ID: 900343135

View in Genome Browser
Species Human (GRCh38)
Location 1:2198006-2198028
Sequence ACTTGAGGACAGGCAGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 341}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900343135_900343143 17 Left 900343135 1:2198006-2198028 CCTTGTCCTGCCTGTCCTCAAGT 0: 1
1: 1
2: 2
3: 32
4: 341
Right 900343143 1:2198046-2198068 GGTGCTGGTGATGGTGATGGTGG 0: 3
1: 240
2: 1761
3: 6697
4: 11433
900343135_900343140 2 Left 900343135 1:2198006-2198028 CCTTGTCCTGCCTGTCCTCAAGT 0: 1
1: 1
2: 2
3: 32
4: 341
Right 900343140 1:2198031-2198053 TCAGCATGACACAGCGGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 97
900343135_900343144 20 Left 900343135 1:2198006-2198028 CCTTGTCCTGCCTGTCCTCAAGT 0: 1
1: 1
2: 2
3: 32
4: 341
Right 900343144 1:2198049-2198071 GCTGGTGATGGTGATGGTGGAGG 0: 4
1: 221
2: 1829
3: 6877
4: 12135
900343135_900343142 14 Left 900343135 1:2198006-2198028 CCTTGTCCTGCCTGTCCTCAAGT 0: 1
1: 1
2: 2
3: 32
4: 341
Right 900343142 1:2198043-2198065 AGCGGTGCTGGTGATGGTGATGG 0: 1
1: 0
2: 27
3: 520
4: 3249
900343135_900343141 8 Left 900343135 1:2198006-2198028 CCTTGTCCTGCCTGTCCTCAAGT 0: 1
1: 1
2: 2
3: 32
4: 341
Right 900343141 1:2198037-2198059 TGACACAGCGGTGCTGGTGATGG 0: 1
1: 0
2: 0
3: 13
4: 169
900343135_900343139 -4 Left 900343135 1:2198006-2198028 CCTTGTCCTGCCTGTCCTCAAGT 0: 1
1: 1
2: 2
3: 32
4: 341
Right 900343139 1:2198025-2198047 AAGTTATCAGCATGACACAGCGG 0: 1
1: 0
2: 2
3: 25
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900343135 Original CRISPR ACTTGAGGACAGGCAGGACA AGG (reversed) Intronic
900203678 1:1422048-1422070 ACCTGGGGCCAGGCAGGAGAAGG + Intergenic
900320873 1:2082994-2083016 ACATGAGGAGAGGGAGGACGGGG - Intronic
900343135 1:2198006-2198028 ACTTGAGGACAGGCAGGACAAGG - Intronic
900926006 1:5706420-5706442 TGTTGGGGACAGGCAGGAAAAGG - Intergenic
901643528 1:10704926-10704948 GCCTGAGGAAAGGCAGGACATGG + Intronic
903330519 1:22594754-22594776 ACTTGAGGCCACACAGTACATGG - Intronic
903511431 1:23878279-23878301 ACTTGAGCCCAGGGAGGCCAAGG + Intronic
903933913 1:26881648-26881670 ACTTGAGCCCAGGGAGGTCAAGG + Intronic
904895304 1:33812873-33812895 ACTTCAGGAAAGGCAGAAAAAGG - Intronic
905831580 1:41073356-41073378 TCTTGAGGACAGTCAGAAGAGGG - Intronic
905943024 1:41879103-41879125 ACTTGAGAACAGGCAGGCACTGG - Intronic
906193824 1:43916381-43916403 ACTTGATGACCAGCAGCACAAGG + Intronic
906229944 1:44153504-44153526 ACCTGGGGACAGGGAGGAAATGG - Intergenic
906460012 1:46029810-46029832 GCCTGTGGACAGGGAGGACATGG - Exonic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
908076820 1:60528957-60528979 ACTTAAGAACAGGCTGGGCATGG + Intergenic
908358626 1:63346191-63346213 ACTTGAGGGAAGGAAGGAAATGG + Intergenic
909620599 1:77662633-77662655 ATTTGAGGCCAGGCCGGACATGG + Intronic
909944194 1:81645097-81645119 ACATGAGTACAGGCTGGGCATGG + Intronic
910907753 1:92199462-92199484 ACTTGAGCCCAGGGAGGTCAAGG - Intergenic
911172376 1:94783341-94783363 ACTAGAGGAGAGGAAGGACCAGG - Intergenic
913103060 1:115587339-115587361 ACCTGAGCACTGGGAGGACAGGG + Intergenic
915139737 1:153759879-153759901 AGGTGAGGAGAAGCAGGACATGG - Intronic
916419158 1:164620108-164620130 ACTTGAGCCCAGGGAGGTCAAGG + Intronic
916479686 1:165203791-165203813 GCTTTAGGACAGGGAGGCCAGGG - Exonic
917141784 1:171842073-171842095 ACTGGAGGACAGGGAGGAAATGG - Intronic
919680336 1:200428120-200428142 ACTTGAGCCCAGGGAGGTCAAGG + Intergenic
920194446 1:204217557-204217579 TCTTGAAGACAGGCACGACAGGG - Intergenic
