ID: 900343334

View in Genome Browser
Species Human (GRCh38)
Location 1:2199033-2199055
Sequence CAGCCTCCTCACAGCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 425}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900343322_900343334 30 Left 900343322 1:2198980-2199002 CCCACACATGGGGTGCAAGAGTA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG 0: 1
1: 0
2: 5
3: 50
4: 425
900343330_900343334 -1 Left 900343330 1:2199011-2199033 CCTTGGTGCCCTTGGGCACCGAC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG 0: 1
1: 0
2: 5
3: 50
4: 425
900343323_900343334 29 Left 900343323 1:2198981-2199003 CCACACATGGGGTGCAAGAGTAG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG 0: 1
1: 0
2: 5
3: 50
4: 425
900343331_900343334 -9 Left 900343331 1:2199019-2199041 CCCTTGGGCACCGACAGCCTCCT 0: 1
1: 0
2: 3
3: 12
4: 131
Right 900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG 0: 1
1: 0
2: 5
3: 50
4: 425
900343332_900343334 -10 Left 900343332 1:2199020-2199042 CCTTGGGCACCGACAGCCTCCTC 0: 1
1: 0
2: 4
3: 26
4: 233
Right 900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG 0: 1
1: 0
2: 5
3: 50
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900343334 Original CRISPR CAGCCTCCTCACAGCCTCAG TGG Intronic
900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG + Intronic
900426254 1:2580764-2580786 CAGCATCCTCTCAGCCACAGTGG + Intergenic
900509956 1:3054100-3054122 CAGCCTCCAGGCAGCCTCAAGGG - Intergenic
900768300 1:4520252-4520274 CTAGCTCCTCACAGCCCCAGAGG + Intergenic
901024200 1:6270451-6270473 CAGGCTCCTCCGAGCCTCTGGGG + Intronic
901613511 1:10518384-10518406 GAACCTCCTCTCTGCCTCAGTGG + Intronic
901739900 1:11335079-11335101 CAGCCCCCTCCCCGCCTCACCGG + Intergenic
901880512 1:12191259-12191281 AAGCCTCTTCACAGCCCCACGGG + Intronic
902613109 1:17608585-17608607 TATCCCCCTCACAGCCTCAGGGG - Intronic
903302177 1:22386863-22386885 CAGCCTCCTCACAACCTGAATGG + Intergenic
903658419 1:24962795-24962817 CAGCCACCTCCCAGGCTCCGAGG + Intronic
903811110 1:26035536-26035558 CAGCCTCCGCAGAGGCTCCGCGG - Exonic
904350493 1:29902215-29902237 CAGCCTTCTTTCTGCCTCAGAGG - Intergenic
904605990 1:31697978-31698000 CAGCCTCCTCCCAGCCTCTGGGG - Exonic
904880714 1:33694814-33694836 CAACCTCCTCAAAGCCTCCTAGG + Intronic
905940784 1:41861567-41861589 CAGTCTCCCCACATCCCCAGAGG - Intronic
906661319 1:47584473-47584495 CAACTTGCTCACAGCCACAGGGG - Intergenic
907246116 1:53110145-53110167 CAGCCTCCTCACTGGCTCATAGG + Intronic
907400946 1:54224439-54224461 TAACCTCCTCACAGCCTATGAGG + Intronic
907444651 1:54499852-54499874 CAGCTTCCTACCAACCTCAGGGG + Intergenic
907456740 1:54581199-54581221 CAGCCTCCACACAGCACCAGAGG - Intronic
910436430 1:87210531-87210553 CAGGCCTCTCCCAGCCTCAGGGG + Intergenic
910803131 1:91164976-91164998 CAGCCTCAACGCTGCCTCAGGGG + Intergenic
910815869 1:91289818-91289840 CAGCCTCAGCTCAGCATCAGAGG + Intronic
911539123 1:99137250-99137272 CAGCCTCCCGAAAGTCTCAGAGG - Intergenic
912363280 1:109112722-109112744 CAGCCGCAGCACAGCCTCACTGG + Intronic
913486003 1:119333337-119333359 CAGCCTACTCACTGCCCCCGTGG - Intergenic
914374454 1:147061324-147061346 CAGCCTCAGCTCAGCATCAGAGG - Intergenic
914965966 1:152257107-152257129 CAGCTTCCGCTCAGCATCAGAGG + Intergenic
915281649 1:154826652-154826674 CACCCTCTGCACAGCCTCAGGGG - Intronic
915860351 1:159437690-159437712 CTGCATCCTCCCAGCCCCAGGGG + Intergenic
916592416 1:166205219-166205241 CAGCCTCTGCAAAGGCTCAGGGG - Intergenic
917859687 1:179134421-179134443 CAGCCTCCACGCAGCCTCCATGG - Intronic
918285900 1:183054813-183054835 CAGCCACCTTAGAGCCTTAGGGG + Intronic
920032964 1:203048416-203048438 CAGCCTCCTCCCACTCTCTGTGG - Intronic
920048287 1:203147737-203147759 CAGTTTCTTCACAGCCTCATGGG + Intronic
920552846 1:206878547-206878569 CAGCCTCCTCAAAAACTCAGAGG - Intergenic
921108998 1:212014583-212014605 CAGCCTCCGCTCGGCATCAGAGG - Intronic
922336776 1:224624472-224624494 CTCACTCCTCACAGCCCCAGTGG + Intronic
922436805 1:225615080-225615102 CAGCCTCCGCTCGGCATCAGAGG - Intronic
922504062 1:226116286-226116308 AAGCGGCCTCACACCCTCAGTGG - Intergenic
922577861 1:226674857-226674879 CAGGAAGCTCACAGCCTCAGTGG - Intronic
922740991 1:228014122-228014144 CAGCCTCCTCCTGGCCTGAGAGG - Intronic
923668658 1:236021149-236021171 CAGCCGTCTCACAGCCTGGGAGG + Intronic
923884543 1:238140106-238140128 CAGTCTCCTCGAAGGCTCAGAGG - Intergenic
