ID: 900343781

View in Genome Browser
Species Human (GRCh38)
Location 1:2201214-2201236
Sequence TTCCAACACAGGGGCAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900343781_900343798 28 Left 900343781 1:2201214-2201236 CCCTCGCTGCCCCTGTGTTGGAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 900343798 1:2201265-2201287 GCGCATCCTCCAGAGGGTCAGGG 0: 1
1: 0
2: 1
3: 5
4: 112
900343781_900343787 -9 Left 900343781 1:2201214-2201236 CCCTCGCTGCCCCTGTGTTGGAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 900343787 1:2201228-2201250 GTGTTGGAAAATAAGGACAGTGG 0: 1
1: 0
2: 1
3: 27
4: 249
900343781_900343789 -5 Left 900343781 1:2201214-2201236 CCCTCGCTGCCCCTGTGTTGGAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 900343789 1:2201232-2201254 TGGAAAATAAGGACAGTGGGTGG 0: 1
1: 1
2: 0
3: 28
4: 366
900343781_900343790 0 Left 900343781 1:2201214-2201236 CCCTCGCTGCCCCTGTGTTGGAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 900343790 1:2201237-2201259 AATAAGGACAGTGGGTGGCCTGG 0: 1
1: 0
2: 3
3: 20
4: 258
900343781_900343793 21 Left 900343781 1:2201214-2201236 CCCTCGCTGCCCCTGTGTTGGAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 900343793 1:2201258-2201280 GGGCCCTGCGCATCCTCCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 187
900343781_900343791 1 Left 900343781 1:2201214-2201236 CCCTCGCTGCCCCTGTGTTGGAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 900343791 1:2201238-2201260 ATAAGGACAGTGGGTGGCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 197
900343781_900343788 -8 Left 900343781 1:2201214-2201236 CCCTCGCTGCCCCTGTGTTGGAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 900343788 1:2201229-2201251 TGTTGGAAAATAAGGACAGTGGG 0: 1
1: 0
2: 2
3: 19
4: 278
900343781_900343794 22 Left 900343781 1:2201214-2201236 CCCTCGCTGCCCCTGTGTTGGAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 900343794 1:2201259-2201281 GGCCCTGCGCATCCTCCAGAGGG 0: 1
1: 1
2: 2
3: 17
4: 187
900343781_900343797 27 Left 900343781 1:2201214-2201236 CCCTCGCTGCCCCTGTGTTGGAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 900343797 1:2201264-2201286 TGCGCATCCTCCAGAGGGTCAGG 0: 1
1: 0
2: 0
3: 15
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900343781 Original CRISPR TTCCAACACAGGGGCAGCGA GGG (reversed) Intronic
900343781 1:2201214-2201236 TTCCAACACAGGGGCAGCGAGGG - Intronic
902572667 1:17356676-17356698 CTCCAACACAGGGGCTTTGAGGG + Intronic
903928784 1:26850311-26850333 TGCCCACCCAGGGGCAGTGATGG - Exonic
907803117 1:57791239-57791261 TTCCAACACAGGGGGGCCTAGGG - Intronic
911745582 1:101438541-101438563 TACCAGCACTGGGGCAGGGAAGG - Intergenic
919349294 1:196428860-196428882 TGCCCACACATGGGCAGCCAGGG + Intronic
920356756 1:205379043-205379065 TTCTAACACAGAGGCTGCCAAGG + Intergenic
1066497973 10:35960709-35960731 CTGCAACAGAGGGTCAGCGAAGG + Intergenic
1069774237 10:70917606-70917628 TGCCATCACAGTGGCAGTGATGG + Intergenic
1071584192 10:86803322-86803344 TTCCAACACTGTGGAAGCCAAGG - Intronic
1072367607 10:94729749-94729771 TTCCCAAACAGGGGCTGCGTGGG + Intronic
1075778211 10:125001515-125001537 TTCCAACAGAGGGGCTCGGAAGG + Intronic
1076181760 10:128414798-128414820 TTCCAACTCAGGACCAGCCAGGG - Intergenic
1077218474 11:1404921-1404943 TCAGGACACAGGGGCAGCGAGGG - Intronic
1083735434 11:64677601-64677623 TTCCAACAGAGGGTGAGAGAGGG + Intronic
1086462419 11:87018956-87018978 TGCCACCACAGGGACAGCTAGGG - Intergenic
1096386367 12:51197636-51197658 TTCCAACACATCAGCAGAGATGG - Intronic