1063033613 10:2261828-2261850 ATCAGAGGACAGGCAGGGCATGG - Intergenic
1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG + Intergenic
1067080046 10:43207635-43207657 ACTCCAGGACAGGGAGGTCATGG + Intronic
1067224047 10:44363861-44363883 GCTTCAGGACAGGCCTGACATGG - Intergenic
1067350196 10:45468603-45468625 ACGTGAAGACAGGCTGGATAAGG + Intronic
1067645952 10:48103082-48103104 GCTGGAAGACAGGCAGGAGAAGG + Intergenic
1067741497 10:48898932-48898954 AATAGTGGAAAGGCAGGACACGG - Intronic
1067824788 10:49562910-49562932 ACTTGAGCCCAGGGAGGTCAAGG + Intergenic
1069413192 10:68173955-68173977 ACTTGATGATAGGCGGGGCATGG - Intronic
1069494416 10:68890037-68890059 ACTTGAGACCAGGGAGGCCAAGG - Intronic
1069560394 10:69425248-69425270 AGTGGAGGACAGGGAGGATATGG - Intergenic
1069811346 10:71162257-71162279 ACTAGAGAACAGTCAGGACTTGG - Intergenic
1070524165 10:77280817-77280839 AGTTGAGGACAGGCAGGACATGG - Intronic
1071197828 10:83181968-83181990 ACTTAAACACAGGCAGGCCATGG + Intergenic
1072303509 10:94085180-94085202 ACATGAGGACAGGCAGGATTTGG + Intronic
1072663520 10:97378001-97378023 ACGTGAGGATAGGCAGAGCATGG - Intronic
1072759920 10:98048137-98048159 ACCTGAGCCCAGGCAGGTCAAGG - Intergenic
1072983302 10:100117693-100117715 ACTTGAGCCCAGGGAGGTCAAGG + Intergenic
1073232206 10:101981726-101981748 ACTTGGGTACAGGCCGGGCATGG + Intronic
1073683209 10:105727374-105727396 ACTTAAGGAAAGGGAGGCCAGGG + Intergenic
1074170158 10:110925538-110925560 ACTTGAGCCCAGGGAGGTCAGGG - Intronic
1074683900 10:115940104-115940126 ACTCAAGGACAGGCAGGAATGGG + Intronic
1076569651 10:131424289-131424311 ACTGGACAACAGGCAGGGCAAGG - Intergenic
1076644552 10:131943653-131943675 ACTGGAGGACACACAGGAGAGGG + Intronic
1076893636 10:133297799-133297821 ACCTGAGGAAAGGCAGGCCCGGG + Intronic
1077325251 11:1960954-1960976 AAGTGAGGACAGGCTGGAGAAGG + Intronic
1077807542 11:5604704-5604726 ATCAGAGGACAGACAGGACAAGG - Intronic
1079938848 11:26652661-26652683 ACTGGAAGGCAGCCAGGACAAGG - Intronic
1080056676 11:27913904-27913926 AGTTGAGGCCAGGCTGGGCAGGG - Intergenic
1080129366 11:28775812-28775834 ACTTGAGCCCAGGGAGGTCAAGG + Intergenic
1081543115 11:44050514-44050536 ACATGAAGACAGGTAGGCCAGGG - Intronic
1082735640 11:56852820-56852842 CCTTGAGCACAGGAAGGACCTGG - Intergenic
1082988259 11:59186127-59186149 ACTTGAGGAGAGGAATGACATGG - Intronic
1083769206 11:64856920-64856942 CTTTGAGGACAGACAGGACAAGG - Intronic
1083855248 11:65390027-65390049 CCTTGGGGACAGGGAGGAGAAGG + Intronic
1083868318 11:65470881-65470903 AGGTGAGGACAGGCATGACCTGG - Intergenic
1084162194 11:67355980-67356002 ACCTGAGGACAGGAAGGTCAAGG - Intronic
1084999818 11:73021869-73021891 ACTTGAGCCCAGGCAACACAAGG + Intronic
1085555126 11:77412509-77412531 ACTTGAGCCCAGGAAGGTCAAGG - Intronic
1086180045 11:83939922-83939944 ACTTGTGAACAGGAAGGATAAGG + Intronic
1087592853 11:100214601-100214623 ACTGAAGGACAGTGAGGACATGG - Intronic
1088162474 11:106888875-106888897 TCTTGAGGACAGGAAGACCAGGG + Intronic
1088396489 11:109375581-109375603 AATTGAGGAGATGCAGGACTGGG - Intergenic
1089278138 11:117353483-117353505 GCTTGACGAAAGGCAGGAGACGG + Intronic
1089341243 11:117759303-117759325 AATAGAGGAGGGGCAGGACAGGG + Intronic
1202808232 11_KI270721v1_random:16133-16155 AAGTGAGGACAGGCTGGAGAAGG + Intergenic
1092158486 12:6301132-6301154 ACTTGAGTCCAGGGAGGTCAAGG + Intergenic
1092447763 12:8573570-8573592 ACTGTAGGACAGGCAAGAAATGG + Intergenic
1094076541 12:26482185-26482207 ACCTCAGGACAGGTAGGAGATGG - Intronic
