ID: 900339986

View in Genome Browser
Species Human (GRCh38)
Location 1:2183737-2183759
Sequence CCACGTGTCCACATGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900339971_900339986 28 Left 900339971 1:2183686-2183708 CCAAGATGGCGCCCAAACACTGC 0: 1
1: 0
2: 1
3: 16
4: 539
Right 900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG 0: 1
1: 0
2: 2
3: 57
4: 188
900339980_900339986 2 Left 900339980 1:2183712-2183734 CCCCGGAGGAGAGAGGGGAGGAA 0: 1
1: 0
2: 8
3: 65
4: 596
Right 900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG 0: 1
1: 0
2: 2
3: 57
4: 188
900339982_900339986 0 Left 900339982 1:2183714-2183736 CCGGAGGAGAGAGGGGAGGAAGG 0: 1
1: 1
2: 8
3: 114
4: 879
Right 900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG 0: 1
1: 0
2: 2
3: 57
4: 188
900339974_900339986 16 Left 900339974 1:2183698-2183720 CCAAACACTGCATTCCCCGGAGG 0: 1
1: 0
2: 1
3: 4
4: 102
Right 900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG 0: 1
1: 0
2: 2
3: 57
4: 188
900339973_900339986 17 Left 900339973 1:2183697-2183719 CCCAAACACTGCATTCCCCGGAG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG 0: 1
1: 0
2: 2
3: 57
4: 188
900339981_900339986 1 Left 900339981 1:2183713-2183735 CCCGGAGGAGAGAGGGGAGGAAG 0: 1
1: 0
2: 17
3: 166
4: 985
Right 900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG 0: 1
1: 0
2: 2
3: 57
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900339986 Original CRISPR CCACGTGTCCACATGGCAGA AGG Intronic
900318004 1:2069022-2069044 CCACGTGTCCCCGTGGCAGCCGG - Intronic
900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG + Intronic
900909840 1:5587244-5587266 CCACATCCTCACATGGCAGAAGG - Intergenic
902379559 1:16046270-16046292 TCACGAGCCCACTTGGCAGATGG + Intronic
902436771 1:16403146-16403168 CCACGTGTCTCCAGGGCAGGTGG - Intronic
903489277 1:23715734-23715756 CCACATGACCACATGGATGATGG - Intergenic
907708131 1:56850481-56850503 CCAGGTGGCAACATGGTAGAGGG - Intergenic
908512301 1:64859121-64859143 CTACCTGTCCACAAGGCAGCCGG + Intronic
908584817 1:65556141-65556163 CCATGTCTTCACATGGCAGAAGG - Intronic
908714683 1:67056433-67056455 CCATGTCCTCACATGGCAGAAGG + Intergenic
909301700 1:74020878-74020900 CTATGTCTTCACATGGCAGAAGG + Intergenic
910100549 1:83570856-83570878 CTATGTCTTCACATGGCAGAAGG + Intergenic
910191082 1:84596513-84596535 CCACATCCTCACATGGCAGAAGG + Intergenic
910584750 1:88866768-88866790 CCATGTGTCCACATTACAAAGGG + Intronic
912414033 1:109496064-109496086 CCACCAGTCCACATGTCAGATGG - Exonic
916970813 1:170013067-170013089 CCATGTCCTCACATGGCAGAAGG - Intronic
920989355 1:210921956-210921978 ATACGTGTTCACATGACAGAGGG - Intronic
921364510 1:214360987-214361009 GCACGTCTTCACATGGCAGCAGG - Intronic
923895067 1:238260582-238260604 CCGGGTCTGCACATGGCAGAAGG - Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
1063728876 10:8672496-8672518 CTATGTTTTCACATGGCAGAAGG + Intergenic
1064086164 10:12348535-12348557 CCTGGTGTCCACCTGTCAGAGGG - Intergenic
1067524484 10:47029854-47029876 CCATGTGAGGACATGGCAGAAGG - Intergenic
1069490466 10:68856477-68856499 CCTCGTGCCCACGTGGGAGACGG - Intronic
1069903000 10:71716585-71716607 CCTCTTGTCTGCATGGCAGATGG - Intronic