923961135 1:239084987-239085009 CAGCTTCCACACAACCCCAGAGG + Intergenic
924619611 1:245649317-245649339 CTCGCTCCTCACAGCTTCAGAGG + Intronic
1062912061 10:1217741-1217763 CCGACTCCTCACAGCCTGGGCGG - Intronic
1064097082 10:12431821-12431843 CAACCTTCTCACATCCGCAGAGG + Intronic
1064098712 10:12444363-12444385 ACACCTCCTCAAAGCCTCAGAGG - Intronic
1065737904 10:28771207-28771229 CAGCCTCTGCTCAGCATCAGAGG - Intergenic
1066109398 10:32182776-32182798 CACCCTGTCCACAGCCTCAGAGG - Intergenic
1066140670 10:32501004-32501026 CAGCCTCCGCTCGGCATCAGAGG + Intronic
1067077144 10:43194450-43194472 CACCCTCCTCCCTGCCCCAGGGG + Intergenic
1067344889 10:45429980-45430002 CAGCCTCCCCACAGTCTCCCAGG + Intronic
1067527192 10:47045972-47045994 CAGCCTCCCCTCGGCCTCAAGGG - Intergenic
1067566273 10:47340000-47340022 CAGCCTTGCCACAGCCACAGGGG + Intergenic
1068805341 10:61188809-61188831 CAGCCTCCTCACAACTCCTGAGG + Intergenic
1069177622 10:65312919-65312941 CAGTCTCCCCAAAGGCTCAGAGG - Intergenic
1069841556 10:71342681-71342703 CAGTGTCCTCCCAGCCTCAGAGG + Intronic
1070286468 10:75087401-75087423 GAGCCCCATCACAGGCTCAGAGG + Intergenic
1070781897 10:79142551-79142573 CAGCCTACACAAAGGCTCAGAGG + Intronic
1072196254 10:93119332-93119354 CAGCCTCTTCCCAGCCTGGGTGG + Intergenic
1073326838 10:102648117-102648139 TAGCTTCCCCACAGCCTCATGGG - Intronic
1073847025 10:107568221-107568243 CAGTCCCATCACAGGCTCAGAGG - Intergenic
1073972424 10:109060160-109060182 CAGCCTGCACACAGACACAGAGG - Intergenic
1074536926 10:114334740-114334762 CAGCCCCCTCTGAGTCTCAGTGG - Intronic
1074756514 10:116627827-116627849 CAGCCTCCTGCCCGCCTCCGCGG - Exonic
1074945296 10:118275390-118275412 CAGCTTCCTCACAACGTCAGAGG + Intergenic
1075635315 10:124026705-124026727 CAGGCAGCTCACGGCCTCAGCGG + Intronic
1076634964 10:131875902-131875924 CATCCTGGACACAGCCTCAGGGG + Intergenic
1076767655 10:132645320-132645342 CCGCCTGCTCACAGCCTGGGAGG - Intronic
1076903605 10:133351664-133351686 CAGCTTCCCCACAGCCTCCAGGG + Intronic
1077123440 11:921678-921700 CTGCACCCCCACAGCCTCAGAGG + Intergenic
1077183077 11:1225001-1225023 CTGCCTCCTCCCAGCCTCCATGG + Intronic
1077287509 11:1774205-1774227 CAACCTCCTCACTGTCTCTGAGG - Intergenic
1077393951 11:2312143-2312165 CACCTTGCTCACAGCCTCAGAGG + Intronic
1077478536 11:2802386-2802408 CAGGCTCCCCGCTGCCTCAGTGG - Intronic
1077924521 11:6667695-6667717 CAACCTTCTCACTGCATCAGTGG - Intergenic
1078017925 11:7631159-7631181 CATCCCCATCACAGCCTGAGGGG - Intronic
1080061628 11:27962411-27962433 AGTCCTCTTCACAGCCTCAGTGG + Intergenic
1080639178 11:34148831-34148853 CCCCCACCTCCCAGCCTCAGCGG - Intergenic
1080668621 11:34357200-34357222 CAGGCGCCTCACCGCCTCGGCGG + Exonic
1080869500 11:36225208-36225230 AAACCTCCTCACTGCCTCACAGG + Intronic
1082064937 11:47892327-47892349 CAGCCTCCACTCGGCATCAGAGG - Intergenic
1083353769 11:62049752-62049774 CATCCTGTTCACAGCCTCACAGG + Intergenic
1084191667 11:67502230-67502252 CAGGCTCCTGGCTGCCTCAGTGG - Intronic
1084688534 11:70711379-70711401 CAGCCTGGGCACAGCCTGAGCGG - Intronic
1085122136 11:73974089-73974111 CAGCCTCCACCCACCCTCTGTGG + Intergenic
1085175729 11:74486743-74486765 CAGTTTCCTGCCAGCCTCAGTGG + Intergenic
1085303312 11:75471359-75471381 CCGGCTCCTGACAGCCTAAGAGG + Intronic
1085779350 11:79394281-79394303 CACCCTCCTCACATCCCCACAGG - Intronic
1088804573 11:113340474-113340496 CAGCAGCCTCTCAGCGTCAGAGG - Intronic
1089378132 11:118009398-118009420 CTTCATCCTCACAGCCTCACAGG - Intergenic
1089631098 11:119784729-119784751 AAGCCTCCACAAAGCCTCAGAGG + Intergenic
1090265084 11:125348570-125348592 CAGTCTCCTCTCAGCCTCATGGG + Intronic
1090267396 11:125361900-125361922 CAGGCTCCTCATAGCCTGGGAGG + Intronic
1090918837 11:131190726-131190748 CAGCCCACTCCCACCCTCAGTGG - Intergenic
1090968075 11:131615796-131615818 CAGGCTCAGCACAGCCTTAGGGG - Intronic
1091284387 11:134399943-134399965 CACCTTGCTCACAGCCTGAGAGG - Intronic
1091339788 11:134801381-134801403 CAGCCTCCTGCCAGCATCGGCGG - Intergenic
1091558161 12:1591728-1591750 GAGCTTCATCACAGCCCCAGGGG + Intronic
1092100692 12:5881475-5881497 CAGCCTTCTCAAAGCCAAAGGGG + Intronic
1092172957 12:6384739-6384761 CAGCCCCCTCGCGGCCTCAGAGG + Intronic
1092236699 12:6815015-6815037 CAGTCTCCTCCCTGCCCCAGGGG + Intronic
1092819385 12:12339113-12339135 GAGCCTCTTCACAGCCTCTTTGG - Intronic
1092821001 12:12353468-12353490 CAGCCTCCTAAGAGCCTCCTAGG - Intergenic
