ID: 900344098

View in Genome Browser
Species Human (GRCh38)
Location 1:2202998-2203020
Sequence TTGTCCAGTCACCAGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900344098_900344102 6 Left 900344098 1:2202998-2203020 CCAGCCAGCTGGTGACTGGACAA 0: 1
1: 0
2: 0
3: 20
4: 175
Right 900344102 1:2203027-2203049 TGTCCATCCGAGTGGGACACTGG 0: 1
1: 0
2: 0
3: 9
4: 60
900344098_900344101 -1 Left 900344098 1:2202998-2203020 CCAGCCAGCTGGTGACTGGACAA 0: 1
1: 0
2: 0
3: 20
4: 175
Right 900344101 1:2203020-2203042 ACAGTGCTGTCCATCCGAGTGGG 0: 1
1: 0
2: 4
3: 23
4: 131
900344098_900344100 -2 Left 900344098 1:2202998-2203020 CCAGCCAGCTGGTGACTGGACAA 0: 1
1: 0
2: 0
3: 20
4: 175
Right 900344100 1:2203019-2203041 AACAGTGCTGTCCATCCGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900344098 Original CRISPR TTGTCCAGTCACCAGCTGGC TGG (reversed) Intronic
900325975 1:2108881-2108903 TAGTCAAGGCACCAGCTGGGTGG + Intronic
900344098 1:2202998-2203020 TTGTCCAGTCACCAGCTGGCTGG - Intronic
901858505 1:12059412-12059434 TGGCCCAGGCAGCAGCTGGCAGG - Intergenic
902825479 1:18970658-18970680 TTTTCTAGACACCAGCTTGCTGG - Intergenic
903373916 1:22853951-22853973 TTGTCCTGTCAGCTGCTGGCTGG + Intronic
904056343 1:27672977-27672999 TTGACCTGCCACCAGATGGCTGG + Intergenic
904287362 1:29461127-29461149 CTGGCCAGTCACCAGGAGGCTGG + Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906949035 1:50319476-50319498 TGGGCCAGCCCCCAGCTGGCTGG - Intergenic
909034723 1:70583796-70583818 TTGTCCAGTCTGCAGCCTGCAGG + Intergenic
910109259 1:83664988-83665010 TTGTCCAACCCACAGCTGGCAGG + Intergenic
912591783 1:110829626-110829648 TTCTTTAGACACCAGCTGGCTGG + Intergenic
913239483 1:116817593-116817615 TTTTGCAGTCACATGCTGGCAGG - Intergenic
916316924 1:163459394-163459416 ATGTCCTGGCACCAGCTGACAGG - Intergenic
916608377 1:166365303-166365325 TCTTCCTGTGACCAGCTGGCTGG + Intergenic
919481191 1:198091816-198091838 TTGTTCAGTCACCAGCTCTGTGG + Intergenic
920438947 1:205965770-205965792 TTGTCCAGTCACCAGCACAAGGG + Intergenic
923426593 1:233876223-233876245 TTGACCTGCCACCAGGTGGCTGG - Intergenic
923456621 1:234170479-234170501 TGGTCAGGTCACCTGCTGGCAGG + Intronic
1063727164 10:8650270-8650292 TGTTCCAGTCACCAGCTTGAAGG + Intergenic
1068992056 10:63160327-63160349 TTTTCCAGTCACCAGCTTAATGG - Intergenic
1069662100 10:70130556-70130578 TTATCCACTCATCAGCTGACGGG + Intronic
1072034040 10:91548306-91548328 TTGTCCAGTCCACAGCCTGCAGG + Intergenic
1073332990 10:102683138-102683160 TTGTCCACACACCAGCTTCCTGG - Intronic
1074084464 10:110197416-110197438 CTGTCCAGTCACCTGTTGGTTGG - Intergenic
1074448767 10:113541918-113541940 TTGCCCATTCAACAGCTGTCAGG + Intergenic
1074452702 10:113572062-113572084 TTGCACAGCCACCAGCTGGATGG + Intronic
1074565222 10:114571550-114571572 TTGGACTGTCTCCAGCTGGCTGG - Intronic
1074887213 10:117703596-117703618 ATGCCCAGACACCAGCTGACTGG - Intergenic
1077394434 11:2314253-2314275 GTGTTCTGTCACCAGCAGGCAGG + Intronic