1070256320 10:74815735-74815757 CTACGTCCTCACATGGCAGACGG + Intergenic
1070578844 10:77703404-77703426 CTGTGTGACCACATGGCAGAAGG - Intergenic
1073758438 10:106605817-106605839 CCACTTTTTCACTTGGCAGAAGG - Intronic
1076425865 10:130367206-130367228 CCACCTCATCACATGGCAGAGGG - Intergenic
1077217158 11:1399711-1399733 CCCCATGTCCACCCGGCAGAAGG - Intronic
1077260030 11:1612460-1612482 CCAATTGCCCACATGGCACAGGG - Intergenic
1079144665 11:17840062-17840084 CCAGGTGACCACATGTCAGGTGG - Intronic
1080225758 11:29958085-29958107 CCAGGAGTCAACATGGCAGAAGG - Intergenic
1081783619 11:45731006-45731028 CTATGTCTTCACATGGCAGAAGG + Intergenic
1081797182 11:45828793-45828815 CCATGAGCCCACATAGCAGAGGG - Intergenic
1083411916 11:62499722-62499744 CTACGTGGCCTCATGCCAGAAGG - Intronic
1085992560 11:81867908-81867930 GCACGTCTCCACATGGAGGAAGG + Intergenic
1088511578 11:110580895-110580917 CTGGGTGTGCACATGGCAGATGG + Exonic
1090307015 11:125699881-125699903 AAACATGTCCACTTGGCAGAGGG + Intergenic
1091475680 12:769840-769862 CCACGTGCTCACATGGCAGAGGG + Intronic
1092001555 12:5036799-5036821 ACATGTTACCACATGGCAGAAGG + Intergenic
1092395091 12:8118914-8118936 CCATGTCTTCACATGGCAGAAGG - Intergenic
1093021613 12:14209176-14209198 CCACATCCTCACATGGCAGAAGG + Intergenic
1102061073 12:109931551-109931573 CCACTTTTCCACATGGCAACAGG + Exonic
1102861923 12:116343543-116343565 CAAGCTGTCCATATGGCAGATGG - Intergenic
1107447643 13:40482761-40482783 GCACGTCTTCACATGGCAGCAGG + Intergenic
1111969218 13:94893337-94893359 CCACGTGGCCACATGGAATCAGG - Intergenic
1116307373 14:43275317-43275339 CCACATGTCCACATGGGAAGTGG + Intergenic
1117464537 14:55979222-55979244 GCACATCTCCAAATGGCAGATGG - Intergenic
1120015657 14:79470430-79470452 CCATGTTTTCACATGGCAGAAGG + Intronic
1123188175 14:106540087-106540109 TCACGTGTCCACCAGACAGAGGG - Intergenic
1123469580 15:20540289-20540311 CAATGTCTCCTCATGGCAGAAGG + Intronic
1123472231 15:20563789-20563811 CAATGTATCCTCATGGCAGAAGG - Intergenic
1123645771 15:22436564-22436586 CAATGTATCCTCATGGCAGAAGG + Intergenic
1123648482 15:22460410-22460432 CAATGTCTCCTCATGGCAGAAGG - Intronic
1123667081 15:22616441-22616463 CAATGTGTCCTCACGGCAGAAGG + Intergenic
1123729858 15:23135275-23135297 CAATGTCTCCTCATGGCAGAAGG + Intronic
1123732536 15:23158780-23158802 CAATGTATCCTCATGGCAGAAGG - Intergenic
1123748028 15:23332757-23332779 CAATGTCTCCTCATGGCAGAAGG + Intergenic
1123750670 15:23356162-23356184 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124280393 15:28356609-28356631 CAATGTCTCCTCATGGCAGAAGG + Intergenic
1124283040 15:28380078-28380100 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124299659 15:28531535-28531557 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124302305 15:28555003-28555025 CAATGTCTCCTCATGGCAGAAGG - Intergenic
1124320923 15:28711009-28711031 CAATGTGTCCTCACGGCAGAAGG + Intronic
1124481571 15:30084346-30084368 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124488028 15:30136442-30136464 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124522020 15:30412848-30412870 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124536645 15:30553370-30553392 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124543117 15:30605419-30605441 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124563068 15:30792861-30792883 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1124627977 15:31320316-31320338 TCATGTGTACACATGGCACAGGG - Intergenic