1092871170 12:12807227-12807249 CAGCCTGCTCACCTCCACAGTGG + Intronic
1095221926 12:39626166-39626188 CAACCTCCCAACAGCCTCTGCGG - Exonic
1097998631 12:65917267-65917289 CAACATTCTCACGGCCTCAGTGG - Intronic
1098893297 12:76031313-76031335 CAGCATCCTCCCAGCATAAGAGG + Exonic
1101452269 12:104790294-104790316 CAGCTTCCTGACAGCCCCTGGGG - Intergenic
1101740020 12:107493465-107493487 GAACCTTCTCTCAGCCTCAGAGG + Intronic
1102509428 12:113404006-113404028 CTCCCTTCTGACAGCCTCAGTGG - Intronic
1102829589 12:115984839-115984861 CAGCATACTCACTGCTTCAGTGG - Intronic
1103045238 12:117730546-117730568 CAGCCTCGGCTCAGCATCAGAGG - Intronic
1104804421 12:131575931-131575953 CAGCGTCTTCACAGCAACAGGGG - Intergenic
1104903440 12:132201419-132201441 CAGCCTCCTAATATCCACAGAGG + Intronic
1107042695 13:35966542-35966564 CAGCCTCCGCTCAGCATCAGAGG - Intronic
1112103781 13:96218391-96218413 CACCCTCCTCTCTGCCCCAGAGG - Intronic
1112140302 13:96634045-96634067 CTGCCTCCTCATATCCTCACAGG - Intronic
1112507657 13:99984869-99984891 CAGCCCCCTCGCAGCCTGAGTGG + Intronic
1113088087 13:106588617-106588639 CACCCTCCCCACAGCCTCTCTGG + Intergenic
1113735908 13:112678997-112679019 CAGCCTCGGCTCAGCATCAGAGG + Intronic
1113839504 13:113350812-113350834 CAGCCACCTCATGGCGTCAGAGG + Intronic
1113881201 13:113627640-113627662 CAGCTTCCTAACAGGCCCAGGGG - Intronic
1114049953 14:18914325-18914347 CTGCCTCCTCACGTCCACAGTGG - Intergenic
1114112604 14:19487605-19487627 CTGCCTCCTCACGTCCACAGTGG + Intergenic
1114336538 14:21697327-21697349 CAGCCTCCGCTCGGCATCAGAGG - Intergenic
1114523206 14:23351853-23351875 CACCCTTCTCACATCCCCAGTGG - Exonic
1114763527 14:25344749-25344771 CAGCATCACCACAGCTTCAGAGG - Intergenic
1115761790 14:36583187-36583209 CATCCCCCTAACAGCCTCAGAGG + Intergenic
1117186701 14:53247181-53247203 CAGCCTGCTCACAGGCAAAGGGG - Intergenic
1117715496 14:58575797-58575819 CAGCTTCTTCACAGAGTCAGGGG - Intergenic
1118191079 14:63580933-63580955 AAGCCTCGTCACACCCTAAGTGG - Intergenic
1118604444 14:67492454-67492476 CAGTGGCCTCACAGCCTCACTGG + Intronic
1118888785 14:69889451-69889473 CAGCCTCAGCATAGGCTCAGAGG + Intronic
1119418848 14:74494047-74494069 CAGGCTCCTCACGGCCTCCCTGG + Exonic
1119835581 14:77746954-77746976 CAGCCTCGGCTCAGCATCAGAGG - Intronic
1120181426 14:81346264-81346286 CACCCACCTCACTACCTCAGGGG - Intronic
1121078131 14:91086018-91086040 CTGCCTCCTGTCAGCCCCAGTGG + Intronic
1121431282 14:93890157-93890179 CATCCTCCCCAAAGCCCCAGGGG - Intergenic
1121463357 14:94098842-94098864 CAGCCACCTCACAGGGTTAGTGG - Intronic
1121640205 14:95480243-95480265 CAGCCCTCTCACTGACTCAGTGG - Intergenic
1121667576 14:95685000-95685022 CAGCCTCATCTGATCCTCAGAGG + Intergenic
1122744428 14:103889563-103889585 CAGCCTCCACACGGCCTCAGCGG + Intergenic
1123042688 14:105496836-105496858 CAGACTCCTCACTGCCTTAGGGG + Intronic
1124335237 15:28850599-28850621 CAGCTTCGGCACAGCATCAGAGG + Intergenic
1124335873 15:28856702-28856724 CAGCCTCCCCAAAGGCTCAGAGG - Intergenic
1124650914 15:31473309-31473331 CAGCTTCCTCACAGGGTCAGGGG - Intergenic
1125749767 15:42020417-42020439 CCAACTCCTCACAGCCTCACAGG - Intronic
1126573028 15:50172180-50172202 CAGCCTCCGCTCGGCATCAGAGG - Intronic
1127284288 15:57518927-57518949 CAGACTCCACACCGCCTCGGAGG - Intronic
1127593316 15:60450251-60450273 CAGCGTCCTCACAGTGGCAGAGG - Intronic
1127854763 15:62945295-62945317 CAGGTGCCTCACAGCCTCAGAGG + Intergenic
1127931411 15:63599866-63599888 CAGGCTCCTCACAACCCCAGTGG + Intronic
1128914439 15:71547001-71547023 CTGCCTCCTCCCTGCCTCAGTGG + Intronic
1129107239 15:73318790-73318812 CTGCTTCCCCACAGCCCCAGAGG + Intergenic
1129265641 15:74391844-74391866 CAGGTGCCCCACAGCCTCAGTGG - Intergenic
1129326768 15:74803895-74803917 AAGCCTCCTCACACCTTCAGAGG - Intergenic
1129333295 15:74838582-74838604 AAACCTCCCCACAGCCTGAGGGG - Intronic
1129660187 15:77549026-77549048 CTGCCCCCTCCAAGCCTCAGTGG + Intergenic
1129903484 15:79169692-79169714 CAGCCGGCTCACAGCCTCTGGGG - Intergenic
1130911775 15:88275904-88275926 CAGCCAGCTCCCAGCCTCCGTGG + Intergenic
1132162570 15:99556676-99556698 CAGACTCATCAAAACCTCAGGGG - Intergenic
1132683082 16:1151900-1151922 CAGCCGCCCCACAGCCTCTCCGG + Intergenic
1132700956 16:1221934-1221956 CCGCCACATCACAGCATCAGGGG - Exonic
1132748211 16:1445684-1445706 CAGACTCCTGCCGGCCTCAGAGG - Exonic