1095423689 12:42052180-42052202 GCTTGAGCCCAGGCAGGACGAGG - Intergenic
1096256072 12:50063158-50063180 CCTTGAGGCCAGCCAGGCCAAGG + Intronic
1096593515 12:52678561-52678583 ACTGAAGAACATGCAGGACATGG - Exonic
1096849502 12:54426632-54426654 ACGTGAGGAGAGGGAGGGCAGGG + Intergenic
1097895635 12:64822579-64822601 ACCTGAGGCCAGGGAGGTCAAGG - Intronic
1101667321 12:106831137-106831159 GCTTTAAGACTGGCAGGACATGG - Intronic
1102379943 12:112456540-112456562 ACTTGAGCCCAGGGAGGACGGGG - Intronic
1103733873 12:123046180-123046202 CCTTCAGGAAAGGCAGGACTGGG - Intronic
1103743323 12:123105974-123105996 TCTTCAGGACAGGCAGGGCCAGG - Intronic
1104627849 12:130374597-130374619 ACTTGAGTTCTGGCAGCACAGGG - Intergenic
1104790799 12:131480814-131480836 GCCTGAGGACAAGCAGGCCAGGG + Intergenic
1106092052 13:26605017-26605039 GCCTGAGGACAGGAAAGACAGGG - Intronic
1106342852 13:28847719-28847741 ACTTGAGACCAGCCAGGAGATGG - Intronic
1107027426 13:35817207-35817229 AGATGAGGACAGGAAGGAAAAGG - Intronic
1110383223 13:74878175-74878197 ACTTGAGTCCAGGGAGGTCAAGG - Intergenic
1111819731 13:93197544-93197566 ACTTGAGCCCAGGGAGGCCAAGG + Intergenic
1111855691 13:93634310-93634332 AGTTGAGGACAGGCAGGAGGTGG - Intronic
1112560694 13:100511078-100511100 ACTTGAGGAAAAGCAGAGCAAGG - Intronic
1112716083 13:102187624-102187646 ACTTAAGAACAGCAAGGACAGGG - Intronic
1113809434 13:113129430-113129452 ACTGGAAGGCAGGGAGGACAGGG - Exonic
1114149767 14:20024980-20025002 GCTTGAGGCCAGCCTGGACAAGG + Intergenic
1114825663 14:26075048-26075070 ACTTGAGGATAGGTTGGACATGG + Intergenic
1115095797 14:29634292-29634314 ACCTCAGCACAGGCATGACACGG - Intronic
1116658497 14:47678385-47678407 GCTTAAGGACAGGCAAGAGATGG + Intergenic
1116701448 14:48248413-48248435 ACTGGATGACAGACAGGACTTGG - Intergenic
1117019033 14:51550320-51550342 ACTTGAGCCCAGGGAGGCCAAGG - Intronic
1118270834 14:64340632-64340654 ACTTCAGGACAGACAGTACAAGG - Intergenic
1118569894 14:67183934-67183956 ACTTGAGCCCAGGGAGGTCAAGG - Intergenic
1119363568 14:74072054-74072076 ACTGGAGGAGATGCAGTACAAGG + Intronic
1120639894 14:86998031-86998053 ATATGAGGGCAGGCAGGAAATGG - Intergenic
1120742139 14:88119744-88119766 ACCTGAGCACAGGGAGGTCAAGG + Intergenic
1120966778 14:90174559-90174581 ACTGGAGGTCAGGCCGGGCATGG + Intronic
1121148825 14:91611317-91611339 ACCTGAGGACTGGCTGGGCACGG + Intronic
1121695693 14:95909996-95910018 ATTTGAGGGCAGGCAGGAGATGG + Intergenic
1122243309 14:100383477-100383499 AGGTGAGCACAGGGAGGACAAGG - Intronic
1122311541 14:100799076-100799098 GCTTGAGCCCAGGCAGGAGACGG + Intergenic
1122584505 14:102795924-102795946 ACTCAAGGACAGGCCGGGCATGG + Intronic
1122687364 14:103515865-103515887 ACCTGAGCCCAGGCAGGTCAAGG + Intergenic
1122910524 14:104825799-104825821 ATTTGAGCAGAGGCAGGAAATGG + Intergenic
1123062600 14:105601053-105601075 GCTGGAGGACGGGCAGGTCATGG - Intergenic
1123726853 15:23111869-23111891 AAGGCAGGACAGGCAGGACATGG - Intergenic
1124433019 15:29623272-29623294 ACTTGAGCCCACTCAGGACATGG - Intergenic
1128443989 15:67740507-67740529 ACTTGAGTCCAGGGAGGTCAAGG + Intronic
1129070759 15:72948438-72948460 ACTTGAGCCCAGGGAGGTCAAGG + Intergenic
1129163152 15:73758856-73758878 ACATGAGGCCACACAGGACAGGG - Intergenic
1129417174 15:75391717-75391739 CATGGAGAACAGGCAGGACAGGG - Intronic
1129692113 15:77719492-77719514 ACATGAGGACGGGGAGGTCACGG + Intronic
1129741390 15:77991316-77991338 TGCTGAGGGCAGGCAGGACAGGG - Intronic
1129844273 15:78761091-78761113 TGCTGAGGGCAGGCAGGACAGGG + Intronic
1130257535 15:82332708-82332730 TGCTGAGGGCAGGCAGGACAGGG - Intergenic
