ID: 900343736

View in Genome Browser
Species Human (GRCh38)
Location 1:2200946-2200968
Sequence CCAGTTCAGCACGTTTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900343728_900343736 24 Left 900343728 1:2200899-2200921 CCCCAGGGAAGGTCTGGCTTCTC 0: 1
1: 0
2: 5
3: 31
4: 229
Right 900343736 1:2200946-2200968 CCAGTTCAGCACGTTTTTATGGG 0: 1
1: 0
2: 0
3: 9
4: 67
900343729_900343736 23 Left 900343729 1:2200900-2200922 CCCAGGGAAGGTCTGGCTTCTCG 0: 1
1: 0
2: 0
3: 14
4: 140
Right 900343736 1:2200946-2200968 CCAGTTCAGCACGTTTTTATGGG 0: 1
1: 0
2: 0
3: 9
4: 67
900343730_900343736 22 Left 900343730 1:2200901-2200923 CCAGGGAAGGTCTGGCTTCTCGG 0: 1
1: 1
2: 0
3: 21
4: 160
Right 900343736 1:2200946-2200968 CCAGTTCAGCACGTTTTTATGGG 0: 1
1: 0
2: 0
3: 9
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900343736 Original CRISPR CCAGTTCAGCACGTTTTTAT GGG Intronic
900343736 1:2200946-2200968 CCAGTTCAGCACGTTTTTATGGG + Intronic
903312759 1:22472702-22472724 TCAGTTCAGCATATATTTATTGG + Intronic
911195940 1:94995778-94995800 ACAGTGAAGGACGTTTTTATTGG - Intronic
911780405 1:101869220-101869242 CCACTTCAGCCTGTTTTCATGGG - Intronic
912234253 1:107831985-107832007 CCAATTCAGTAAGTTCTTATGGG - Intronic
916812066 1:168314403-168314425 TCAGTTCAGCAAATGTTTATTGG - Exonic
921103265 1:211950177-211950199 TCAGTTCAACAAGTATTTATGGG - Intronic
922283829 1:224151067-224151089 GTAGTTCAGTAAGTTTTTATTGG + Intronic
1063006671 10:1978304-1978326 CCATTGCAGCAGCTTTTTATAGG - Intergenic
1065770886 10:29077334-29077356 CTAATTCAGCAAGTATTTATTGG - Intergenic
1068840064 10:61602347-61602369 CCAGTTCATCACTTTATCATGGG + Intergenic
1075923488 10:126232692-126232714 CCAGCTGAGCATGTATTTATTGG - Intronic
1079680819 11:23295452-23295474 CTAGTTCAGCTCCTTTTTACTGG - Intergenic
1086924148 11:92622069-92622091 CCAGTTCACCACATTTTTTAAGG - Intronic
1093367700 12:18323862-18323884 CCACTTCAGCACTTTGTTTTTGG - Intronic
1093603968 12:21067027-21067049 TCTGTTCATCACCTTTTTATAGG + Intronic
1101485319 12:105151774-105151796 CCAGCCCAGCTCATTTTTATTGG + Intronic
1102804519 12:115767857-115767879 CCAGTTCACCATCTCTTTATTGG + Intergenic
1106143179 13:27028074-27028096 CAAGTTGAGCACGTCTTTGTTGG - Intergenic
1125188366 15:36959470-36959492 TTAGTTCAACACGTATTTATTGG - Intronic
1125278660 15:38021117-38021139 CCAGTACAGCACTTTTTAATGGG + Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1130578138 15:85110991-85111013 GAAGTTGAGCACCTTTTTATTGG + Intronic
1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG + Intergenic
1145977333 17:28991892-28991914 CCAGTTTAGGAGGATTTTATGGG + Intronic
1147814927 17:43202351-43202373 GCAGTTCAGCAGGTTTCTAATGG + Intronic
1150674815 17:67235655-67235677 TCAGTTCAGCAAGTATTTATTGG - Intronic
1155950051 18:31902012-31902034 CCAGTTCAGCATATTTTTGGTGG - Intronic
1156770901 18:40723424-40723446 CCTTTTCAGCACGTTATTTTTGG - Intergenic
1161459878 19:4390196-4390218 CCTGGTCAGCAGGTTTTTCTAGG + Intronic
1161777019 19:6269176-6269198 CCAGTGCAGCCTGTTTTTATTGG - Intronic
930689614 2:54347423-54347445 CCAGTTCATCAAATTTTTATTGG - Intronic
