGTTCCCAGGG + Intronic
1076803469 10:132843724-132843746 GCTCCTGGTGGGTGTTCCCAGGG + Intronic
1076803580 10:132844127-132844149 GCTCCTGGTGGGTGTTCCCAGGG + Intronic
1076803600 10:132844199-132844221 GCTCCTGGTGGGTGTTCCCAGGG + Intronic
1078241569 11:9535261-9535283 CCTGCTGGTGGTGGACCCCAAGG - Intergenic
1078559064 11:12354984-12355006 GCTGCTGGTGGGAGGCAGGCTGG - Intronic
1078950528 11:16127770-16127792 GCTGTTTGAGGGAGACCCCATGG - Intronic
1079209728 11:18450259-18450281 GCTTCTGATGGGAGGTTCCAGGG + Intronic
1079210689 11:18458138-18458160 GCTTCTGATGGGAGGTTCCAGGG + Intronic
1079370702 11:19849587-19849609 GCAGCTGTTGGGAGGGCTCAAGG - Intronic
1079380503 11:19933596-19933618 GCTGCTGGAAGCAGGGCCCACGG - Exonic
1079710970 11:23681015-23681037 GCTGCTGCAGGGAGGGCACAGGG - Intergenic
1081576788 11:44323741-44323763 GTTGATGGTGGGAGGACACAGGG - Intergenic
1083158905 11:60842562-60842584 GCTGATGCTGGGGGGCCCCCGGG - Exonic
1083842941 11:65315088-65315110 GATGCGGGTGGGAAGCCCCATGG - Intronic
1084207530 11:67604666-67604688 TGTGAGGGTGGGAGGCCCCAAGG + Exonic
1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG + Intronic
1084423153 11:69070815-69070837 GCTGCTGGTGGGAGATCCCTGGG - Intronic
1084965305 11:72741430-72741452 GCTGGTGGTGGGAGCGCCCCAGG - Intronic
1085038037 11:73311202-73311224 GCTGCTGGATGGAGGCAGCATGG - Exonic
1086166587 11:83786753-83786775 CCTGCTCGTGGGATGCACCACGG + Exonic
1086555432 11:88104923-88104945 GCTGCTTCTGGGAGACTCCATGG + Intergenic
1088089496 11:106021861-106021883 GCTGCTGGTAGGAGTCCCGGTGG + Exonic
1091800487 12:3321652-3321674 GCTGCTGGTGAGAGGCAGCAGGG + Intergenic
1092918130 12:13206617-13206639 GCTGCTGCCGCCAGGCCCCATGG + Intronic
1094230982 12:28103112-28103134 GCTGCTTCTGGGAGGCCTCAGGG + Intergenic
1094689556 12:32755526-32755548 CGCGCTGGTGGGAGGCGCCACGG - Exonic
1094841695 12:34345043-34345065 GCTCCTCGTGGTACGCCCCAAGG - Intergenic
1095495667 12:42781072-42781094 GCTGCTGCTGGCAGGCCCTGCGG - Intergenic
1095967557 12:47879177-47879199 GCTGGGGGTGGGTGGCACCAAGG - Intronic
1096113400 12:49041568-49041590 GCTGCTGCAGGCAGGCCCCATGG + Intronic
1096526897 12:52215402-52215424 GGTGGTGGTGGCTGGCCCCAGGG + Intergenic
1096637716 12:52971658-52971680 GCTGATGGTGGGAGGGTCCCAGG + Intergenic
1096701119 12:53383419-53383441 GCTGCTGCTGGTCTGCCCCAAGG - Exonic
1096846805 12:54411936-54411958 TGTGCTGGTGGGAGCACCCAAGG - Exonic
1096976650 12:55703156-55703178 GCTGCTGGTGGGTGCTCCCCAGG - Exonic
1097188436 12:57208248-57208270 GCTGGTGGTAGGAAGCCCCCGGG + Intronic
1101653234 12:106696224-106696246 GCTTCTGTTGGGAGGGCCCTGGG + Intronic
1103483104 12:121264000-121264022 GCTGCAGGTGGGATGCCAAAAGG + Intronic
1103561911 12:121797335-121797357 GCTGCTGGCGCTGGGCCCCAGGG - Intronic
1104936451 12:132366832-132366854 GCTCCTGGTGGCAGGCCCCGGGG + Intergenic
1105897187 13:24726345-24726367 GCTGCTGGGTGCCGGCCCCAGGG - Intergenic
1108624189 13:52211236-52211258 CCTGCTGGTGAGAGGCGCCCAGG - Intergenic
1108661863 13:52595187-52595209 CCTGCTGGTGAGAGGCGCCCAGG + Intergenic
1108683998 13:52803270-52803292 GGTGCTGGTGGCTGGCACCAGGG + Intergenic