1132773847 16:1580947-1580969 CAGCCTCACCACAGCTTCATAGG + Intronic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133023005 16:2975085-2975107 CTGCCTCCTCACAGCTCCACAGG - Intronic
1133054250 16:3137607-3137629 CAGCCTCCTCACCGCTTCCCGGG - Exonic
1133232785 16:4374341-4374363 CAGCCTCCTCACACCCAGGGAGG - Intronic
1133300260 16:4778066-4778088 CAGGCTCCCCACACCCTCACCGG + Exonic
1135473264 16:22751225-22751247 CATCCTCCTCTCTGCCCCAGGGG - Intergenic
1135622532 16:23968229-23968251 CAGGGTCCTGACAACCTCAGGGG - Intronic
1136287612 16:29253651-29253673 CACCCTCCTCACATCTGCAGAGG - Intergenic
1136631453 16:31491436-31491458 CAGCCTCCTGACAGTCCCACAGG + Intronic
1137492334 16:48943650-48943672 CACCCTCCTTCCAGCCCCAGAGG - Intergenic
1137729769 16:50680877-50680899 CTGCCTCAGCACAGCCTTAGAGG - Intronic
1137943544 16:52712726-52712748 CAGCCTCCTCACATCCTTAAAGG + Intergenic
1140410880 16:74739715-74739737 CAGCCCCTTCTCAGCTTCAGGGG + Intronic
1141652166 16:85398507-85398529 TATCCTCACCACAGCCTCAGGGG - Intergenic
1141913302 16:87075739-87075761 CCGTCTCCTCACACCCTCTGAGG - Intergenic
1142011652 16:87718407-87718429 CAGCCTCCGCTCGGCATCAGAGG - Intronic
1142066389 16:88065364-88065386 GAGACTCCTCCCAGCCACAGAGG - Intronic
1142093235 16:88226279-88226301 CACCCTCCTCACATCTGCAGAGG - Intergenic
1143115684 17:4580654-4580676 CAGCCTCCTCACTGGGTCAAAGG - Intergenic
1143295192 17:5866042-5866064 CGACCTGCTCACAGCCACAGAGG + Intronic
1144832557 17:18139827-18139849 CTGGCTCCCCACAGCCCCAGTGG + Intronic
1146219779 17:31008475-31008497 CAGCATCCTCGCGGCCTCTGCGG - Intergenic
1146290097 17:31600649-31600671 CAGCCGCCAGGCAGCCTCAGAGG + Intergenic
1147191586 17:38741039-38741061 CTGCCTCCTCACATTCTCTGGGG - Intronic
1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG + Intronic
1148830495 17:50427600-50427622 CAGAGTCCTCCCAGCCTGAGGGG - Intronic
1149317413 17:55451481-55451503 CAGCCACTTCAAAGCCTCTGTGG - Intergenic
1149345622 17:55732126-55732148 CACCCTCTTGGCAGCCTCAGGGG - Intergenic
1149401156 17:56297178-56297200 CAGCCACCACAGAGCTTCAGAGG - Intronic
1150070476 17:62146063-62146085 CAAGCTGCTCACAGCCTCAGGGG + Intergenic
1151462711 17:74264240-74264262 CAGCCTCCCCGCAGGCTCACTGG + Intergenic
1151589962 17:75036734-75036756 CTGCATCCTCAGATCCTCAGCGG + Intronic
1152019745 17:77774440-77774462 CAGCCTCCTCCCAGCCTCCTGGG - Intergenic
1152757044 17:82091403-82091425 CAGCTTCTGCACGGCCTCAGGGG + Exonic
1152830979 17:82496941-82496963 CCTCCTCCACACAGCCTTAGAGG + Intergenic
1153512837 18:5874080-5874102 TAGCCTCATCACAGCCCCTGTGG - Intergenic
1153535869 18:6100916-6100938 CAGCCTGCCCCCAGCATCAGTGG - Intronic
1156453982 18:37282565-37282587 GAGCCACCTCACTGCCCCAGGGG + Intronic
1156500427 18:37554137-37554159 CAGGCTGGGCACAGCCTCAGAGG - Intronic
1159490860 18:69132755-69132777 CAGCCTCCCCAAAAGCTCAGAGG + Intergenic
1160246742 18:77165535-77165557 CAGCCTTCCCCCAGCCTCATAGG - Intergenic
1160626393 18:80210436-80210458 CAGCAGCCTCACAGCCTGGGAGG + Intronic
1161075312 19:2282404-2282426 AAGGCCCCCCACAGCCTCAGAGG + Intronic
1161698849 19:5784344-5784366 CAGCCTCGTCAAGGGCTCAGGGG + Exonic
1161815828 19:6499345-6499367 CTGGCTCCTGACAGCCCCAGTGG + Intronic
1162153895 19:8663942-8663964 CAGTCACCACACAGCCTCAAAGG - Intergenic
1162441073 19:10692335-10692357 CAGCCTGATGGCAGCCTCAGAGG + Exonic
1162538342 19:11277446-11277468 CAGCCTCCGCTCGGCATCAGAGG + Intergenic
1162683089 19:12361757-12361779 CAGCCTCCGCTCGGCATCAGAGG - Intronic
1162949472 19:14062046-14062068 CAGCCAAGTCACAGCCTCCGGGG - Intergenic
1163451012 19:17377452-17377474 CCGCCTTCTCACAGCCAGAGTGG - Intergenic
1164231351 19:23290766-23290788 CAGCCTCCACTCGGCATCAGAGG + Intergenic
1164647042 19:29866194-29866216 CAGCCTCAGCCCAGCCTCAGAGG + Intergenic
1165308630 19:35017596-35017618 CTGCCCCATCCCAGCCTCAGGGG + Intronic
1165369178 19:35392043-35392065 CCTCCTCCTCACAGCCTTTGAGG + Intergenic
1166196242 19:41207602-41207624 CAGCTCCCGCCCAGCCTCAGGGG - Intergenic
1166309029 19:41952078-41952100 CATCCGCCACACAACCTCAGAGG + Intergenic
1166888068 19:45973492-45973514 CGGCCTCTTCACGGCCTCCGCGG - Exonic
1167270589 19:48503566-48503588 CAGCCTCCTCCCAGCCTCCCTGG + Intronic
1167902646 19:52633514-52633536 CACCCTCCTTCCAGCCTCACTGG - Intronic
1167925230 19:52816081-52816103 CACCCTCCTTCCAGCCTCACTGG - Intronic
1167929564 19:52853247-52853269 CACCCTCCTTCCAGCCTCACTGG - Intronic