931220702 2:60285838-60285860 CCACTTCAGAAGCTTTTTATGGG + Intergenic
941578218 2:167262806-167262828 ACAATTCAGCACAATTTTATGGG - Intergenic
1170129357 20:13002035-13002057 CCAGGTCACCATCTTTTTATAGG + Intergenic
1172227532 20:33315032-33315054 CCACTTCACAACGTTTTTATAGG - Intergenic
951236475 3:20241534-20241556 CCTGGTCAGCAGGTTTATATTGG - Intergenic
953394069 3:42553008-42553030 CCAGTTCAGCACGTTTACCTAGG - Exonic
956321616 3:68003791-68003813 AAAGTTCAGAAGGTTTTTATTGG + Intergenic
962708858 3:138068913-138068935 CCGGATCAGCAAGTTTTTATGGG + Intronic
976528706 4:86124597-86124619 CCATTTCAGCACATTCTTGTGGG - Intronic
977331912 4:95646718-95646740 CCATTTCACCACTTATTTATTGG + Intergenic
988150505 5:27372325-27372347 CCAATTCAGAACGTTTCTATTGG + Intergenic
988942912 5:36163981-36164003 TCAGTGCAGCATGTGTTTATGGG + Intronic
992546247 5:77816835-77816857 CCAGCTCAGCAGGTTGTTTTGGG - Intronic
994180623 5:96761454-96761476 TCATTTCAGCATGTTATTATTGG - Exonic
994451744 5:99951861-99951883 CCAGTTCAGGACTTTTTCAAAGG - Intergenic
998596417 5:143535249-143535271 CTAGTTGTGCACGTTTTTTTGGG + Intergenic
1005282878 6:24293327-24293349 CAAGTTCAGTAAATTTTTATGGG + Intronic
1007228791 6:40333767-40333789 TCTATTCAGCACGTTCTTATTGG - Intergenic
1008381168 6:50841229-50841251 CCAGTTCAGAATGTCTTTTTTGG + Intronic
1008430741 6:51413700-51413722 ACAGTTCAGCATGATTTTAGAGG - Intergenic
1012425595 6:99110819-99110841 TCAGTTCAGAAAGTATTTATTGG - Intergenic
1015035456 6:128648315-128648337 GCAGTTCAGAACTTTTTTACTGG + Intergenic
1016339898 6:143051272-143051294 TCAGTTCAGCACTTTTTAAAAGG + Intergenic
1019684049 7:2370650-2370672 TCATTTCAGAACGTTTTCATCGG + Intronic
1030238477 7:107293010-107293032 CCAGTTCTGCATCTTGTTATTGG + Intronic
1031273075 7:119679160-119679182 CAAATTCAGCACATTTTTGTTGG - Intergenic
1033588760 7:142793341-142793363 CCAGACCAGAACATTTTTATTGG - Intergenic
1034470859 7:151253705-151253727 CCTGTGTGGCACGTTTTTATGGG - Intronic
1046402874 8:113729952-113729974 CCAGTTCAGTTAGTTTTTAAAGG - Intergenic
1048693648 8:136997879-136997901 CAAGTTCAGCATATTTTTGTGGG + Intergenic
1055154065 9:73039081-73039103 CCAGTTGAGGACTTTTTTAGGGG - Intronic
1056378943 9:86040135-86040157 CAATTTCAGAACATTTTTATTGG - Intronic
1057288408 9:93780137-93780159 CCAATTGAGCATGTTTTTAAGGG + Intergenic
1060108543 9:120890396-120890418 ACATTTCAGTACATTTTTATGGG - Intronic
1060147158 9:121262929-121262951 GATGTTTAGCACGTTTTTATTGG - Intronic
1060464457 9:123890338-123890360 CCATTTAAGCACATTTTTCTGGG - Intronic
1062684926 9:137807264-137807286 TCAGTTGAGCAGGTTTTTGTTGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189268298 X:39733043-39733065 CCAGTTCAGCAAATATTTACTGG - Intergenic
1189610987 X:42734706-42734728 CCAGTTCATCAATTTTTTAATGG - Intergenic
1193773107 X:85611005-85611027 CTAGTACAGCAGGTTTTTAAAGG - Intergenic
1198004224 X:132475645-132475667 CTATTACAGGACGTTTTTATTGG + Intronic
1198542582 X:137655759-137655781 CCTGTTTATCACGTTGTTATAGG + Intergenic
1199813505 X:151374899-151374921 CCAGTTTATCACATTTTTAATGG - Intergenic
1201456296 Y:14170575-14170597 CCAGATCATCATGTTTTTAAAGG - Intergenic