1078458382 11:11493686-11493708 TTATCTAGTCACCAACTGGGAGG - Intronic
1078885227 11:15493354-15493376 ATTTCCATTCACCTGCTGGCAGG - Intergenic
1081085604 11:38796496-38796518 TTGGCCAGACTTCAGCTGGCTGG + Intergenic
1081616315 11:44593395-44593417 CTGTCCAGGCCCCAGCTGCCCGG + Intronic
1083816584 11:65135738-65135760 CTGTCAAGTCAACAGGTGGCAGG - Intergenic
1088718446 11:112571172-112571194 GTGTTCAGTCATCAACTGGCTGG - Intergenic
1088770792 11:113034189-113034211 TTGTCCAGTCATGCGCAGGCAGG + Intronic
1089321378 11:117628946-117628968 CTGTCTAGCCAGCAGCTGGCTGG - Intronic
1091640329 12:2231114-2231136 ATTGCCAGTCACCAGCTGCCTGG - Intronic
1094422544 12:30286484-30286506 TTCTCCATTCACCAGTTGGTAGG + Intergenic
1094717628 12:33029068-33029090 TTGTCCATTCACTAGCTGTGTGG + Intergenic
1095372072 12:41480292-41480314 TTGCTCAGTCACCAAGTGGCTGG + Intronic
1096313166 12:50540012-50540034 TAATCCATTCACCAGCTGGCAGG + Intronic
1096875945 12:54630685-54630707 TTGGCCAGTCACAGGCTGCCTGG - Intergenic
1098302353 12:69067159-69067181 TTGCCCAGCCACATGCTGGCAGG - Intergenic
1102426755 12:112849874-112849896 TTGTCCAGTCAACTGCAGCCAGG + Intronic
1104639244 12:130456963-130456985 TTGGCCAGTAGCCAGGTGGCAGG - Intronic
1106000609 13:25719788-25719810 TGGTCCAGACATCAGCTTGCTGG + Intronic
1109254192 13:60058619-60058641 TTATCCACTCACCAGTTGGTGGG - Intronic
1122297266 14:100712612-100712634 TTGTCAAGACAGAAGCTGGCAGG - Intergenic
1122305840 14:100765982-100766004 TGGCTCAGTCACCAGATGGCTGG - Intergenic
1125417906 15:39472886-39472908 TTGTGCAATCACCACTTGGCAGG - Intergenic
1126195707 15:45928085-45928107 TTGACAACTCACCAGCTGGGAGG - Intergenic
1127473909 15:59314491-59314513 TTCTCCTGTGACCAGGTGGCAGG - Intronic
1127553600 15:60065480-60065502 ATTTCCAGTCACCAGCTGACAGG + Intergenic
1129799759 15:78405389-78405411 AGGTCGAGTCACCAGCTGGTGGG + Intergenic
1129806971 15:78469825-78469847 ACACCCAGTCACCAGCTGGCAGG + Intronic
1132023282 15:98383060-98383082 TGGTGCAGTCAGCAGCTGGAGGG - Intergenic
1132303448 15:100790427-100790449 TGTTCCTGTCACCAGCTGGCTGG - Intergenic
1132365492 15:101253546-101253568 GTGTCCAGTGAAAAGCTGGCCGG + Intergenic
1133664212 16:7949948-7949970 TTATCCAGTCATCAGTTGACAGG + Intergenic
1135134166 16:19875383-19875405 TTGTCCACACACCACCTGGGCGG + Intronic
1137707260 16:50544263-50544285 TTGGCCAGTCCCCACCTTGCTGG + Intergenic
1137765073 16:50971807-50971829 GTGTCCAGACACCAGTTGTCTGG - Intergenic
1138596603 16:58032539-58032561 GAGTCCATTCACCAGCTGGGTGG - Intronic
1139409885 16:66751118-66751140 TTGACCACTCTCCAGCTGACCGG + Intronic
1140107505 16:71974226-71974248 TGGCTCTGTCACCAGCTGGCTGG + Intronic
1141243807 16:82288008-82288030 TTATCCATTCATCAGCTGACGGG + Intergenic
1142976078 17:3645311-3645333 ATCTCCAGTCCCCTGCTGGCTGG - Intronic
1143649518 17:8254939-8254961 TTGTCCAGACAGCAGTAGGCAGG + Intronic
1144224245 17:13129287-13129309 TTGTCCAATCACCTGGTGTCTGG + Intergenic
1147138355 17:38447833-38447855 TTGCCCAGGCAACAGCAGGCTGG - Intronic