1167992648 19:53373532-53373554 CACCCTCCTTCCAGCCTCACTGG + Intronic
1168001319 19:53448440-53448462 CACCCTCCTTCCAGCCTCACTGG + Intronic
1168005705 19:53485003-53485025 CACCCTCCTTCCAGCCTCACTGG + Intronic
1168272891 19:55259441-55259463 TAGCCGCCTCCGAGCCTCAGAGG + Intergenic
1168599189 19:57704640-57704662 CTGTTTCCTCACAGCCTCACAGG - Intronic
925542919 2:4985483-4985505 CTGCCTCCTGACAGCCTCAGGGG + Intergenic
925933885 2:8734343-8734365 CAGGCTCCTCAAAGCCTTCGAGG - Intronic
925975223 2:9137651-9137673 GTGCCTCCTGACAGCCTCACGGG + Intergenic
926173882 2:10571865-10571887 CGGCCACCGCACAGCCCCAGGGG - Exonic
926337152 2:11872390-11872412 AAGGCTCCTTTCAGCCTCAGCGG - Intergenic
926980114 2:18560039-18560061 TGGACTCCTCTCAGCCTCAGCGG + Intronic
927138916 2:20116406-20116428 CATCCTCCTCCCAGGCTGAGGGG + Intergenic
927146712 2:20170993-20171015 CAGCCTTCTCACAGCCCCAGGGG + Intergenic
927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG + Intergenic
929127290 2:38533412-38533434 CACCCTCCTCAAAGCATCACGGG - Intergenic
929873062 2:45774255-45774277 CAGCTGCTTCACAGCCTCACGGG + Intronic
930363477 2:50411083-50411105 CAGCCTCCGCTCGGCATCAGAGG - Intronic
932275935 2:70452342-70452364 GAGCCTCCTCGGAGCATCAGTGG - Intronic
932494445 2:72139467-72139489 CAGCCTCCTCGCAACCAGAGGGG - Intronic
932982365 2:76685215-76685237 CAGCCTCCTCTCCACCTCAGTGG + Intergenic
933063478 2:77767684-77767706 GTGCCTCCTCGCAGCTTCAGGGG - Intergenic
933898525 2:86833044-86833066 CAGCCTCCTCACAGGGTCATAGG + Intronic
934746711 2:96764059-96764081 CTTCCTCCTCACTGCCTCTGTGG + Intronic
935270457 2:101429929-101429951 CAGCCTCTTGAAAGCCCCAGGGG + Intronic
935761613 2:106325739-106325761 CAGGGTCCTCACAGAGTCAGGGG + Intergenic
936663394 2:114567262-114567284 CAGCATACTCACAGCTTCAGAGG - Intronic
937023951 2:118682094-118682116 CAAGCTCATCACAGCCCCAGGGG - Intergenic
937357864 2:121209446-121209468 CAGCCTCCCCGCAGCCACATGGG + Intergenic
937583951 2:123523768-123523790 CAGTCTCCTCAAAGGCTCAGTGG + Intergenic
937737799 2:125313118-125313140 CAACCTCCTCACCACCTCTGGGG + Intergenic
937825959 2:126368820-126368842 CAGATGCCTCAGAGCCTCAGAGG - Intergenic
938146171 2:128836333-128836355 CAGCCTCCTGTCAGCATCAAGGG + Intergenic
938613894 2:132977970-132977992 CAAACCACTCACAGCCTCAGTGG + Intronic
938642592 2:133296380-133296402 CAGCCTCCTCCGAGATTCAGAGG - Intronic
938904516 2:135825728-135825750 CAGCCCTCTCTGAGCCTCAGGGG - Intronic
939042590 2:137208613-137208635 CAGTCTCCTCAAAGGCTCAGAGG + Intronic
941024954 2:160448332-160448354 CAGCCTCCGCTCGGCATCAGAGG - Intronic
942083066 2:172419567-172419589 CAACCTCCTCAGACCCTCATTGG - Intergenic
942231709 2:173866612-173866634 CAGCCCCCTGCCAGCTTCAGTGG + Intergenic
942790514 2:179756011-179756033 CAGTTTCTTCCCAGCCTCAGTGG + Intronic
943100183 2:183478587-183478609 CAGCCTCCACTCGGCATCAGAGG - Intergenic
943804135 2:192101198-192101220 CAGCCTCCTCAGAGTCTGATGGG + Intronic
943863059 2:192893518-192893540 CAGCCTCGGCTCAGCATCAGAGG - Intergenic
944144731 2:196494817-196494839 CAGCCTCATCAAATGCTCAGTGG - Intronic
944427248 2:199596040-199596062 TAGCCTATTCACAGCCTCTGGGG - Intergenic
944858418 2:203790588-203790610 CAGGTTCCTCACAGCCTTAAAGG - Intergenic
946245537 2:218385133-218385155 CTGCCTCCTCACAGCTTCTCTGG + Exonic
947032779 2:225816925-225816947 CAGCCTCCTCAAAAATTCAGAGG - Intergenic
947747038 2:232513145-232513167 CAACCTCCTCAGAGCCTCTGAGG - Intergenic
947815192 2:233032107-233032129 CCGCCCCCTCGCTGCCTCAGGGG + Intergenic
948878209 2:240841375-240841397 CAGCCTCCTTGCAGCCTCCTGGG + Intergenic
948927412 2:241108292-241108314 CCTCCTCCTCACAGCTACAGAGG - Exonic
1168843176 20:922879-922901 CTGCCTCCTCAGAGGCTGAGGGG + Intergenic
1168924551 20:1568443-1568465 CAGCCCTCTCTCAGCCCCAGTGG + Intronic
1169744965 20:8934465-8934487 CTGCCTCCTCAGAGCCTCAGGGG - Intronic
1170568110 20:17617935-17617957 CAGGCTCCACCCAGCCTCACCGG - Intronic
1170612753 20:17928161-17928183 TTGCCTCCTCCCAGCCTCGGGGG - Intergenic
1171005540 20:21461965-21461987 CAGCCCCAACACATCCTCAGTGG - Intergenic
1172611034 20:36252770-36252792 CAGTCTCCCCACAACCTCTGGGG + Intronic
1173405949 20:42764916-42764938 CAGAACACTCACAGCCTCAGAGG + Intronic
1173898446 20:46568844-46568866 CAGCATCCTCGCAGCCACACAGG + Intronic
1174177968 20:48656982-48657004 CAGCCACCACTCAGCCTGAGAGG + Intronic
1175964572 20:62654110-62654132 GACCCTCCTCAGAGCCCCAGGGG - Intronic