1130597409 15:85257256-85257278 TGCTGAGGGCAGGCAGGACAGGG + Intergenic
1130892709 15:88146739-88146761 ACTTGAGTACTGGCATGTCAAGG - Intronic
1131763126 15:95645911-95645933 ACATGGGGAAAGGAAGGACAGGG - Intergenic
1132642956 16:986140-986162 CCTTGAGGGCAGGCAGGAGGTGG + Exonic
1132994341 16:2815246-2815268 CCTGGAGGGCAGGGAGGACAGGG - Intergenic
1132996686 16:2827181-2827203 CCTGGAGGGCAGGGAGGACAGGG + Intergenic
1134016347 16:10891188-10891210 GCTTGAGCCCAGACAGGACAAGG + Intronic
1134240116 16:12499756-12499778 ACCTGAGCACAGGGAGGTCAAGG - Intronic
1136056020 16:27690230-27690252 ACTTGAGCACAGGGAAGTCAAGG + Intronic
1136083941 16:27871110-27871132 ACTCCAGGACTGGCTGGACACGG - Intronic
1138186254 16:54980054-54980076 CCTGGAAGACAGGCAGGACAAGG + Intergenic
1138620528 16:58207508-58207530 GCTTGGGAACAGGCAGGACTAGG - Intergenic
1139348099 16:66317478-66317500 ACTTGAGGATGGGGAGGGCAAGG - Intergenic
1139741541 16:69039343-69039365 AAGTGAGCACAGGCTGGACACGG + Intronic
1140855304 16:78972695-78972717 ACCTGAGGTCAGGGAGGAGAAGG - Intronic
1141223450 16:82092638-82092660 ACACGATGACAGGCAGGACCAGG + Intronic
1142099750 16:88264915-88264937 GGATGAGGACAGGAAGGACATGG - Intergenic
1142531924 17:585364-585386 ACTTGAGGAATGGCTGGGCAAGG + Intronic
1143058984 17:4184369-4184391 ACCTCAGGACAGGCAAGAGAAGG + Intronic
1144242632 17:13328283-13328305 ACTTGAAGAAAGGAAGGGCATGG + Intergenic
1146265992 17:31453058-31453080 ACTTGGGGAGAGGCTGGGCACGG + Intronic
1146526034 17:33567625-33567647 ACTTGTGGACAGGCTGGTCGTGG + Intronic
1147505679 17:41014882-41014904 ATTCAAGGACAAGCAGGACATGG + Intronic
1147923549 17:43933082-43933104 ACATGAGGACAGGCAGCAGCGGG + Intergenic
1148105564 17:45116860-45116882 CCTTCAGGACAGGCAGGCAAAGG + Intronic
1150928759 17:69561926-69561948 GCTTGAGGCCAGGGAGGTCAAGG + Intergenic
1151089446 17:71420138-71420160 AGTGGAGGACAGGCAGGATGGGG + Intergenic
1151349172 17:73521554-73521576 TCCTGAGTACAGGCAGGGCAAGG - Intronic
1151785223 17:76272036-76272058 GCTGGAACACAGGCAGGACAAGG + Intergenic
1152219799 17:79057058-79057080 ACTTGAGCCCAGGGAGGTCAAGG + Intergenic
1152706428 17:81845991-81846013 GCTGGAGGGCAGGCAGGGCACGG + Exonic
1152841716 17:82573342-82573364 ACAGGAAGGCAGGCAGGACAGGG - Intronic
1153096043 18:1404953-1404975 ACTTGAAGACACAGAGGACATGG + Intergenic
1155246912 18:23919624-23919646 ACATGGGGACAGGCAAGACGGGG + Intronic
1155564691 18:27121083-27121105 ACTTGAGCCCAGGAAGGTCAAGG - Intronic
1157094820 18:44678857-44678879 ACTTGATGAAGGGAAGGACACGG - Intergenic
1157121728 18:44917692-44917714 GCTTGAGGACAAGCTGGAGAGGG - Intronic
1157766205 18:50298980-50299002 ACCTGGGGACAGGCGGGACGAGG + Intergenic
1158409297 18:57190633-57190655 ACTTGAGAACAGTCAAGACAGGG - Intergenic
1160052260 18:75445014-75445036 ACTTGAGCCCAGGCAGGTCGAGG + Intergenic
1160406907 18:78652622-78652644 AGATGAGGACAGGCAGGCCAGGG + Intergenic
1161182691 19:2895493-2895515 ACATGAGGACAGGCCGGGCACGG + Intergenic
1161206377 19:3043269-3043291 GCTTGAGGCCAGGCCGGGCATGG - Intronic
1161390064 19:4016115-4016137 CCTTGCCGACAGGCAGGACAGGG - Intronic
1162282347 19:9709371-9709393 ACTTCAGGACAGACAGTACAAGG - Intergenic
1162283757 19:9721939-9721961 ACTTCAGGAGAGACAGTACAAGG - Intergenic
1162292882 19:9792478-9792500 ACTCGATGACAGACAGGGCAGGG - Intronic
1162374336 19:10296045-10296067 AAATGAGGACCGGCAGGACCAGG - Intronic
1163008177 19:14409231-14409253 ACTTGAGGAAAAGCAGGGCTGGG + Intronic
1163323438 19:16587797-16587819 ACCTGAGTACAGGCAGCACGCGG + Intronic