1147186668 17:38716822-38716844 TTGCCCAGTGCCCAGCTGGCTGG + Exonic
1151982239 17:77520090-77520112 TTGTCCAGTCACCAGTCATCTGG - Intergenic
1152285295 17:79409234-79409256 GTGTCCATTCTCCAGCTGACAGG + Intronic
1152375121 17:79914911-79914933 GTGTCCAGGCCCCAGGTGGCAGG - Intergenic
1152572391 17:81126577-81126599 TGGCGCAGTCACCAGCAGGCTGG + Intronic
1152999701 18:443012-443034 TGGTCCAGCCACCTGCTAGCAGG + Intronic
1154140124 18:11816219-11816241 TTATCCATTCACCAGCTGGTGGG - Intronic
1155339808 18:24802609-24802631 TTGGCCAGTCAGCAGCTGGGAGG + Intergenic
1157313006 18:46566322-46566344 TTGTCCAGCCAGCGGTTGGCGGG + Intronic
1160097375 18:75887398-75887420 TTGTCCATGCACCAGCTGAAAGG + Intergenic
1160527642 18:79546846-79546868 CTGTCCACTCCCCAGCAGGCTGG + Intergenic
1161742096 19:6027621-6027643 TTGTCCAGTGCCCAGCAGACTGG + Intronic
1163061363 19:14764510-14764532 GTGGCCAGTCACCTGCTGGATGG - Exonic
1165464680 19:35966731-35966753 TTGTCCAGTTCCAAGATGGCAGG + Intergenic
1166378921 19:42344440-42344462 GTGTCCAGCCGCCAGCTGCCTGG + Exonic
1166744969 19:45137260-45137282 TTGCCCATTCACCAGCTGACAGG - Intronic
925627105 2:5852475-5852497 TTGTCCAGGCCCCAGCAGGAAGG + Intergenic
925932521 2:8720655-8720677 TTGTTCTGTCACTAGCTGGGTGG + Intergenic
926359186 2:12069115-12069137 TTCTCCATTCACCAGCTGATGGG + Intergenic
926457257 2:13082217-13082239 TTCTCCAGTCACCACCTGTCTGG + Intergenic
926687101 2:15706542-15706564 TTGTCCAGTTTGCAGATGGCAGG - Intronic
930277420 2:49329560-49329582 TTGTTCAATCACCAGGTGACAGG - Intergenic
931571078 2:63669844-63669866 TTGTCCAGTGCACAGCTTGCAGG + Intronic
932577088 2:72968566-72968588 CTGTCCTGTCACCAGCTGTCAGG - Intronic
934056241 2:88253576-88253598 ATGGCCATTCACCAGCTGGCTGG - Intergenic
934732811 2:96670008-96670030 TTGTCCAGTCACTGCCTGCCCGG - Intergenic
938868003 2:135444514-135444536 TTTTCCAGTCACCAGCTCTCTGG - Intronic
939275473 2:139992215-139992237 TTGTTCCTTCACCAGCTGGAGGG + Intergenic
940064464 2:149611663-149611685 ATGTACAGACAACAGCTGGCTGG + Intergenic
941759086 2:169221086-169221108 TTGTACAGTCAGGACCTGGCAGG - Intronic
943739597 2:191396864-191396886 CTGTCCAGTAACCATCTTGCAGG + Intronic
944770455 2:202909290-202909312 TTTTCCATTCATCAGCTGGTGGG - Intronic
947851277 2:233290559-233290581 TAGGCCCTTCACCAGCTGGCAGG + Intronic
948726531 2:239937577-239937599 TCATCCAGTCATCAGCTGACGGG + Intronic
1171469825 20:25361597-25361619 TATACCAGTAACCAGCTGGCTGG - Intronic
1172808732 20:37632061-37632083 CTGTCCTTTCACCCGCTGGCTGG + Intergenic
1174676031 20:52356899-52356921 TTGTGCAGTCCCCTACTGGCTGG + Intergenic
1178917735 21:36718323-36718345 TTCTCCATTAAGCAGCTGGCTGG + Intronic
1179911749 21:44454460-44454482 GTGTCCATTCACCTGCTGGTGGG - Intergenic
1181572772 22:23776644-23776666 TTGATCAGACAACAGCTGGCAGG - Intronic
1181804963 22:25369263-25369285 TTGTCCAGTCCAGAGCTGTCAGG - Intronic
1182853557 22:33497455-33497477 TGGGCCAGTCACCAGAAGGCAGG - Intronic