1098772145 12:74566144-74566166 TTCCATGACAGGTGCAGAGAAGG - Intergenic
1102000456 12:109554615-109554637 TGCAAACACTGGGGCAGCGGGGG + Exonic
1103956163 12:124578056-124578078 TGCCAAGACAGGGGCAGTGCAGG + Intergenic
1104378128 12:128283314-128283336 TTCCAAAACTGGGGCAGGGAAGG - Intronic
1104637731 12:130448518-130448540 TGCCAGCACAGGGGCAGCGCTGG - Intronic
1112133680 13:96552336-96552358 GATCAACACAGGGGCAGCTATGG + Intronic
1113258152 13:108529900-108529922 TTACAGCACAGGGGCAGAGTGGG + Intergenic
1117777656 14:59199084-59199106 TGCCAAGGCAGGGGCAGCCAAGG - Intronic
1119091767 14:71789485-71789507 TTCAAACACAGTGCCAGCCATGG - Intergenic
1119155422 14:72405754-72405776 TTCCAGCAGAGGGGCAGGCAAGG - Intronic
1122415500 14:101547758-101547780 TTACAAGACAGGGACAGAGATGG + Intergenic
1124112453 15:26804592-26804614 TTCCCACACAGAGGCAGTCAGGG - Intronic
1131566117 15:93487024-93487046 TCCCAACACAGGAGTAGCGCCGG + Intergenic
1132404550 15:101534525-101534547 TTCCAAGACAGCGTCAGAGAGGG - Intergenic
1132775288 16:1590309-1590331 CTCCAAGACAGGGGCAGAGGAGG - Intronic
1134205723 16:12236629-12236651 TTCCAACACAGTGGGACAGATGG - Intronic
1134355898 16:13482070-13482092 TTCCAGCACCAGGGCAGGGATGG - Intergenic
1137697188 16:50469208-50469230 TTGCCACACAGGGGCAATGAAGG - Intergenic
1138475019 16:57265439-57265461 TGGCAACACAGTGGCAGCGGAGG - Intronic
1146722279 17:35131912-35131934 TACCAACACGGGGGAAGAGAGGG + Exonic
1152481837 17:80559436-80559458 TTCCAGGACTGGGGCAGGGAGGG - Intronic
1154347079 18:13551230-13551252 TTCCGACAGAGCAGCAGCGAGGG + Intronic
1155254445 18:23982432-23982454 TGCTCACAGAGGGGCAGCGATGG + Intergenic
1155258994 18:24023299-24023321 TTCCAAGGCAAAGGCAGCGACGG - Intronic
1161473880 19:4473942-4473964 TTCCACCAAAGGGGCATCCAAGG - Intronic
1163538390 19:17891809-17891831 TTCCAAAACAGGGGTAGGCATGG - Intronic
1163627075 19:18396403-18396425 GGCCAGCACAGGGCCAGCGATGG + Exonic
1166660591 19:44644294-44644316 TTCCAACCCCGGGGCAGAGATGG - Intronic
925461470 2:4067143-4067165 CTCCAAGGCAGGGGCAGGGAGGG + Intergenic
925711256 2:6743055-6743077 TTCCGTCACATGGCCAGCGATGG - Intergenic
926976284 2:18519990-18520012 TTGGAAGACAGGGGCAGCAAGGG + Intergenic
927936765 2:27080517-27080539 TTCCAGCACAGGGCAAGGGAAGG + Intronic
928381241 2:30820806-30820828 TTGGAAAACAGGAGCAGCGAGGG + Intergenic
931738016 2:65215638-65215660 TTCCAACAAAGTGACAGCTAAGG - Intergenic
932276234 2:70454270-70454292 TGCCAAGACAGGGGCTGGGATGG - Intronic
932459344 2:71872479-71872501 TTCCCCCACAGGGCCAGGGAGGG - Intergenic
935214199 2:100963228-100963250 AGCCAAGACAGGGGCAGGGAAGG + Intronic
936037398 2:109123788-109123810 GTCCAAAACAGGTGCAGCCATGG - Intergenic
944301824 2:198132320-198132342 TTCCAACTCAAGGTCAGCGTGGG + Intronic
945773605 2:214077580-214077602 TGCCTGCACAGGGGCAGCCAAGG - Intronic
946638579 2:221757863-221757885 GTCCAACACTGTGGCAGAGATGG + Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1173553292 20:43948380-43948402 TTCCAACACAGTGGAAGAGCAGG - Intronic
1173760524 20:45555757-45555779 TTCAAATACAGGGGCTGCGAAGG - Exonic
1174432012 20:50477208-50477230 TACCACAACAGGGGCAGGGAGGG + Intergenic
1175310036 20:58005478-58005500 TTCCAACACAGGGGACTCAAGGG + Intergenic
1176914192 21:14605086-14605108 TTCAAATACAGAGGCAGCAAGGG + Intronic
1178916300 21:36707414-36707436 CTCCACCACGGGGGCAGCGGTGG - Intronic
1179647918 21:42786402-42786424 CCCCAACACAGCTGCAGCGATGG - Intergenic
1180090795 21:45533061-45533083 CTCCAACCCAGGAGCAGGGAGGG + Intronic
1180141766 21:45897580-45897602 GGCCAAAGCAGGGGCAGCGAGGG - Intronic