1111843098 13:93473783-93473805 GCTGCTGTGGGGAGGACACAGGG - Intronic
1112932978 13:104764167-104764189 TCTGATGGTTGAAGGCCCCAAGG + Intergenic
1113418165 13:110147432-110147454 GTTGCTGGTGGAAGGCAGCATGG + Intergenic
1114268444 14:21087117-21087139 GGTGCTGGGGGGTGGCCCCCAGG + Intronic
1114674411 14:24430889-24430911 GCTGCAGCTGGAGGGCCCCAAGG + Exonic
1117438497 14:55740003-55740025 CCTCCTTGTGGGAGGCCCCAGGG - Intergenic
1119392094 14:74297841-74297863 ACTGCTGGTGGCAGACACCAAGG - Intronic
1119406664 14:74403280-74403302 GCTGCATGAGGGAGGCCCCAAGG + Intergenic
1121226111 14:92323136-92323158 GCAGCGGGCGGGAGGCGCCACGG + Intronic
1121473497 14:94174382-94174404 CCTGCTGGTGGGCGGCCGCGGGG + Exonic
1121602705 14:95217936-95217958 GCAGGTGGTCCGAGGCCCCAAGG + Intronic
1122235685 14:100329659-100329681 GCTGCTGGTGGGTGGGCCGCTGG - Exonic
1122707292 14:103629267-103629289 GCTGCTGGTGCGAGGAGCCGCGG + Intronic
1122774664 14:104111870-104111892 GCTGCTAGTCAGTGGCCCCAAGG + Intronic
1122861783 14:104585882-104585904 GGTGCTGGTGGGGCGCCCCTGGG - Intronic
1202839781 14_GL000009v2_random:111097-111119 GCTGTTGGTGGGAGGCAGGAGGG - Intergenic
1202909159 14_GL000194v1_random:101237-101259 GCTGTTGGTGGGAGGCAGGAGGG - Intergenic
1125600767 15:40914820-40914842 GCTGCAGGAGAGAGGTCCCATGG - Intergenic
1127578408 15:60314601-60314623 TCTGCTTCTGGGAGGCCTCAGGG - Intergenic
1127734661 15:61829717-61829739 GCTGATGGTGGCAGGCTTCATGG - Intergenic
1128478381 15:68016628-68016650 TCTGCTCCTGGGAGGCCTCAGGG - Intergenic
1129373026 15:75109805-75109827 GCTGCTGCTGGCTGGCCACAAGG - Intronic
1129673784 15:77621598-77621620 GGTGCTAGGGTGAGGCCCCAGGG + Intronic
1130276052 15:82476887-82476909 GCAGCTTGTGGGAGACCACAAGG - Intergenic
1130776732 15:86992075-86992097 GCTTCTGGTGAGAGGCCTCAAGG + Intronic
1130871515 15:87975802-87975824 GCTGCTAGTGAGAAGACCCAAGG - Intronic
1131390849 15:92047826-92047848 GCTGGTGGTGGGAGGACCTGAGG - Intronic
1131442069 15:92466914-92466936 GCTGGTGTTGGGTGGCCCCAGGG + Exonic
1132150725 15:99456200-99456222 GCAGCTGGTGGCAGCTCCCAAGG - Intergenic
1132483385 16:177441-177463 GGGGCTGGGGGGAGGCCCAAGGG - Exonic
1132596935 16:756465-756487 GCTGCTGGTGGGAGTGCAAATGG - Intronic
1134687680 16:16169988-16170010 GCTTCTGGTGGGAGGCACAGCGG - Intronic
1135888097 16:26331692-26331714 GCTGCTGGTGGGATGCTAAATGG + Intergenic
1136248083 16:28986397-28986419 GCGTCCGGTGGGAGCCCCCAAGG - Exonic
1138531244 16:57635492-57635514 GCAGGTGGTGGCATGCCCCAGGG + Intronic
1138556212 16:57772576-57772598 GCTGCCGTTGGGTGGGCCCAGGG - Intronic
1139549799 16:67666919-67666941 GCTGCTTGGGGCGGGCCCCAAGG - Exonic
1139840339 16:69873472-69873494 GCTGCAGGTGGGGAGTCCCAGGG + Intronic
1140507362 16:75482215-75482237 GCTGGTGGTTGGAGGCCAGAGGG - Intronic
1141548134 16:84786130-84786152 GCTGGTGGGGGGAGGCCCACAGG - Intergenic
1141625446 16:85258986-85259008 GCTTCTTCTGGGAGGCCCCCAGG + Intergenic
1141896734 16:86963200-86963222 GCTGCAGGGGTGAAGCCCCACGG + Intergenic
1143018522 17:3904415-3904437 GCTGCTGGTCCCAGGCCCCTTGG + Intronic
1143064070 17:4229731-4229753 GCTGCTGGCAGGAGGCCACAAGG + Intronic