1175987201 20:62770074-62770096 CAGCCTCCTCCCCGCTCCAGGGG + Intergenic
1177370431 21:20196701-20196723 CAGCCTCCTCAGACCCCCACTGG - Intergenic
1178397846 21:32258475-32258497 CAGCCTGTTCACAACCACAGTGG - Intergenic
1178599826 21:33985875-33985897 CGCCTCCCTCACAGCCTCAGAGG - Intergenic
1178723378 21:35029768-35029790 CACCCTCCTCACCACTTCAGTGG + Intronic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1180468435 22:15636701-15636723 CTGCCTCCTCACGTCCACAGTGG - Intergenic
1180611469 22:17100838-17100860 CAGCCTGGTCCCAGCCTCCGTGG + Intronic
1181068278 22:20316742-20316764 CAGCCCCCGCACAGCGCCAGAGG + Intronic
1181578892 22:23815956-23815978 CAGCATCCTAACAGCCTGCGGGG - Intronic
1181775757 22:25159089-25159111 CAGGCTCCTGTCGGCCTCAGAGG - Intronic
1182092884 22:27608095-27608117 CAGCCTGCACCCAGCATCAGGGG + Intergenic
1182646596 22:31815081-31815103 CTGGCTCCTCACTTCCTCAGTGG - Exonic
1183457759 22:37932004-37932026 CAGCCTCCTTAGAGTCCCAGGGG - Intronic
1183675200 22:39295205-39295227 GACCATCCTCACAGCCTCAGGGG - Intergenic
1183714342 22:39525047-39525069 GACCCTCCTCACAGCCTCTCAGG - Intergenic
1184490230 22:44804093-44804115 CACCCTCCTCAAAGCCACATGGG + Intronic
1184570708 22:45323015-45323037 CCGTCTCCCCACAGCGTCAGAGG + Intronic
1184691005 22:46117230-46117252 CAGCCTCCCCCCAGGCTCTGGGG - Intergenic
1184715234 22:46278221-46278243 CAGTGCCCTCAGAGCCTCAGGGG + Intronic
1184852696 22:47129807-47129829 CAGCCTCCTCACACCGCCAGAGG + Intronic
1185149103 22:49154150-49154172 CAGCCTCCTCCCCGCTGCAGGGG + Intergenic
1185190403 22:49432777-49432799 CAGCCTCCCAACGGCCCCAGGGG + Intronic
1185374695 22:50476922-50476944 CAGCCTGCACACAAGCTCAGTGG - Intergenic
950431634 3:12954339-12954361 CTCCCCCCTCACAGCTTCAGGGG + Intronic
950626466 3:14251120-14251142 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
952817392 3:37457499-37457521 CTGCCTTCTCATAACCTCAGTGG + Intronic
952894145 3:38065296-38065318 CAGCCTCCGCTCGGCATCAGAGG + Intronic
953917953 3:46932654-46932676 GGGCCACATCACAGCCTCAGGGG + Intronic
954800719 3:53185626-53185648 CAGCCTCCTCAGAGCCTGTTGGG + Exonic
954999995 3:54918759-54918781 CAGTGTCCTCGCAGGCTCAGTGG - Exonic
956803703 3:72787752-72787774 CAGCCTCCGCTCGGCATCAGAGG - Intronic
956839204 3:73121416-73121438 CAGCTGCCTCAGAGCCTCAGAGG - Intergenic
961145878 3:124592829-124592851 CAGCCTCCTGGCTGCCTCACAGG - Intronic
961447158 3:126986235-126986257 CAGGCTCCTCACAGTGGCAGTGG - Intergenic
961714033 3:128846681-128846703 AAGCTTCCTCAGAGCCTCCGTGG - Intergenic
961837091 3:129671177-129671199 CAGCATCCACACAGACTCTGTGG - Exonic
962263057 3:133927214-133927236 CAGCCTCCCCACTGCGTCACTGG - Intergenic
962787796 3:138784467-138784489 CAGCCTCCGCTCGGCATCAGAGG - Intronic
966967086 3:185004438-185004460 CAGCCTCGGCTCGGCCTCAGAGG + Intronic
968089011 3:195888590-195888612 CTGCCGCCTCCCAGCCTCTGTGG + Exonic
968156402 3:196385040-196385062 CAGCCTCGGCTCAGCATCAGAGG - Intronic
968598153 4:1495909-1495931 CAGCCTCCCCACATCCACTGTGG - Intergenic
968771729 4:2511804-2511826 CACCCTCCTCCCACCCACAGAGG - Intronic
968817889 4:2831215-2831237 CAGCCCACTCAGAGCCACAGGGG - Intronic
969508499 4:7603117-7603139 CAGCCTCCGCTCGGCATCAGAGG + Intronic
969708882 4:8831489-8831511 CAACCTCCACACAGGCCCAGTGG + Intergenic
969857847 4:10014448-10014470 CAGCCTGCTCATAGCCTGGGTGG + Intronic
969866546 4:10080183-10080205 GAACATCCTCTCAGCCTCAGGGG + Intronic
970249321 4:14097329-14097351 CAGTGTCCTCACAGCCTCCGAGG + Intergenic
971266335 4:25099324-25099346 CAGGATGCTAACAGCCTCAGAGG + Intergenic
971757672 4:30722471-30722493 CAGCCGCCTCACCGACTCGGTGG - Exonic
972541532 4:40043444-40043466 CAACCTCGTCACAGCCTCCATGG - Intergenic
972938321 4:44167380-44167402 CAGCCTCCGCTCGGCATCAGAGG - Intergenic
974415959 4:61607071-61607093 CAGTCTCCCCAAAGACTCAGAGG + Intronic
975733159 4:77357081-77357103 CAGCCTTCTCACAGGCACAGAGG + Intronic
976131898 4:81893290-81893312 CAGCCTCTTCCCACCTTCAGAGG - Intronic
978606351 4:110484236-110484258 TAGCCTCCTCACAGCGTTATGGG - Intronic
978866245 4:113515092-113515114 CAAACGCATCACAGCCTCAGAGG - Exonic
980548333 4:134299569-134299591 CAGCCTCCTCAGACCCTCCCTGG + Intergenic
980722408 4:136716169-136716191 CAGGCTCCTCCCAGCTGCAGAGG - Intergenic
982315701 4:154029398-154029420 CAACCTCCTCAAGGCCTCAGGGG - Intergenic
984702599 4:182827801-182827823 CTGGCTTCTGACAGCCTCAGAGG + Intergenic