1124755499 15:32401879-32401901 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124762008 15:32454222-32454244 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124776621 15:32594846-32594868 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124960222 15:34388338-34388360 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124976851 15:34534559-34534581 CAATGTGTCCTCATGGCAGAAGG + Intronic
1125477873 15:40059823-40059845 CGAGGTGTCCACTAGGCAGACGG + Intergenic
1127752186 15:62056879-62056901 TCACGTGTCCACAGGACAGGGGG - Intronic
1128214189 15:65922932-65922954 GCACGTGTCCACCTGGCCGCTGG - Exonic
1128444868 15:67750283-67750305 CCAAGTTTCCACAAGGAAGATGG - Intronic
1129036972 15:72656089-72656111 CAATGTGTCCTCATGGCAGAAGG - Intronic
1129153368 15:73702917-73702939 CAACGTGACCACGTCGCAGATGG + Exonic
1129153681 15:73704321-73704343 CAACGTGACCACGTCGCAGATGG + Exonic
1129212915 15:74081136-74081158 CAATGTGTCCTCATGGCAGAAGG + Intronic
1129397487 15:75259950-75259972 CAATGTGTCCTCATGGCAGAAGG - Intronic
1129401096 15:75284227-75284249 CAATGTGTCCTCATGGCAGAAGG - Intronic
1129474696 15:75776935-75776957 CTATGTGTCCTCATGGCAGAAGG - Intergenic
1129730052 15:77925452-77925474 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1129838465 15:78728535-78728557 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1130260117 15:82348036-82348058 CAATGTGTCCTCATGGCAGAAGG + Intronic
1130268613 15:82431397-82431419 CAATGTGTCCTCATGGCAGAAGG - Intronic
1130281115 15:82520972-82520994 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1130472486 15:84237152-84237174 CAATGTGTCCTCATGGCAGAAGG - Intronic
1130479978 15:84351723-84351745 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1130484207 15:84389303-84389325 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1130491792 15:84436406-84436428 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1130503407 15:84515446-84515468 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1130594783 15:85241789-85241811 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1131481774 15:92788483-92788505 GCACGTCTTCACATGGCAGTAGG - Intronic
1132206900 15:99992689-99992711 CCAAGTGTCCCCATGGCAGGAGG + Intronic
1132433765 15:101780655-101780677 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1137309376 16:47239046-47239068 CCACGTCCTCACATGGCAGAAGG - Intronic
1137388731 16:48063923-48063945 GCACGTCTTCACATGGCAGCAGG - Intergenic
1137681447 16:50349469-50349491 GCACGTCTTCACATGGCAGCAGG - Intronic
1138009480 16:53364065-53364087 CAATGTATCCTCATGGCAGAAGG + Intergenic
1140079807 16:71735237-71735259 CCTCCTCTCCACATGACAGAAGG + Intronic
1140771142 16:78205332-78205354 CCACGTATCCATATGTCAGTTGG + Intronic
1140908898 16:79433686-79433708 CCAGGTGTGCTCATGGCAGTCGG - Intergenic