1143189775 17:5033008-5033030 GATGCTGGTGGGAGGGAACATGG + Exonic
1144626039 17:16844937-16844959 GCTGCGGGTGGGAGGCAGAAAGG - Intergenic
1144880395 17:18427783-18427805 GCTGCGGGTGGGAGGCAGAAAGG + Intergenic
1145151840 17:20516604-20516626 GCTGCGGGTGGGAGGCAGAAAGG - Intergenic
1145978052 17:28995755-28995777 GCTGGTGGTGGTGGGACCCAGGG + Intronic
1145981484 17:29014856-29014878 GCTGCTGGTGGAGACCCCCATGG - Intronic
1146371865 17:32269624-32269646 GCTGCTGGCCTGATGCCCCAAGG + Intronic
1146376461 17:32298125-32298147 GCTGCTGGTGGGGGTGCCCCTGG + Exonic
1146964174 17:37010801-37010823 GCCTCTGGTGTGAGGGCCCACGG + Intronic
1147720419 17:42536386-42536408 GCTGCTGGGGCCAGGCCCCGCGG + Exonic
1148674653 17:49438425-49438447 GCTGCTGGAGGGACGCTGCAGGG + Intronic
1151668241 17:75557774-75557796 GCTGTTGGTGATAGGCCCCCTGG + Intronic
1152014915 17:77744292-77744314 GCTGAGAGAGGGAGGCCCCAGGG - Intergenic
1152117184 17:78395584-78395606 GCTGCTAGGGAGAGGCCCCCTGG + Intronic
1152465623 17:80464563-80464585 GCTGCAGCTGGGGTGCCCCATGG + Intergenic
1152999619 18:442400-442422 GGAGCTGTTGGGAGGCCCAAGGG + Intronic
1154095964 18:11414845-11414867 GCTGGAGGTGGGAGAACCCATGG - Intergenic
1154274703 18:12948528-12948550 GCTGACGGTGGGATGCCCCTGGG - Intronic
1155449667 18:25950568-25950590 TCTGCTTCTGGGAGGCCTCAGGG + Intergenic
1156112394 18:33744217-33744239 GCTGCTGGTGCAAAGCCCCCTGG - Exonic
1157409185 18:47449374-47449396 GCTGCTGCTGTGGGGCCTCAAGG + Intergenic
1157590403 18:48833276-48833298 GCTGCAGGCGGGAGGCCTCGTGG + Intronic
1157595529 18:48861485-48861507 GCTGCTCAGGGCAGGCCCCAGGG + Exonic
1160029729 18:75248912-75248934 GCTGCTGGTGGGTGACCCTATGG - Intronic
1160233553 18:77067647-77067669 GCTGCTGGTGGGTAGCACCAGGG - Intronic
1160936748 19:1599698-1599720 GCTGCTGGTGCCAGCCCTCAGGG - Intronic
1161222892 19:3126169-3126191 GCTGCTGCTGGGAGGACAGACGG + Intergenic
1161312060 19:3600256-3600278 GCTGCTGCTGGGGGCCGCCATGG - Exonic
1161824367 19:6552207-6552229 GCTGCTGCAGGGAGGGCCCAGGG - Intergenic
1162019477 19:7862141-7862163 GCCGCTGGAAGGAGTCCCCACGG + Exonic
1162519802 19:11173160-11173182 GCTGCTAGTGGACTGCCCCAAGG + Intronic
1163186994 19:15645783-15645805 GCTGCTGGTGGGTGGGGCCCTGG + Exonic
1163217795 19:15893795-15893817 GCTGCTGGTGGGTGGGGCCCTGG - Intronic
1163237026 19:16035832-16035854 GCTGTTGGTGCTTGGCCCCATGG - Intergenic
1163472594 19:17506025-17506047 GCTGCTGGAGGGAGGACAGACGG - Exonic
1163587920 19:18173883-18173905 GCTGCTGCTGGACGTCCCCACGG + Exonic
1163634153 19:18430743-18430765 TCTGCAGGTGGCCGGCCCCATGG - Intronic
1163747482 19:19056939-19056961 GCTGGTGGTGGGAGCCACCCTGG + Intronic
1163768052 19:19174302-19174324 GCTTCTGTTTGGATGCCCCATGG + Intronic
1164596784 19:29535491-29535513 GCTGCTGCTGGGTGCCCACACGG + Intronic
1165642636 19:37403196-37403218 GCTGCTGTGAGGAAGCCCCAGGG - Intergenic
1165788196 19:38474925-38474947 GCTGCTGGGCGGGGGCCCCAGGG + Intronic
1166288893 19:41849137-41849159 GCAGCTGGAGGGAGGTGCCAGGG - Exonic
1166523280 19:43495429-43495451 GGAGGTGGTGGGATGCCCCAGGG + Intronic
1166837587 19:45677050-45677072 GGTGCTCGTGGGAGGCTCCGAGG + Exonic