985633890 5:1026754-1026776 CAGCATCCTCCCAGCCCCCGAGG + Intronic
985752051 5:1686361-1686383 CAGCCTCCAGACATCCCCAGTGG - Intergenic
986258189 5:6119310-6119332 CAGCCTCTTCACTGCCTCTGGGG - Intergenic
987857393 5:23438382-23438404 CAGTCTCCTCAAAGGCTCAGAGG - Intergenic
987998367 5:25315394-25315416 CATCCTCCTCACAGCACCATAGG - Intergenic
990498445 5:56371971-56371993 CAGCCTCGGCTCAGCATCAGAGG - Intergenic
991609993 5:68440155-68440177 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
995047944 5:107671285-107671307 CAGCCTCCTCTGTGCCTTAGCGG + Intergenic
996876658 5:128248242-128248264 TAGATTCCTCACAGCCTCTGTGG + Intergenic
997396154 5:133561496-133561518 CTGCCTGCTCACCGTCTCAGAGG - Intronic
997469162 5:134107217-134107239 GGGACTGCTCACAGCCTCAGAGG + Intergenic
999183539 5:149688301-149688323 CAGCCACCTCTCTGCCTGAGAGG + Intergenic
999240125 5:150122655-150122677 CAGCCTCCACACTGCCTCTCAGG - Intronic
999286980 5:150399952-150399974 CAGCCTCCCCGCAGGCTCACTGG - Exonic
1000732759 5:164856467-164856489 CAGCCACCTCATAGGATCAGTGG - Intergenic
1001890894 5:175337568-175337590 CAGTCTCCTCAAAGTCTCAAGGG - Intergenic
1002089800 5:176797797-176797819 CCGCCTCCTGCCAGCCTCACAGG - Intergenic
1002200791 5:177526848-177526870 CTGCTGCCTCACAGCCTCAATGG - Intronic
1002467860 5:179416711-179416733 GAGCCTCCCCACAGGCTCGGAGG + Intergenic
1003280226 6:4684762-4684784 CAGGCACCTCACAGCAGCAGGGG + Intergenic
1004920381 6:20370364-20370386 CATCCTTCCCACATCCTCAGAGG + Intergenic
1006460672 6:34155800-34155822 CATCTTCATCACAGCCCCAGAGG + Intergenic
1007210031 6:40186131-40186153 CAGTCTCCACAAAGTCTCAGAGG + Intergenic
1007340604 6:41188854-41188876 CAATCTGCTCACAGCCTCTGAGG - Intergenic
1008539919 6:52537689-52537711 CAGACTCCTCACAGTCCCACAGG + Intronic
1013409179 6:109868963-109868985 CAGCCACCCCTTAGCCTCAGGGG - Intergenic
1017297370 6:152813884-152813906 CAGCCTCCACACAGCATGATGGG + Intergenic
1018743553 6:166747890-166747912 CTGCCTTCTCACAGCTGCAGAGG - Intronic
1018851604 6:167644554-167644576 CAGCCTCCGCCCAGGCTCTGAGG - Intergenic
1019267200 7:124499-124521 AGGCCTCCTCCCAGCCTCGGGGG - Intergenic
1019568205 7:1695168-1695190 CAGAACCCTCACAGCCCCAGCGG - Intronic
1020016841 7:4836216-4836238 CAGCCTCGGCACAGCCAGAGGGG + Intronic
1020899802 7:13990439-13990461 CCTCCTCCCCACAGCCACAGTGG - Intronic
1021496092 7:21276241-21276263 CAGCCTCCTCCCCTCCCCAGAGG + Intergenic
1021510529 7:21428135-21428157 CAGCCTCCTCCGAGCCACCGCGG + Exonic
1022700172 7:32753210-32753232 CAGCCTCCGCTCGGCATCAGAGG - Intergenic
1024048196 7:45599582-45599604 AAACCTCCTCACAGCCCCCGAGG - Intronic
1024306996 7:47937684-47937706 CGGCCACCCCATAGCCTCAGAGG - Intronic
1024775447 7:52779571-52779593 AAGTCTCCTCAAAACCTCAGAGG - Intergenic
1024891544 7:54210165-54210187 CACCCACCTCCCAGCCACAGTGG + Intergenic
1025813891 7:64892062-64892084 CAGCCTGCTCAGGGCCACAGAGG - Intronic
1025996401 7:66530079-66530101 CACCCGCCTCACAGGCTAAGAGG - Intergenic
1026586399 7:71659529-71659551 CAGCTTCCTTACAGCCTGACGGG + Intronic
1026837845 7:73650017-73650039 CAGCTTCCTCCCAGCCCCACGGG + Intergenic
1028595825 7:92545770-92545792 CAGCCTCCTCTCGGCATCAGAGG + Intergenic
1028599726 7:92589288-92589310 CAGCCCCCTCCCCGCCCCAGCGG + Intronic
1029181602 7:98705798-98705820 CAGCTTCATCACAGATTCAGAGG - Intergenic
1029734335 7:102457270-102457292 CACACTGCTCACAGCATCAGGGG + Exonic
1030692542 7:112551056-112551078 CAGCTTCCGCTCAGCATCAGAGG - Intergenic
1031648364 7:124254871-124254893 CTACATCCTCACAGCCTCTGAGG - Intergenic
1032096452 7:128940645-128940667 CAGCCTCCACCCGGCCCCAGGGG - Intronic
1032858351 7:135855864-135855886 CTGATTCCCCACAGCCTCAGTGG + Intergenic
1033499719 7:141935760-141935782 CACACTCCACACAGCCTCAGTGG - Intronic
1035284967 7:157800018-157800040 CAGCCTCCTCTGTCCCTCAGAGG + Intronic
1035445067 7:158935663-158935685 CAGGCTCCCAACAGCCACAGGGG - Intronic
1035549954 8:514679-514701 CAGTCACCTCAGTGCCTCAGTGG + Intronic
1035796969 8:2366722-2366744 CTGCCTCCTCAGAGCCACCGGGG - Intergenic
1036515043 8:9436226-9436248 CAGCCTCTTCAAAGGCTCAAAGG + Intergenic
1037164371 8:15809214-15809236 CAACATCCTCACACCCTCACTGG - Intergenic
1037578819 8:20232567-20232589 CAGCCTCCTTCCTGCCCCAGAGG + Intergenic
1037950833 8:23017943-23017965 AAGCCTACTCACACCCTCACTGG + Exonic
1038198890 8:25393379-25393401 CAGTTACCTCACTGCCTCAGTGG + Intronic