1166268079 19:41697119-41697141 ACCTGAGGGCAGGCAGGACCTGG + Intronic
1166716813 19:44973627-44973649 GCTTGGGCACAGGCAGGGCAGGG + Intronic
1168196269 19:54776274-54776296 ACTGGAGGACAGGAAGAAAAGGG - Intronic
925200272 2:1961720-1961742 ACTTGAGTACAGGCAGGCCTCGG + Intronic
925919478 2:8629018-8629040 ACTTGAGCCCAGGCAGGTCAAGG + Intergenic
926676978 2:15633084-15633106 ACTTGGGGAGTGGCAGAACAAGG + Intergenic
927587410 2:24320086-24320108 ACTTAAGGAGAGGCCGGACATGG + Intronic
928024415 2:27728269-27728291 ACTTGAGGCCAGGAAGGCCAAGG + Intergenic
928160729 2:28921793-28921815 ACTTGAGCCCAGGGAGGTCAAGG - Intronic
928638239 2:33270116-33270138 GTTTGAGGCCAGCCAGGACATGG - Intronic
929341776 2:40827804-40827826 ACTTGATGACTGCCAGCACAGGG + Intergenic
930936188 2:56955074-56955096 ACTTCAGGACAGACAGTACAAGG - Intergenic
932290374 2:70572110-70572132 AGTGGAGGAGAGGCAGGAAAGGG + Intergenic
934123555 2:88863903-88863925 ACTTGAGGGCAGAGAGGTCAAGG + Intergenic
934726942 2:96628127-96628149 TCTAAAGGACAGGCAGGAGAAGG + Intronic
935407144 2:102721011-102721033 ACTTGAGGATAGGCAGGCTGGGG - Intronic
935538216 2:104319183-104319205 ACTTGAGCACTGTCAGGAGAGGG - Intergenic
938168845 2:129057237-129057259 ACCTGGGGACAGGGTGGACAGGG - Intergenic
938951053 2:136254850-136254872 ACCAGAGAACAGGCAAGACAAGG - Intergenic
939105419 2:137943293-137943315 TCCTGAGGACAGGGAGCACAGGG - Intergenic
940845157 2:158632505-158632527 ACATGAGGACTGGCGGTACAAGG - Intronic
941044505 2:160657366-160657388 ACTGGAGTTCAGGGAGGACAAGG + Intergenic
941617193 2:167734082-167734104 CCCTGTGCACAGGCAGGACATGG + Intergenic
943212615 2:184987698-184987720 TCTTGAGGACATGTAGTACATGG - Intergenic
943386397 2:187208224-187208246 ACATGTGCACTGGCAGGACAAGG - Intergenic
948702497 2:239769001-239769023 CCTTGAGGCCAGGAAGGCCATGG - Intronic
948862234 2:240758207-240758229 ACCTCAGGCCAGGGAGGACAGGG + Intronic
949047221 2:241877652-241877674 AGTTGAGGTCAAGCAGGCCAGGG - Intergenic
1169416625 20:5422796-5422818 AGATGAGGACATTCAGGACAGGG + Intergenic
1170029688 20:11931861-11931883 GCTAGAGAACAGGCTGGACAGGG - Intergenic
1170064874 20:12299877-12299899 ACTTGAGGCCAAGAAGGAGAGGG - Intergenic
1170582243 20:17707909-17707931 ACTTGACTACGGGCTGGACACGG + Intronic
1171207540 20:23292730-23292752 ACTTGAGCCCAGGGAGGCCAAGG + Intergenic
1171308280 20:24124520-24124542 ATTTGAGGAGAGGAATGACAAGG - Intergenic
1171310062 20:24138769-24138791 ACCAAAGGACAGGCTGGACAGGG - Intergenic
1171424816 20:25042782-25042804 ATTTGAAGAAGGGCAGGACATGG - Intronic
1172128308 20:32638647-32638669 ACTGGAGGACAGGAGGGACCGGG + Intergenic
1172705754 20:36880910-36880932 AATGCAGGACAGGCAGGTCAAGG - Intronic
1173809575 20:45947879-45947901 ACTTGGGGACAGGCAGGGAGGGG - Exonic
1173940478 20:46906862-46906884 AATTAAGGACAGGCATGAGAAGG + Intronic
1174860424 20:54086271-54086293 GCTGGAGGACATGCAGGAGAAGG - Intergenic
1174958604 20:55129972-55129994 AGTTGAGAAAAGGCAGGCCAAGG + Intergenic
1175204202 20:57299185-57299207 AGTTGAAGACAGGCCGGGCATGG - Intergenic
1176223774 20:63982628-63982650 ACTTGGGGACAGACAGGATGGGG + Intronic
1178509876 21:33195423-33195445 CCTTGAAGAGAGGCAGGGCACGG + Intergenic
1179205944 21:39278569-39278591 ACTGGAGGACTGGAAGAACAAGG + Intronic
1179409292 21:41149862-41149884 AGGTGAGGACCGGGAGGACAGGG + Intergenic
1180082213 21:45492094-45492116 AGTTGGGAACAGGCAGGAGAGGG + Intronic
1180864054 22:19105743-19105765 AAGTGAGGAAAGGCAGGACCTGG + Intronic
1181427973 22:22856292-22856314 ACCACAGGACAGGAAGGACAGGG + Intronic