1167175434 19:47860991-47861013 GCTGCTGGGAGGACTCCCCAGGG - Intergenic
1167323096 19:48808133-48808155 CTTGCTGGTGTGAGGCTCCAGGG + Intronic
1167374339 19:49103074-49103096 GCAGCTGGTGGGAGGGAGCATGG + Intronic
1168344811 19:55644986-55645008 GCGGGTGGTGGGCGGCCCCACGG + Exonic
1202652607 1_KI270707v1_random:20569-20591 GCTGTTGGTGGGAGGCAAGAGGG - Intergenic
925665653 2:6252631-6252653 GCTGAGGGTGAGAGGCCCTAGGG - Intergenic
926725445 2:15993945-15993967 ACTTCTGCTGGGAGCCCCCAAGG + Intergenic
926906282 2:17808513-17808535 GCTTCTGGTGGGAGTTCGCAAGG - Intergenic
927237259 2:20885551-20885573 GGTGCTGGTGAAAGGCCCCTAGG + Intergenic
927256354 2:21043867-21043889 GCTGCTGCTGGCGGGCGCCAGGG - Exonic
927711555 2:25329220-25329242 ACTGCTGGAGGCAGGGCCCATGG - Intronic
927981579 2:27378110-27378132 GGTGCCAGTGGGGGGCCCCAGGG - Exonic
928363907 2:30687262-30687284 GCTGCTGGTGAGAGCCCTCTGGG + Intergenic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
929410698 2:41695265-41695287 GCAGGTGCTGGGAGGCTCCATGG + Intergenic
932768842 2:74489337-74489359 GCAGCTGGGGGAAGGCCCCAAGG + Intronic
933727936 2:85437061-85437083 CCTGCACGAGGGAGGCCCCACGG + Intergenic
936278995 2:111122018-111122040 GCTGCTGGTGGAGGGCCCGACGG + Intronic
937249961 2:120517392-120517414 ACAGCTGGTGGGAGGCAGCATGG - Intergenic
937308474 2:120886760-120886782 GCACCTGGTGGGTGGACCCAGGG + Intronic
938059411 2:128240377-128240399 GCTCCTGGTGGGATGACCCTGGG - Intronic
938104804 2:128522541-128522563 TCTGCTGGTGGGAGGGCACACGG - Intergenic
940204349 2:151186186-151186208 GCTGCTGAACGGTGGCCCCATGG - Intergenic
940536465 2:154951514-154951536 CCTGCTAGTTGGATGCCCCAGGG + Intergenic
943090609 2:183370128-183370150 GCAGCTTGTGGGAGGCCCAGAGG + Intergenic
945603464 2:211896015-211896037 CCTACTGTTGGTAGGCCCCAAGG + Intronic
946404111 2:219483682-219483704 GCTGCTGCGGGGAGGCCCCGAGG + Exonic
947909406 2:233791479-233791501 GTTGCCTGTGGGAGCCCCCAGGG + Intronic
948421015 2:237859883-237859905 GTTCCAGGCGGGAGGCCCCAGGG + Intronic
948479263 2:238239990-238240012 GCTGCTGCTGGGCGGCCGCGGGG - Exonic
948574833 2:238943034-238943056 GCATCTGGTGGGAGGAGCCAGGG + Intergenic
948641316 2:239377624-239377646 GGTGCGGGCAGGAGGCCCCAGGG + Intronic
1169209772 20:3759510-3759532 GCTCTTGGTGGGAGGGCCTAGGG - Intronic
1169642194 20:7765405-7765427 CCTGCTTGTGGGAGTCCTCAAGG - Intergenic
1169970232 20:11261821-11261843 CCTGCTGGTGGGAAACCCCAGGG + Intergenic
1170527987 20:17260323-17260345 GCAGCTGGAGAGAGACCCCAGGG + Exonic
1171249535 20:23637742-23637764 GCGCCTAGTGGGAGGCCCCATGG - Exonic
1171393746 20:24817671-24817693 GCTGCTGGTTGGAGTCACCTGGG - Intergenic
1171460366 20:25294573-25294595 TCTGCTGGTTGGAGGTCCCAGGG + Intronic
1171485335 20:25481728-25481750 GCTGAAGGTGGGCAGCCCCAGGG - Intronic
1173324305 20:42018638-42018660 TCTGCAGGTGCAAGGCCCCAGGG - Intergenic
1173872738 20:46351983-46352005 GCTGCTGGTGAGAAACCCCTGGG + Intronic
1174452580 20:50629137-50629159 GCTGCTGGGGCCAGGTCCCAGGG + Intronic
1175339586 20:58219755-58219777 GCTGCTGGGGGGAGGTGTCATGG - Intronic