1142346541 16:89557627-89557649 GCACCAGTCCACATGGCAGCAGG - Exonic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1144141649 17:12355304-12355326 TCACGTCTTCACATGGCAGCAGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151143203 17:72015178-72015200 CAAATTGTCCACATGACAGAGGG + Intergenic
1151533771 17:74725459-74725481 CGAGGTGTCCACATGGCCAAAGG - Intronic
1152292476 17:79448000-79448022 GCACGTCTTCACATGGCAGCAGG - Intronic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1152485217 17:80586618-80586640 CCACAGGCCCCCATGGCAGAGGG - Intronic
1152810776 17:82381454-82381476 CCATGTGTGCACATGACACAGGG - Intergenic
1152810788 17:82381562-82381584 CCACGTGTACACATGACACAGGG - Intergenic
1152810795 17:82381618-82381640 CCACGTGTACACATGACACAGGG - Intergenic
1152810802 17:82381674-82381696 CCACGTGTGCACATGACACAGGG - Intergenic
1152810809 17:82381730-82381752 CCACATGTGCACATGACACAGGG - Intergenic
1152810814 17:82381784-82381806 CCATGTGTGCACATGACACAGGG - Intergenic
1155413562 18:25571807-25571829 CCAAGGCTGCACATGGCAGAGGG + Intergenic
1158327614 18:56327947-56327969 CCAAGTGTCCACATTCCACATGG - Intergenic
1159434359 18:68396407-68396429 CCATGTGTACACATGGCTTATGG + Intergenic
1160448946 18:78948894-78948916 CCGCGTGTCCACGTGACAGTGGG - Intergenic
1160553178 18:79708478-79708500 CCACGTCCCCACGTGGCACACGG - Intronic
1161047310 19:2142622-2142644 CCACGTGGCCGCCTGGCTGAGGG + Intronic
1161237066 19:3203587-3203609 CCCAGTGTCCACAGGGCCGAGGG + Intronic
1162046203 19:8002071-8002093 TCAGGTGTCCACTGGGCAGAGGG - Intronic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1163075631 19:14888626-14888648 TCACGTGTCCACCGGACAGAGGG + Intergenic
1164148856 19:22531856-22531878 CCATGCGTCCTCACGGCAGAAGG + Intronic
1164155911 19:22596880-22596902 CAATGAGTCCTCATGGCAGAAGG - Intergenic
1165915772 19:39258491-39258513 TCACGTGTCCACATGACAGGGGG + Intergenic
1166706880 19:44913008-44913030 CCACGTGTCAGCCTGGCAGTAGG - Intergenic
1167970268 19:53184873-53184895 TCACGTGTCCACTGGACAGAGGG + Intronic
1168411768 19:56144708-56144730 CCCCTTGACCACAAGGCAGAGGG - Intronic
925009532 2:471611-471633 CCTGGTGTCTACAAGGCAGAAGG + Intergenic
925496091 2:4450907-4450929 CCAGGTCCTCACATGGCAGAAGG - Intergenic
927431855 2:23033261-23033283 CTATGTCTTCACATGGCAGAAGG + Intergenic
927622673 2:24678073-24678095 ACACATGGACACATGGCAGAGGG - Intronic
928687840 2:33767790-33767812 CCACTAGACCACATGGAAGAGGG - Intergenic
932857778 2:75255614-75255636 CCATGTCCTCACATGGCAGAAGG - Intergenic
935429520 2:102960159-102960181 CTATGTCTTCACATGGCAGAAGG + Intergenic
937594501 2:123657633-123657655 CCATGTGCTCACATGGCAGTAGG + Intergenic
938802146 2:134773504-134773526 CCACATGGCCACATGGCCCAGGG - Intergenic
943370876 2:187014173-187014195 CTACGTCCTCACATGGCAGAAGG - Intergenic
944223578 2:197326648-197326670 CCATGTCCTCACATGGCAGAAGG - Intergenic
944495379 2:200302593-200302615 CTTAGTTTCCACATGGCAGATGG + Intergenic
947069819 2:226276182-226276204 CTACGTCCTCACATGGCAGAAGG + Intergenic
947231279 2:227889363-227889385 CTGCGTCTTCACATGGCAGAGGG + Intronic
949017553 2:241722000-241722022 CCAGCTGTCCACCTGGCACAGGG - Intronic
1169331398 20:4719302-4719324 CTGTGTGCCCACATGGCAGAAGG + Intergenic
1169797595 20:9481386-9481408 TCACGTGTCCACCTGGCAATTGG + Intergenic