1182125537 22:27813268-27813290 ACTTGAGCCCAGGCAGCAGAGGG - Intergenic
1182966933 22:34530884-34530906 ATTGGAGGACAGGCAGGATCAGG - Intergenic
1183226295 22:36552284-36552306 CCTTGAGAAAAGGCAGGAAAGGG - Intergenic
1183996139 22:41634111-41634133 GCTAGAGCTCAGGCAGGACATGG + Intronic
1184019979 22:41814273-41814295 AGATGAGGACAGGCCGGGCACGG + Intronic
1184671531 22:46014322-46014344 ACGAGAAGACAGGCGGGACAGGG - Intergenic
1185037977 22:48489636-48489658 AGTTGAGGACATGCTGGGCAGGG - Exonic
1185394643 22:50580544-50580566 AGGTGAGGGCAGGCAGGACAAGG - Exonic
949741450 3:7239080-7239102 ACTTGAGCCCAGGGAGGTCAAGG - Intronic
950067631 3:10125798-10125820 ACTTAAGCACTGGCCGGACATGG + Intronic
950167757 3:10814677-10814699 CCTAGAGGCCAGGCAGGATAGGG + Intergenic
950746570 3:15095095-15095117 ACTTGAGCCCAGGGAGGTCAAGG - Intronic
950902499 3:16510611-16510633 ACTTTAGGATAGGAAAGACAGGG + Intronic
951349938 3:21594415-21594437 ACTTGAGGAGGAGCAGAACAGGG + Intronic
951986757 3:28629486-28629508 ACTTGAGGGCAGTCTGGAGAAGG + Intergenic
953138066 3:40200789-40200811 ACGTGATGACACGCAGGGCAGGG - Intronic
953211217 3:40876803-40876825 CCCTGATGACAAGCAGGACAAGG - Intergenic
954102752 3:48389664-48389686 ACTTCTGCACAGGCTGGACACGG - Intronic
954616850 3:51973599-51973621 ACTTGAGCCCAGGAAGGTCAAGG - Intronic
954623275 3:52007741-52007763 ACTCGAGGAGAGGCAGGAGCTGG + Intergenic
955831215 3:63006252-63006274 ACTTGAGCACGGTCAGGCCAAGG - Intergenic
956202777 3:66723491-66723513 GGTGGTGGACAGGCAGGACAAGG - Intergenic
956471416 3:69570878-69570900 CCTTGAGGACAGGAACCACATGG + Intergenic
957985519 3:87570377-87570399 ACTTGAGCCCAGGGAGGTCAAGG - Intergenic
959494664 3:107036328-107036350 AGTTGAAGATAGGCAGGAAAAGG + Intergenic
961090541 3:124107541-124107563 AGTTAAGGACAGGGAGGACAAGG - Intronic
961739484 3:129024083-129024105 CCTTGAGGACAGTTAGCACAGGG - Intronic
965959789 3:174415112-174415134 ACCTGAGGCCATGCCGGACAAGG - Intergenic
966540912 3:181088659-181088681 ATTTTAGGTCAGACAGGACATGG + Intergenic
967258094 3:187613672-187613694 ACATTAGGCCAGGCAAGACAGGG + Intergenic
967907717 3:194515485-194515507 ACTTGAGCACAGGAGTGACATGG - Intergenic
968283346 3:197493541-197493563 ACTTGGTGACAGGCAGAATATGG - Intergenic
968534322 4:1113732-1113754 ACCTGAGGACCGCCAAGACAGGG - Intergenic
968807825 4:2786925-2786947 ACTTGAGGCCAGGTGGGACGGGG + Intergenic
969037316 4:4265107-4265129 GGCTGAGGACAGGCAGAACATGG + Intergenic
969268977 4:6086028-6086050 AGTTGTGGCCAGGCAGGAGAGGG - Intronic
972469172 4:39387296-39387318 GTTTGAGGAGAGGCAGGACATGG + Intergenic
972761556 4:42110201-42110223 ACTTGAGCCCAGGAAGGTCAAGG + Intergenic
973498574 4:51266043-51266065 AATTGAGGACATACAGCACAAGG - Intergenic
976478701 4:85513916-85513938 ACTTGACGACTGTCATGACAGGG + Intronic
976714871 4:88113025-88113047 ACTTGAGCCCAGGGAGGTCAGGG + Intronic
977907588 4:102496446-102496468 ACATGAGGACAGGGAGAAGATGG + Intergenic
983216889 4:165010386-165010408 CCTTCAGGACAGGAAGGTCAGGG + Intergenic
983406763 4:167340798-167340820 AACTGCAGACAGGCAGGACACGG + Intergenic
983873933 4:172854150-172854172 GCTTGAAGAAAGGTAGGACAAGG - Intronic
984783216 4:183544862-183544884 AGTTGAGGGCAGGCAGGAGATGG - Intergenic
985300726 4:188486209-188486231 ACTTGAGGACTGGACGCACAGGG + Intergenic
985611829 5:893384-893406 ACTGGAGGACAGCCGGGGCAGGG - Intronic
985893799 5:2737623-2737645 CCTACAGGACAGGCAGGAGATGG - Intergenic
985913945 5:2903586-2903608 GCTTGAGGTGAGGCAGGGCAGGG + Intergenic