1175778706 20:61668881-61668903 GGTGCTGGTGGAAGGCACCCGGG - Intronic
1175851734 20:62097448-62097470 ACCCCTGGTGGGAGGACCCAAGG - Intergenic
1175996767 20:62815445-62815467 GCTGGTGCTGGGAGCCCCTAAGG + Intergenic
1176028625 20:62999387-62999409 CCTGCTGGAGAGAGTCCCCACGG - Intergenic
1176082023 20:63278279-63278301 ACTGCACATGGGAGGCCCCAAGG - Intronic
1176599544 21:8779085-8779107 GCTGTTGGTGGGAGGCAAGAAGG + Intergenic
1176628513 21:9115950-9115972 GCTGTTGGTGGGAGGCAGGAGGG - Intergenic
1178752310 21:35316663-35316685 GCTGCTGCTGTAATGCCCCATGG - Intronic
1179450367 21:41464456-41464478 GCTGCTGGTCAGAGGACCAAAGG - Intergenic
1179481101 21:41679188-41679210 TCTGCTGGTGGGAAGGCCGATGG + Intergenic
1179481494 21:41681543-41681565 GCAGCTGGGAGGAGGCTCCACGG + Intergenic
1179618452 21:42596824-42596846 GCTCCTGGAGGGTGGCCCCTGGG - Intergenic
1179829421 21:43987223-43987245 TCTGAAGGTGGGTGGCCCCATGG - Intergenic
1179904181 21:44413681-44413703 GATGCAGGTAGGAGGCCCCGGGG - Intronic
1180378631 22:12117496-12117518 GCTGTTGGTGGGAGGCAGGAGGG + Intergenic
1180418891 22:12795821-12795843 GCTGTTGGTGGGAGGCAAGAGGG - Intergenic
1180817302 22:18798998-18799020 GCTGCTGGCAGGAGGCCTCATGG - Intergenic
1181167504 22:20991555-20991577 CCTGCTGTGGGGAGGCCCCGAGG + Intronic
1181187923 22:21119596-21119618 GCTGCTGGTGGGAGGTCTTTGGG - Intergenic
1181203492 22:21233319-21233341 GCTGCTGGCAGGAGGCCTCATGG - Intergenic
1181211275 22:21290897-21290919 GCTGCTGGTGGGAGGTCTTTGGG + Intergenic
1181500967 22:23315360-23315382 GCTGCTGGTGGGAGGTCTTTGGG - Intronic
1181592362 22:23893346-23893368 CCTCCAGCTGGGAGGCCCCATGG - Intronic
1181766299 22:25094583-25094605 GCTGCTGGAGGAAGGCCCGGGGG - Intronic
1182556915 22:31134237-31134259 ACAGCTGGTGGGAAGGCCCAGGG - Exonic
1183744517 22:39685273-39685295 GCTGCAGGTGGGGGGCCCCGGGG + Intronic
1184036188 22:41919479-41919501 GGTTCTGGAGGGAGGGCCCACGG + Intergenic
1184257150 22:43293883-43293905 GCTGCAGATGGGCGGCGCCAGGG - Intronic
1184333586 22:43840683-43840705 GCTGCTGATGGGAAGGCCCGAGG - Intronic
1184410221 22:44322023-44322045 GGTGCTGGTGTGGGGCCTCAGGG - Intergenic
1184458897 22:44626132-44626154 GCTGTGGGAGGGAGGCCCCCAGG - Intergenic
1184674358 22:46032372-46032394 CCTGATGGTGGGAGGCTGCAGGG + Intergenic
1185021543 22:48379596-48379618 GCTGCTGCTGGGAGCTCCCTCGG + Intergenic
1185098783 22:48826462-48826484 GCTGTTGGTGGGAGGCTCCTGGG - Intronic
1203215674 22_KI270731v1_random:4534-4556 GCTGCTGGTGGGAGGTCTTTGGG - Intergenic
1203223429 22_KI270731v1_random:62095-62117 GCTGCTGGCAGGAGGCCTCATGG + Intergenic
1203267401 22_KI270734v1_random:24725-24747 GCTGCTGGCAGGAGGCCTCATGG - Intergenic
1203274952 22_KI270734v1_random:80857-80879 GCTGCTGGTGGGAGGTCTTTGGG + Intergenic
950421224 3:12901019-12901041 GCTGCTGGTGGGGGGCGGCGGGG + Intronic
950854190 3:16090068-16090090 GCTGCTGGTGGAAGGCTCTGAGG - Intergenic
951521988 3:23619028-23619050 GCTGGTCCTGGAAGGCCCCAGGG + Intergenic
952090418 3:29878262-29878284 GCTACTGGTTTGCGGCCCCAGGG + Intronic
952224693 3:31363221-31363243 ACTGCTCCTGAGAGGCCCCATGG - Intergenic
953820785 3:46205873-46205895 GCTGGTGGTGTCAGGCCTCAGGG - Intronic