1170957045 20:20991160-20991182 CCGCGTCCTCACATGGCAGAAGG + Intergenic
1171564913 20:26172856-26172878 CCTGGTGGCCTCATGGCAGAGGG - Intergenic
1172049282 20:32104014-32104036 TCACATGTCCACAGGTCAGATGG - Intergenic
1172278687 20:33695254-33695276 CCACCTGACCACATAGCAGCGGG - Intergenic
1172876876 20:38169771-38169793 CAGCGTGTCCACTTTGCAGATGG + Intergenic
1174385650 20:50187236-50187258 CCACGTGGCCACATGGTGGTGGG - Intergenic
1175252276 20:57616773-57616795 TCAGGTGTCCTCAGGGCAGAGGG + Intronic
1175287069 20:57844158-57844180 CCATGTGTTCACCTGGCACATGG + Intergenic
1175486986 20:59353745-59353767 CCACGTGTCCATATGCCAGCTGG - Intergenic
1175863508 20:62162759-62162781 CCACGTGTCCATGCAGCAGACGG + Exonic
1177155103 21:17493602-17493624 CCAGGTGTTCACGTGGCAGGTGG - Intergenic
1179608618 21:42534338-42534360 CCACCTGTCCACAAGGAAGAAGG - Intronic
1180187944 21:46149686-46149708 CCAGGTGTCCACAAGACAAAAGG + Intronic
1180707161 22:17817026-17817048 CCACTCGTGCACAGGGCAGAGGG - Intronic
1180841429 22:18960635-18960657 CCCTGTGTGCAGATGGCAGATGG - Intergenic
1181060067 22:20278159-20278181 CCCTGTGTGCAGATGGCAGATGG + Intronic
1182471525 22:30551349-30551371 CCATGTTTCCACATTGCACAGGG + Intergenic
1183124060 22:35758140-35758162 CCACCTGTTTACATGGAAGATGG - Intronic
950407762 3:12815415-12815437 CCACCTGTCCACGTAGCATATGG - Exonic
950415774 3:12868459-12868481 CCACGTGTCCACTGGACAGGGGG - Intronic
953124119 3:40075417-40075439 CCACCTGTCCTGATGGGAGAAGG + Intronic
953557696 3:43959892-43959914 GAACGTGTCTACAGGGCAGAGGG - Intergenic
954273588 3:49527942-49527964 ACACGAGCTCACATGGCAGAGGG - Intronic
959569318 3:107866400-107866422 CTGCGTCTTCACATGGCAGAAGG - Intergenic
962008104 3:131368523-131368545 CCACATAGCTACATGGCAGATGG + Intergenic
964972794 3:162581897-162581919 CGACTTCTCCACATGGCAGCAGG - Intergenic
967989146 3:195118495-195118517 CCAGGTGTGGACATGGCAGAAGG + Intronic
969271045 4:6102463-6102485 CCATGTCCTCACATGGCAGAAGG - Intronic
970441641 4:16085175-16085197 GCACATCTTCACATGGCAGAAGG - Intergenic
970858793 4:20678298-20678320 CTGTGTGTTCACATGGCAGAAGG + Intergenic
971414675 4:26413255-26413277 CCAGGTGTCCACATGGCTTTAGG + Intronic
976392675 4:84521981-84522003 CCATCTGTCCACAAGGCAGTAGG + Intergenic
976870237 4:89783674-89783696 CCATATTTCCCCATGGCAGAAGG + Intronic
981193053 4:141885945-141885967 GCACGTCTTCACATGGCAGCAGG - Intergenic
982446559 4:155497495-155497517 CCTTGTGTCCACATGGTGGAAGG + Intergenic
982527490 4:156497752-156497774 CCAGGTCTTCAGATGGCAGAAGG + Intergenic
984983196 4:185302628-185302650 CCACATCCTCACATGGCAGAAGG - Intronic
987918885 5:24252142-24252164 CCTTGTCTCCACAGGGCAGAAGG + Intergenic
991214020 5:64140965-64140987 CTACATCTTCACATGGCAGAAGG + Intergenic
993861925 5:93146701-93146723 CCACGTCATAACATGGCAGAAGG + Intergenic
995290773 5:110450098-110450120 GCACGTTTTCACATGGCAGCAGG - Intronic
996728816 5:126697564-126697586 TGCTGTGTCCACATGGCAGAAGG + Intergenic
1000151641 5:158507882-158507904 CCATGTTCTCACATGGCAGAAGG + Intergenic
1003567754 6:7234953-7234975 CCACATGTCCACATTGCAGAAGG + Intronic
1003903169 6:10674120-10674142 TCATGTCTTCACATGGCAGAGGG + Intronic
1004791102 6:19027424-19027446 CTACATGTTCACATGGCAGAAGG - Intergenic