986402250 5:7394104-7394126 AGTGGAGGGCAGGCAGGACAGGG + Intergenic
987114375 5:14714415-14714437 GCTTGAGGACGCGCAGGGCAGGG + Intronic
987230993 5:15893173-15893195 AGCTGGGGAGAGGCAGGACAGGG + Intronic
987552346 5:19399907-19399929 ACTATATGACAGGCAGGACTAGG + Intergenic
988415567 5:30942975-30942997 TCTTGAGGACTGGCTGGGCATGG + Intergenic
988446299 5:31289708-31289730 ACTTGGGGACACACAGGAAATGG + Intronic
989291801 5:39776184-39776206 CTTTGAGAACAGGCAGGGCAGGG - Intergenic
992982746 5:82193506-82193528 ACTGGAGGATAGTCAGAACAAGG + Intronic
993385736 5:87261398-87261420 GCTTGAGGCCAGGAAGGTCAAGG - Intergenic
996398386 5:123035513-123035535 ACCTGAGGACGGGGAGGACTAGG - Intronic
996714461 5:126575969-126575991 AATTGTGGACAGGCAGGGCGCGG + Intronic
998212745 5:140212882-140212904 ACTTGAGCCCAGGGAGGTCAAGG + Intronic
998650039 5:144108298-144108320 ACTTGAGGACAAGCAAGAGCTGG + Intergenic
998987474 5:147776635-147776657 ACTACAGGACAGGCTGGGCATGG + Intronic
1000884737 5:166738204-166738226 ATGTGAGGACAGGCTGGGCACGG + Intergenic
1001658811 5:173375081-173375103 ACATGAGGACAGGAAGGACAGGG - Intergenic
1002091075 5:176806788-176806810 AAATTAGGATAGGCAGGACATGG + Intergenic
1004131698 6:12926875-12926897 AGATGAGGCCAGGCAGGACCAGG - Intronic
1004519478 6:16348151-16348173 ACTTGAGCACAGGGAGGTCGAGG - Intronic
1005637933 6:27768861-27768883 ACTTGACCACTGGCAGGACATGG - Intergenic
1006387374 6:33738873-33738895 ACTTGATGACATTCAGTACATGG + Intronic
1006763713 6:36486351-36486373 ACTGGAAGGCAGGCAGGAGAGGG - Intronic
1006946237 6:37786181-37786203 AATTCAGGACAGGCTGGGCACGG + Intergenic
1007690556 6:43698406-43698428 GCTGCAGGGCAGGCAGGACAGGG + Intergenic
1007735152 6:43977770-43977792 CCTCGAGGCCAGGCAGGGCAAGG - Intergenic
1007808685 6:44470970-44470992 ACATGACAACAGGCAGGGCAGGG - Intergenic
1010871145 6:81041978-81042000 ACTTGAGGATACGGAGGGCAGGG + Intergenic
1012334321 6:98035406-98035428 ACTTGAGGACATGCTAGATAAGG + Intergenic
1012469729 6:99557514-99557536 AAATGAGGACAGGCCAGACATGG + Intronic
1013050180 6:106525781-106525803 ACTTGAGAACACGTAGGAAAAGG + Intronic
1013467227 6:110428375-110428397 ACTCAGGGACAGGCTGGACAAGG + Intronic
1015402211 6:132799397-132799419 GCTCGAGGACTGGCTGGACACGG + Intergenic
1017704475 6:157109134-157109156 CCATGTGGCCAGGCAGGACACGG - Intronic
1017844949 6:158249040-158249062 ACTTGAGCCCAGGGAGGTCAAGG + Intronic
1018764881 6:166925407-166925429 AGGTGAGGACGGGCTGGACAGGG - Intronic
1019780834 7:2938738-2938760 CCTGGAGGACAGGCAGGAGCTGG - Exonic
1021777835 7:24071229-24071251 AGTTGAGGAAAGGGAGGAGAGGG - Intergenic
1021844600 7:24752334-24752356 CCTGCAGGAGAGGCAGGACATGG - Intronic
1022133176 7:27422904-27422926 AATTGAGGACTGGCTGGGCACGG + Intergenic
1022327326 7:29344084-29344106 CCTTGATGACAAGCTGGACATGG - Intronic
1022818713 7:33938010-33938032 CCTTGAGCACAGGCAGCACCTGG - Intronic
1022840444 7:34159038-34159060 TCTTGAAGACAGTCAGGCCAGGG + Intergenic
1023560299 7:41467102-41467124 ACTTGAGGGCTGGCAGGAGCAGG - Intergenic
1023579515 7:41666531-41666553 ATTTGAGGACCGGCTGTACAAGG - Intergenic
1026640777 7:72123440-72123462 CCATGATGACAGGAAGGACAAGG - Intronic
1026904772 7:74056722-74056744 ACTTGGGGACAGGCAGGGCAGGG - Intronic
1027466088 7:78516433-78516455 ACTTGAGCCCAGGAAGGTCAAGG - Intronic
1028295059 7:89119135-89119157 ATTTGAGGTCAGGTAGGTCAAGG - Intronic
1030567169 7:111172651-111172673 ACTTGAGGAGGGGAAGGAAAGGG - Intronic
1030835103 7:114274696-114274718 ACTTGAGCCCAGGGAGGTCAAGG - Intronic