953906159 3:46869186-46869208 GCTGCTGGTGGGAGAGTACAGGG - Intronic
954146117 3:48635141-48635163 GCCGCTGGTGTGACGCCCGAGGG - Intronic
954879477 3:53823783-53823805 GCTGCTGGAGGCCGGGCCCAAGG - Exonic
961329143 3:126128679-126128701 GCTGCTGGGACCAGGCCCCAGGG + Intronic
962312706 3:134337463-134337485 TCTCCTGGAGTGAGGCCCCAGGG + Intergenic
962578758 3:136778404-136778426 GATGCTGGTGGGAGTCCTCATGG - Intergenic
964462622 3:156952207-156952229 GCTGCTGATGGGATGGCCCCAGG + Intronic
965674489 3:171180308-171180330 AGTGCTGGGGGGAGGTCCCAGGG - Intronic
966980763 3:185133213-185133235 GTTGCTGGTGGGAGGGCAAATGG + Intronic
967108677 3:186273816-186273838 GCTGCTGCAGGGAGGCCCGCTGG - Intronic
967399029 3:189040431-189040453 GCTGCTGGTGGTATTCCCCATGG + Intronic
968460342 4:721628-721650 GCTGCTGAACGCAGGCCCCAGGG + Intronic
968619370 4:1596978-1597000 GATGCTGGAGGGAGGCCCCGAGG - Intergenic
968805742 4:2771002-2771024 GCTGGTGAAGGGAGGCCCCAGGG + Intergenic
969608091 4:8212214-8212236 GCTGGAGGTGGGTGCCCCCATGG + Intronic
971972085 4:33633885-33633907 GGGCCTGGTGGGAGGCCCCATGG + Intergenic
972333213 4:38082248-38082270 GCTGCTGGTGGGAAGTCCCTGGG + Intronic
973362896 4:49181456-49181478 GCTGTTGGTGGGAGGCAAGAGGG + Intergenic
973398203 4:49615398-49615420 GCTGTTGGTGGGAGGCAAGAGGG - Intergenic
975900124 4:79141413-79141435 GATGCTGGTGGGAGGCACTTGGG + Intergenic
978763212 4:112377903-112377925 GGTTCTGATGGGAGGCACCAGGG + Intronic
981135529 4:141206915-141206937 GCTGCTGGTGCAAGTCCCAAAGG + Intronic
981588705 4:146332609-146332631 TCTGCTTCTGGGAGGCCTCAGGG - Intronic
984784048 4:183552234-183552256 GTTTCTGGTGGCAGGACCCAGGG - Intergenic
1202760249 4_GL000008v2_random:102963-102985 GCTGTTGGTGGGAGGCAGGAGGG + Intergenic
985558166 5:568307-568329 GGTGCAGATAGGAGGCCCCAGGG - Intergenic
986233269 5:5885821-5885843 GGTGCCGGTGGGATGGCCCAGGG + Intergenic
986456520 5:7926349-7926371 GCTGCTGGTGGAATGCCCCCTGG + Intergenic
988722500 5:33892320-33892342 GCTGCGAGTGAGAGGCCCCCAGG + Intergenic
990134819 5:52632329-52632351 GTTGCTGGAGGGAGGCCATATGG - Intergenic
990325359 5:54670404-54670426 GCTGCTCCTGGGAACCCCCAGGG + Intergenic
991622527 5:68559559-68559581 GCTGCTGGTGGTTTGACCCATGG + Intergenic
994733721 5:103525571-103525593 GCTGGAGGTCAGAGGCCCCATGG + Intergenic
998174158 5:139891142-139891164 GCCGCTGGTGGGAGGAAGCAGGG + Intronic
999204647 5:149839433-149839455 GCTGCAGGTGGGTGGCACCTGGG + Intronic
999621695 5:153480650-153480672 GCTGCTGGTGGGACTTCCCCTGG + Intergenic
999723783 5:154418258-154418280 GATGATGGTGGGAGGTTCCAGGG - Exonic
1001649438 5:173304952-173304974 GCTGCGGGTGGCAGACCCCTCGG + Intergenic
1001752785 5:174144352-174144374 GCTGCTGGCAAGAGGCCTCAGGG + Intronic
1002006510 5:176238711-176238733 GCTGCAGCTGTGAGGCGCCAGGG - Intronic
1002051450 5:176573926-176573948 GCTGCGGGTGGAAGGCACCTGGG - Intronic
1002219868 5:177671925-177671947 GCTGCAGCTGTGAGGCGCCAGGG + Intergenic
1002424225 5:179166222-179166244 GCTGCTGTGGGAGGGCCCCAGGG - Intronic
1003256844 6:4482553-4482575 GATGCTGCTGGGAGGCGCCGGGG + Intergenic