1180708285 22:17822913-17822935 TCCCACCACAGGGGCGGGGAGGG + Intronic
1182824655 22:33254294-33254316 TTCCAACACAGGCCCAACGAGGG - Intronic
1183893777 22:40951392-40951414 TTCCAAAATGGCGGCAGCGATGG + Exonic
1185395705 22:50586576-50586598 TTCAAGCACAGGGGTAGCCAGGG - Intronic
954429943 3:50465180-50465202 TTTGAACACAAAGGCAGCGATGG + Intronic
957465585 3:80586205-80586227 CTCCAACAGAGAGACAGCGAGGG + Intergenic
963237907 3:142973751-142973773 TTCCCAAACAGGGCCAGCCATGG - Intronic
965836095 3:172854468-172854490 TTCCAACACAAAGGCAAAGATGG - Intergenic
968893246 4:3383779-3383801 GCCCATCACAGGAGCAGCGATGG + Intronic
969436402 4:7191923-7191945 TCCCAACCCAGGGGCCACGAGGG - Intergenic
975398104 4:73901416-73901438 ATCCAACAGAGAGGCAGTGAGGG + Intergenic
975996987 4:80327223-80327245 TTCAAACACTGGGGCAGGGAAGG + Intronic
985977329 5:3430478-3430500 TGCCCTCACAGGAGCAGCGAGGG - Intergenic
995586404 5:113653197-113653219 TTCCAAGAAAGGGGCAGCTTAGG + Intergenic
996766710 5:127041564-127041586 TTCCATCACAGGGGCTTCGCAGG + Intergenic
997301262 5:132807374-132807396 TTCCAGCCCAGGGGAAGCAAAGG - Intergenic
999206513 5:149852093-149852115 TTCCAACAAAAGGCCAGCAAAGG - Exonic
999240726 5:150125866-150125888 TTCCATCTGAGGAGCAGCGAAGG - Intronic
1007114735 6:39335602-39335624 TTCCAACCCAGCTGCAGCCAGGG - Exonic
1007325298 6:41054881-41054903 TTCCAACACAGAGGGAGGGTAGG + Intronic
1008536010 6:52506684-52506706 ATCCAACACAAGGGCAGAGCTGG + Intronic
1010292549 6:74154966-74154988 TTCCAAGACTGGGGTAGGGATGG - Intergenic
1011527413 6:88280224-88280246 TTTCCACACAGGGACAGAGAAGG + Intergenic
1014496907 6:122136674-122136696 TTCCACCACAGTGTCAGTGATGG - Intergenic
1017302188 6:152874883-152874905 TTTCAACACAGTGGAAGGGAAGG + Intergenic
1019646136 7:2129989-2130011 ACCCAACAGAGGGGCAGGGATGG + Intronic
1020078986 7:5276429-5276451 TTCCAAGACAGGGGCAGGACTGG - Intronic
1023940871 7:44767765-44767787 TTCCAATTCAGGGGCAGGGCTGG - Exonic
1024974900 7:55104349-55104371 ATCCAGCACAGTAGCAGCGACGG - Intronic
1026896748 7:74013821-74013843 TTCCAACACCAGGGCAGGGCGGG + Intergenic
1029623875 7:101707473-101707495 CTCCCACACAGGGGCAGGAAAGG - Intergenic
1031084962 7:117293385-117293407 TGCCAGCACTGGGGAAGCGATGG - Intronic
1031127385 7:117790488-117790510 TTCCAACACTCGGGCACAGATGG - Intronic
1031398835 7:121306593-121306615 TTGCCACAAATGGGCAGCGAAGG + Intergenic
1032076552 7:128838780-128838802 TTCCGACACATGGACAGGGAAGG - Exonic
1032508310 7:132452445-132452467 GTCCAACACAAGGAAAGCGATGG + Intronic
1035566498 8:644678-644700 GACCAACACTGGGGCAGGGAGGG - Intronic
1037478324 8:19279153-19279175 TTCCAAGCCTGGGGCAGCGGCGG + Intergenic
1038885178 8:31655479-31655501 TTCCAACCTTGGGGCAGAGAAGG + Intronic
1039907606 8:41798095-41798117 TCCCAACCCAGGGGCACCCAGGG - Intronic
1044171480 8:89057692-89057714 TTCCTACACAGGGTCAGGGCAGG + Intergenic
1046552959 8:115739573-115739595 CACAAACACAGGGACAGCGAAGG + Intronic
1050319113 9:4432962-4432984 TTCTAACACAGGGTAAGCAATGG + Intergenic
1061213781 9:129208612-129208634 TTCCATCACAGGGGCGGCTGTGG - Intergenic
1061430270 9:130526474-130526496 TTGCAAGTCAGGGGCAGAGATGG + Intergenic
1192299590 X:69886113-69886135 TTCCCACACAGGGACACAGAGGG + Intronic
1193554729 X:82939353-82939375 TTCCAACACAGGAGGAGATAAGG + Intergenic
1197168609 X:123406775-123406797 TTCCAACACCAGTGCAGAGAGGG + Intronic
1197731596 X:129814763-129814785 TCCCCACCCAGGGGCAGTGATGG + Exonic
1198507746 X:137318174-137318196 TTCCAACTCTGGGGAAGCAAAGG + Intergenic
1199717208 X:150515319-150515341 GTCCAACACAGAGCCAGAGAAGG - Intergenic