1031490910 7:122386987-122387009 ACATGGGGAAAGGCAGCACAGGG - Intronic
1032111423 7:129079139-129079161 ACTTGAGCCCAGGGAGGTCAAGG + Intergenic
1032374992 7:131404686-131404708 ACTTGAGCCCAGGGAGGTCAAGG - Intronic
1032415100 7:131729667-131729689 GCTAGTGGACAGGCTGGACATGG - Intergenic
1032574784 7:133041780-133041802 AGATGGGGACAGCCAGGACAGGG - Intronic
1032636439 7:133714174-133714196 ACCTGAGGACAGGCTGACCATGG + Intronic
1033147237 7:138881907-138881929 CCTTGAGAACAGACAGGACTTGG + Intronic
1034637376 7:152577874-152577896 ACTTGAGCCCAGGGAGGTCAAGG + Intergenic
1035002324 7:155622850-155622872 ACTTGAGCCCAGGGAGGTCAAGG - Intronic
1038034166 8:23673098-23673120 ACTTGAGGGCAGGGAGGAGATGG - Intergenic
1039063035 8:33587135-33587157 AAATGAGAACTGGCAGGACATGG + Intergenic
1039513958 8:38115770-38115792 ACTTGGGTAGAGGCAGGAGAGGG - Intronic
1039978747 8:42389024-42389046 ACTTGAGCCCAGGGAGGTCAAGG - Intergenic
1044561386 8:93615884-93615906 ACTTGAGGACTTTGAGGACAGGG - Intergenic
1045098372 8:98821576-98821598 ACCTGAGCACAGGGAGGTCAAGG + Intronic
1045845081 8:106624872-106624894 ACTTGAGCTCAGGGAGGTCAAGG - Intronic
1045876016 8:106981346-106981368 ACTTGATGTCAGTCAGCACAGGG + Intergenic
1046650619 8:116833163-116833185 TCTTGAGGACAGGTGAGACAGGG + Intronic
1047962163 8:130018271-130018293 CCTTGAGGAGAAGCAGGAAAAGG + Intergenic
1048270808 8:133026583-133026605 ACAGGAGGATAGGCTGGACAAGG + Intronic
1048493499 8:134916153-134916175 ACTTGTGGAGAGGAAGAACAAGG - Intergenic
1049801165 8:144518089-144518111 CCTTGAGGCCAGGCAGGGCCAGG - Intronic
1054019337 9:44570815-44570837 AATTGAGGACATACAGCACAAGG - Intergenic
1055019116 9:71649952-71649974 ACTTGAGCCCAGGGAGGTCAAGG + Intergenic
1057460910 9:95260945-95260967 ATTTGAGGACTGGAAGGAAAAGG - Intronic
1057870502 9:98713419-98713441 ATTTGGGGTCAGGCAGGACTGGG - Intergenic
1060201317 9:121653080-121653102 ACTTCAGGAAAGGCAGGAGTGGG - Intronic
1060417217 9:123439697-123439719 AATTCAGGACAGGTAGGAAAGGG + Intronic
1060926968 9:127461814-127461836 GCTTAAGGACAGCCAGGAGAAGG - Intronic
1061443889 9:130626548-130626570 GCTTGAGGGAAGGCAGGTCACGG + Intronic
1061795212 9:133082226-133082248 CCTAGGGGACAGGCAGGGCATGG + Intronic
1062285592 9:135771221-135771243 ACAGGAGACCAGGCAGGACAGGG + Intronic
1062347243 9:136120645-136120667 ACTGCAGGGCAGGGAGGACACGG - Intergenic
1185852112 X:3498881-3498903 ACTTGAGCCCAGGGAGGTCAAGG + Intergenic
1186362476 X:8856759-8856781 TGATGAGGACATGCAGGACATGG - Intergenic
1186389000 X:9139415-9139437 ATTTGAAGAGAGGAAGGACACGG + Intronic
1187290780 X:17951224-17951246 ACTTGAGGACATGATAGACAGGG - Intergenic
1187463407 X:19507492-19507514 ACTTGAGCCCAGGGAGGTCAAGG + Intronic
1187676693 X:21723373-21723395 CCTTGAGGACAGTGGGGACAGGG - Intronic
1194916368 X:99714288-99714310 ACTTCAGGACAGCAAGGGCAAGG + Intergenic
1195322697 X:103732809-103732831 CTTTGAGGAGAGGCATGACATGG - Intergenic
1196296548 X:114004149-114004171 ACATGAGGTGAGGCAGGAAAGGG - Intergenic
1197260600 X:124313108-124313130 CATTGAGGACAGGCAGAGCAAGG + Intronic
1197630773 X:128855153-128855175 ACTAGAGGATAGGCAGGGTATGG + Intergenic
1198175159 X:134147610-134147632 CCTTGAGGTCAGCCAGGAAATGG + Intergenic
1199757812 X:150881442-150881464 AGTTGAGGATTGGCAGGGCAGGG - Intronic
1201247599 Y:12021125-12021147 ACTAGGGGATAGGAAGGACAAGG + Intergenic
1201592643 Y:15632401-15632423 ACCTGAGCACAGGGAGGTCAAGG - Intergenic
1201890257 Y:18936001-18936023 AGTTGAGGATGTGCAGGACACGG - Intergenic
1202099800 Y:21295288-21295310 ACTTCAGGACAGACAGCACAAGG - Intergenic