1004521223 6:16362570-16362592 GCTGCTGGTGGGAAGAGCCGTGG - Intronic
1006255404 6:32828845-32828867 GCTGATGGACTGAGGCCCCAGGG - Intronic
1006459891 6:34152237-34152259 TCTGCCGGTGGGAGGTCCCGGGG - Intronic
1006516189 6:34546984-34547006 GCTGCGGGGGGGGGTCCCCAGGG - Intronic
1006738773 6:36292970-36292992 GCTGGTGGTGGGTGGCCCAGGGG + Intronic
1007321953 6:41034041-41034063 GCTTCAGGAAGGAGGCCCCATGG + Exonic
1007375024 6:41450730-41450752 GGGCCTGGTGGGAGGGCCCAGGG + Intergenic
1007679191 6:43622761-43622783 CCAGCTGGTGGTGGGCCCCACGG - Exonic
1007851642 6:44808559-44808581 GCTGCTGAGCTGAGGCCCCAAGG + Intergenic
1008134061 6:47752793-47752815 GCTGGTGGTGTGAAGCCACAGGG - Intergenic
1011565191 6:88665811-88665833 CCTCCTGCTGGGACGCCCCATGG + Intronic
1013111188 6:107066677-107066699 GCTGGAGGCGGGAGGTCCCATGG - Exonic
1013491009 6:110646396-110646418 GCTGCTGGCGGGCGGCGACATGG + Intronic
1014386994 6:120815568-120815590 GCTCCTGGTGGGAGCCCCTCTGG - Intergenic
1018975088 6:168558448-168558470 GCTGCTGCTGGGAGCCTCCCTGG + Intronic
1019338933 7:499141-499163 CCTGCTGGTGACAGACCCCATGG - Intronic
1019483013 7:1274971-1274993 CCGGCTGGGGAGAGGCCCCAGGG + Intergenic
1019597844 7:1866584-1866606 GCTGCTGGTGTGAGACGCCACGG + Intronic
1019737710 7:2658865-2658887 GCTGCAGGTCGGGGGGCCCATGG - Intronic
1021800852 7:24305005-24305027 GCTGGTGGTGTGAGGCCCATGGG + Intergenic
1022140920 7:27492300-27492322 GCTGATGCTGGGGGGCCCCCTGG + Intergenic
1022691985 7:32665082-32665104 GCTCCAGGAGGGAGGCCCCAGGG + Intergenic
1022919650 7:34999635-34999657 GCTCCAGGAGGGAGGCCCCAGGG + Intronic
1025095331 7:56091824-56091846 TCTGCTGGTGCCAGGCCCCTGGG + Intronic
1029283039 7:99449016-99449038 CCTGCTGGAAGGAGTCCCCAGGG + Intronic
1029536891 7:101162622-101162644 GGGGCTCGTGGGAGGCCCGAAGG + Exonic
1029543104 7:101196150-101196172 GCTGCTGGTGGCCGTCCCCCCGG + Intronic
1031426846 7:121615625-121615647 TCTTCTGTTTGGAGGCCCCAGGG - Intergenic
1031882960 7:127217605-127217627 GCTGAAGGTGGGGGCCCCCAGGG - Intronic
1032402520 7:131633698-131633720 GCTGCTGGCACGAAGCCCCAGGG - Intergenic
1032457904 7:132087536-132087558 GCTGGAGGTGGGAAGCCCCCTGG - Intergenic
1033305008 7:140218800-140218822 GCTGCTGGTATGAGGCTCCCTGG + Intergenic
1034219444 7:149432663-149432685 GCTGCTGGCTCGAGGCCCCGCGG + Exonic
1034346482 7:150388447-150388469 GCTGATGCTGGGAGGCCTCCAGG + Exonic
1034962940 7:155373842-155373864 GCTGCCGGTGTGAGCCCCGAAGG + Intergenic
1035580334 8:735982-736004 CCTGCTTGTGGGAGAACCCAGGG + Intronic
1035763795 8:2088992-2089014 GTTTGTGGTGGGAGCCCCCAGGG - Intronic
1036107298 8:5854775-5854797 GCTATTGGTGGGAATCCCCAAGG - Intergenic
1036286683 8:7449067-7449089 GCTGCAGGTGAGAACCCCCAGGG - Intronic
1036334795 8:7862456-7862478 GCTGCAGGTGAGAACCCCCAGGG + Intronic
1037273639 8:17156255-17156277 GCTGCTGGGCGCAGGCCCCCGGG - Exonic
1037833358 8:22201738-22201760 GCTGAGGTTGGGATGCCCCAGGG - Intronic
1039846705 8:41330562-41330584 GCTGCTGAAGGCAGGCCCCAGGG - Intergenic
1039894170 8:41704636-41704658 GATGCTTGTGGGAGACCCAAGGG + Intronic
1040098594 8:43475358-43475380 TCTGCTTCTGGGAGGCCTCAGGG - Intergenic