1007237514 6:40401395-40401417 CCAAGGGTCCAGCTGGCAGAAGG - Intronic
1007365197 6:41386519-41386541 CCATGTTTCCAAATGGCAGTTGG - Intergenic
1009763122 6:68034770-68034792 CCATGTCCTCACATGGCAGAAGG - Intergenic
1009845172 6:69125497-69125519 CCCTGTCTTCACATGGCAGAAGG - Intronic
1013610910 6:111794111-111794133 CCGGGTGTCCTCATGGCGGATGG - Intronic
1016062682 6:139646748-139646770 CCACATTCCCACATGGCTGAAGG - Intergenic
1018768274 6:166951124-166951146 TCACGTGTCCACTGGACAGAGGG + Intronic
1018870664 6:167779891-167779913 CCACGTCCTCACATGGCAGGAGG + Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019611097 7:1937082-1937104 GCACCTGTCCACAGGGCACAGGG - Intronic
1021367738 7:19801667-19801689 CCATGTCCTCACATGGCAGAAGG - Intergenic
1021687971 7:23206050-23206072 CCCCGTGTCTGCAGGGCAGAGGG - Intergenic
1022452076 7:30524876-30524898 CAATGTGTCCTCATGGCAGAAGG + Intronic
1023677614 7:42646933-42646955 CCATGTCTTCCCATGGCAGAAGG - Intergenic
1023834261 7:44059191-44059213 CCACGTCACCACATAGCACATGG + Intronic
1031673899 7:124586055-124586077 CTACGTCACAACATGGCAGAAGG - Intergenic
1036985925 8:13531069-13531091 CCATGTCTTCACCTGGCAGAGGG - Intergenic
1038087884 8:24220313-24220335 CAAAGTGTAGACATGGCAGAGGG - Intergenic
1040638095 8:49299419-49299441 AGTTGTGTCCACATGGCAGAAGG + Intergenic
1042058566 8:64792335-64792357 CCACCTATCCAGATTGCAGAAGG + Intronic
1045903082 8:107308555-107308577 CCTGGTGTCCACCTGGCAGAAGG - Intronic
1046016923 8:108616155-108616177 CCAAGAGTGCTCATGGCAGAGGG + Intronic
1049342039 8:142118380-142118402 GCAGGTGGCCACATGCCAGATGG + Intergenic
1049364170 8:142228678-142228700 CCAGTGGTGCACATGGCAGAGGG - Intronic
1050041291 9:1496535-1496557 CCACGTCCACTCATGGCAGAAGG - Intergenic
1052782268 9:32793762-32793784 CTATGTCTTCACATGGCAGAAGG - Intergenic
1054878905 9:70124516-70124538 CCTCATCTCAACATGGCAGAAGG - Intronic
1057691654 9:97291542-97291564 CCATGGGTCCACATAGCAGTTGG - Intergenic
1060474819 9:123978803-123978825 CCACTTGTCCAATTGGCAGATGG + Intergenic
1060476543 9:123991320-123991342 CCACTTGTCCAATTGGCAGATGG - Intergenic
1060967761 9:127721189-127721211 CCAGGTGTCCCCAGGGCAGGGGG + Intronic
1061065353 9:128274644-128274666 CAATGTATCCACATGGCAGAAGG + Intronic
1061274997 9:129564879-129564901 CCATGTGTCATGATGGCAGATGG + Intergenic
1186069299 X:5801005-5801027 TCACAGTTCCACATGGCAGAAGG + Intergenic
1187271872 X:17787553-17787575 CCTCGAGTCCAGATTGCAGAGGG - Intergenic
1189268362 X:39733462-39733484 ACCCATGTCTACATGGCAGATGG - Intergenic
1189433384 X:40969514-40969536 CCACTTTTCTGCATGGCAGATGG - Intergenic
1189494600 X:41497840-41497862 GCACGTCTTCACATGGCAGCAGG + Intergenic
1190164027 X:48056713-48056735 CCATGTCCTCACATGGCAGAAGG - Intronic
1199324264 X:146478048-146478070 GCACCTGTGCACATGGCAGCAGG + Intergenic
1201587553 Y:15577517-15577539 TCACAGTTCCACATGGCAGAGGG - Intergenic
1202366525 Y:24169498-24169520 CAATGTGTCTTCATGGCAGAAGG - Intergenic
1202373873 Y:24215990-24216012 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1202496908 Y:25454130-25454152 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1202504257 Y:25500625-25500647 CAATGTGTCTTCATGGCAGAAGG + Intergenic