1039300634 8:36205148-36205170 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
1040755707 8:50771712-50771734 CAGTCTCATCACAGGCTGAGAGG + Intronic
1040830030 8:51665861-51665883 CAGCTTCCTCACATCATCACAGG - Intronic
1041008015 8:53514756-53514778 CAGCCTCAGCAGAGCCACAGTGG + Intergenic
1041066118 8:54085038-54085060 CAGCCTCGTCTCGGCATCAGAGG - Intronic
1043399207 8:79867287-79867309 CAACCCCCTCACACCCACAGTGG + Intergenic
1043517443 8:81007734-81007756 AGACCTCCTCAAAGCCTCAGTGG - Intronic
1043958701 8:86390652-86390674 CAGCCTCGGCTCAGCATCAGAGG + Intronic
1044269023 8:90218296-90218318 CAACCTCCTCTCAGCCCCACTGG + Intergenic
1044958990 8:97511236-97511258 CAGCCCCCTCAAAGCCTTATAGG - Intergenic
1045022060 8:98052475-98052497 CAGCCTCCGCTCGGCATCAGAGG + Intergenic
1045235641 8:100350796-100350818 CAGCCTCCGCTCGGCATCAGAGG - Intronic
1046259007 8:111741356-111741378 CAGGCTCCTCCCAGCCACAAAGG - Intergenic
1047531840 8:125684078-125684100 AGGACTCCTCACTGCCTCAGAGG + Intergenic
1047763322 8:127970199-127970221 CTGTCTCCTCAGACCCTCAGGGG + Intergenic
1047959765 8:130002668-130002690 AAGTCTCCTCACAGCCTCCATGG + Intronic
1049130560 8:140836409-140836431 TAGCCACCTCATAGCCTAAGAGG - Intronic
1049347051 8:142144731-142144753 CAGGGTCCCCCCAGCCTCAGTGG + Intergenic
1049553282 8:143270462-143270484 CAGCCTCCTCGCAGTCCCTGGGG - Intronic
1049686340 8:143940739-143940761 GTGCCCCCTCACGGCCTCAGGGG - Intronic
1050765909 9:9133709-9133731 CAGCATCCTTACAGACTCAGTGG - Intronic
1051393941 9:16598765-16598787 CAGACTCATCACAGCTTAAGAGG + Intronic
1052705775 9:31991758-31991780 CAGTTTCTTCACAGCATCAGTGG - Intergenic
1055649711 9:78395384-78395406 CAGTCTCCCCAAAGGCTCAGAGG - Intergenic
1056166645 9:83947551-83947573 CAGCCTCCCCTCGGCATCAGAGG - Intronic
1056814543 9:89791930-89791952 CAGCCTGCTCTCAGCCTGTGCGG - Intergenic
1057391020 9:94641482-94641504 CTGTCTCCTCAAAGCCCCAGAGG + Intergenic
1057553222 9:96067255-96067277 CGGCCTCCACACAGCCTCCAAGG + Intergenic
1057846637 9:98531110-98531132 CAGGATCCTCACAGCTTGAGTGG + Intronic
1058390566 9:104490537-104490559 CAGCCTCCGCTCGGCATCAGAGG + Intergenic
1058696611 9:107564381-107564403 CAGCATCCTCTCAGGCTCATGGG - Intergenic
1058876541 9:109249789-109249811 CAACCTCCTCCCACCCTCCGGGG + Intronic
1060216466 9:121741417-121741439 CTGCCTCCTGACAGCCTGTGTGG + Intronic
1060874890 9:127075643-127075665 CAGCCTCCTCTCACCCCAAGGGG - Intronic
1061782949 9:133006538-133006560 CAGCATTCCCAGAGCCTCAGAGG - Intergenic
1061848274 9:133400320-133400342 CAGGCTCCTACCAGCCTCTGGGG + Intronic
1061913621 9:133737982-133738004 CCTCCTCCTCCCAGGCTCAGGGG + Intronic
1062073206 9:134570222-134570244 CTGCCTCCTCACTGCCTCCTTGG + Intergenic
1062183688 9:135204974-135204996 CAGCATCCTCACAGCGGCTGGGG + Intergenic
1062191627 9:135250852-135250874 CAGCCATCTGACAGCCTCAGGGG + Intergenic
1062594021 9:137289400-137289422 CAGCCTCCTCAGACCCTCGCTGG - Intergenic
1062646678 9:137551521-137551543 ACGCCACCTCACGGCCTCAGGGG + Exonic
1203427509 Un_GL000195v1:55008-55030 CAGCCTCCTAACATGCACAGTGG + Intergenic
1185772411 X:2774495-2774517 GGGCATCCTCACAGCCTCAAGGG + Intronic
1187249522 X:17584257-17584279 CTCCCTCCTCAGAGCCTCTGAGG - Intronic
1187821851 X:23296478-23296500 CAGCCTTCACACCTCCTCAGGGG - Intergenic
1189554912 X:42132332-42132354 CACCCTCCTCAAAGCCTCCTGGG + Intergenic
1189588583 X:42487816-42487838 CATCCACCTCAATGCCTCAGGGG + Intergenic
1189953632 X:46257177-46257199 CAGCCTCCTCAAAACTTCAGAGG + Intergenic
1190145492 X:47888140-47888162 CAGGCTCCTCACAACTTCACAGG - Intronic
1192324679 X:70122481-70122503 CAGCCTCCGCTCGGCATCAGAGG - Intergenic
1192804710 X:74498534-74498556 CAGTCTCCCCAAAGGCTCAGAGG - Intronic
1193054100 X:77131636-77131658 CTGCATCCACATAGCCTCAGAGG - Intergenic
1193890143 X:87033931-87033953 CAGCCTCCGCTCGGCATCAGGGG + Intergenic
1194112685 X:89854426-89854448 CTGCCTCCACACATCCACAGAGG - Intergenic
1194620039 X:96160159-96160181 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
1195319997 X:103714063-103714085 TAGGGTCCTCACAGCCTCAGTGG + Intronic
1195888810 X:109670663-109670685 CAGCCTCCGCTCGGCATCAGAGG - Intronic
1198189278 X:134286668-134286690 CAGCCTCCGCTCGGCATCAGAGG + Intergenic
1199428791 X:147735098-147735120 CAACCTCTTTACTGCCTCAGGGG - Intergenic
1200465338 Y:3509237-3509259 CTGCCTCCACACATCCACAGAGG - Intergenic
1201948169 Y:19535237-19535259 CAGCCTCCGCTCGGCATCAGGGG - Intergenic