1042004748 8:64168725-64168747 GCTGCTGTAGGGAGGGCACAGGG + Intergenic
1048428263 8:134342669-134342691 GCTGCTGATTGGTGTCCCCAGGG - Intergenic
1049006387 8:139858365-139858387 GCAGCTGGGCGGAGGCCCCGGGG - Intronic
1049278705 8:141733069-141733091 TCGGCTGGTGGGAAGCCCCAGGG + Intergenic
1049379910 8:142306936-142306958 GGTGCTGGAGGGAGGCCCCGGGG - Intronic
1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG + Exonic
1049752006 8:144289385-144289407 GCTGCTGGTGGGTGGCTGGAGGG - Intronic
1049801114 8:144517917-144517939 GCTGCTTGTCCGAGGCCCGACGG - Intergenic
1049828259 8:144684573-144684595 GCTGCTGGTGGGAAGCGGCTCGG + Intergenic
1050074349 9:1847956-1847978 ACTGCAGGTGAGTGGCCCCATGG + Intergenic
1050861591 9:10439767-10439789 GATGGTGGTGGGAGGAGCCAAGG + Intronic
1051486068 9:17609504-17609526 GCTGCAGGGAGGTGGCCCCACGG - Intronic
1051677293 9:19571149-19571171 GCAGCAGGAGGCAGGCCCCAAGG - Intronic
1056793186 9:89639407-89639429 GCTGCTGGCGTGCGGCCCCGGGG - Intergenic
1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG + Intergenic
1060529900 9:124341994-124342016 GCTGCTGGTGTGTGTCCCCCAGG + Intronic
1060818560 9:126648733-126648755 GCTGCCCGTTGGAGGCACCAGGG + Intronic
1060884432 9:127140519-127140541 TCTGTTGGTGGAAGACCCCAGGG - Intronic
1060969454 9:127730010-127730032 GCTGCTCCTCAGAGGCCCCAAGG + Intronic
1061028559 9:128066451-128066473 GCTGCTCTTGGAAGGCCTCATGG + Intronic
1061628937 9:131859360-131859382 GCTGCAGGTGGGATGCCACGTGG + Intergenic
1061733243 9:132633264-132633286 GCTGCTGGTGGGAATCCCTATGG + Intronic
1061774016 9:132948658-132948680 GCTTCTGCTGGCAGCCCCCAAGG + Intronic
1062318065 9:135978000-135978022 GCTGCTGGTGGGGGGGTCTAGGG - Intergenic
1062330943 9:136044731-136044753 GCTGCTGGTGGGAGCGGCCTCGG + Intronic
1062449785 9:136610586-136610608 CCTGCTGGTAGGAGGCCTCGGGG + Intergenic
1062581529 9:137231127-137231149 GGTCCAGGTGGGGGGCCCCAGGG + Intronic
1062582562 9:137234986-137235008 GATGCTGGGGGCAGGCCCCCAGG - Intronic
1203731370 Un_GL000216v2:94419-94441 GCTGATGGTGGAAGAACCCACGG - Intergenic
1203751358 Un_GL000218v1:83629-83651 GCTGTTGGTGGGAGGCAGGAGGG - Intergenic
1203482629 Un_GL000224v1:20725-20747 GCTGTTGGTGGGAGGCAGGAGGG + Intergenic
1203541025 Un_KI270743v1:87857-87879 GCTGTTGGTGGGAGGCAGGAGGG + Intergenic
1187392327 X:18894305-18894327 GCTGCTGGTGGAAGCCATCATGG - Exonic
1189021761 X:37349162-37349184 GCTTCTGCTGGGAAGACCCAGGG - Intergenic
1190461091 X:50676211-50676233 GTGGCTGATGGGAGGCCCTAGGG + Intronic
1192885020 X:75327857-75327879 GGTGCAGGTGGGAGCCCCCGAGG - Intergenic
1196604703 X:117643687-117643709 GGAGCTGGTGGGAGGCCCTTAGG + Intergenic
1198458257 X:136838469-136838491 GCTGCTGGTGTGAGTCCCAAAGG + Intergenic
1200700925 Y:6401876-6401898 GCTGCTGTTGGGGGGCACTATGG + Intergenic
1200766723 Y:7086369-7086391 GTTGCTGGTGGCAGGCCCGGTGG - Exonic
1201033187 Y:9762822-9762844 GCTGCTGTTGGGGGGCACTATGG - Intergenic
1201165016 Y:11201242-11201264 GCTGTTGGTGGGAGGCAGGAGGG - Intergenic
1202175733 Y:22097333-22097355 GCTGCTGTTGGGGGGCACTATGG + Intergenic
1202215628 Y:22489050-22489072 GCTGCTGTTGGGGGGCACTATGG - Intergenic