1182870988 22:33647444-33647466 TTGTCCACATTCCAGCTGGCAGG - Intronic
1184413052 22:44336961-44336983 TTGGCCACTCACCAGCTGTATGG + Intergenic
1184453496 22:44596607-44596629 TTGTCCAGGCAGCTGCAGGCTGG - Intergenic
1184688960 22:46108852-46108874 TAGTCCAGCCACCTGCTGACAGG + Intronic
1185242490 22:49754192-49754214 GTGTCCAGGCACCTGCTGCCAGG - Intergenic
949861105 3:8505603-8505625 CTGTGCAGTCACCAGTGGGCTGG + Intronic
950256381 3:11510097-11510119 TTCTGCAGACACCAGCTGGCTGG - Intronic
950553956 3:13684195-13684217 TTGTCCAGGCCAAAGCTGGCTGG + Intergenic
952611260 3:35213365-35213387 TTATCCATTCATCAGCTGACGGG + Intergenic
952694538 3:36250115-36250137 TTGGGCAGTCTCCAGCTGGGTGG - Intergenic
953125424 3:40087861-40087883 TTTTTCTGTGACCAGCTGGCAGG + Intronic
954899102 3:54003707-54003729 TAGCCCAGTGACCAGCAGGCAGG + Intergenic
960273441 3:115699456-115699478 GTGTCTAGACACCAGCTGCCTGG - Intronic
960962345 3:123080960-123080982 TTGTCCAAATTCCAGCTGGCAGG + Intronic
962251323 3:133837864-133837886 GTGTCCAGCCACCAGCTTCCAGG - Intronic
962864149 3:139433500-139433522 TTATCCATTCACCAGCTGATGGG - Intergenic
962904466 3:139789396-139789418 TTGTGCAGCAACCTGCTGGCTGG - Intergenic
965641568 3:170834280-170834302 TTGTCCATTCACCTGCTGAAGGG + Intronic
968812297 4:2805489-2805511 TCGTCCACACCCCAGCTGGCTGG - Intronic
972969444 4:44554925-44554947 CTGTGCAGTAACCAGCTGTCTGG + Intergenic
973169115 4:47117011-47117033 TGATCCAGTCACCACCTGCCAGG + Intronic
974468701 4:62291666-62291688 TATTCCAGTCACCACCTGCCAGG - Intergenic
977156405 4:93579384-93579406 TTTTGCAGTTACCAGCTGTCAGG - Intronic
977923009 4:102666628-102666650 AGGTGCAGACACCAGCTGGCCGG + Intronic
980979539 4:139642386-139642408 ATGGCCAGTCACCTGCTAGCAGG + Intergenic
983811623 4:172069099-172069121 TTCTTCAGTCTCCAGCTGGAAGG - Intronic
992873470 5:81028910-81028932 TTTTCCAGGTACCATCTGGCAGG - Intronic
993318402 5:86440742-86440764 TTGTCCAGGCATCATCTAGCTGG + Intergenic
995097758 5:108259478-108259500 TAGTACAGCCAGCAGCTGGCAGG - Intronic
995109986 5:108418238-108418260 TTGTCCAGACACCAGCACTCAGG + Intergenic
997689891 5:135821315-135821337 CTCTCCAGTCACTTGCTGGCAGG - Intergenic
1001763440 5:174225942-174225964 TTGTCAAGTCCCCACATGGCTGG - Intronic
1002419642 5:179138914-179138936 GGGCCCAGTTACCAGCTGGCGGG - Intronic
1006716231 6:36122486-36122508 TCGGCCAGTCACCGGCTGCCAGG + Intergenic
1007867527 6:44989380-44989402 TTATCCATTCACCTGCTGACAGG + Intronic
1008448298 6:51619268-51619290 TTGCTCAGATACCAGCTGGCAGG - Exonic
1011350997 6:86423709-86423731 TTTCCCAGTCACCAGCTGGGTGG + Intergenic
1012705022 6:102514066-102514088 TTTTCCATTCACCAGCTGACAGG + Intergenic
1013085409 6:106852654-106852676 TGCTCCAGTCAACAGCTGGTTGG + Intergenic
1016836820 6:148485816-148485838 TTGTCCAGTCACCATCACGTGGG + Intronic
1017543721 6:155428858-155428880 CTGTCCAGTCTCCTGCTGCCCGG + Exonic
1020369944 7:7421094-7421116 TTGTCCATTCACCAGTTGATGGG - Intronic
1023534015 7:41188702-41188724 TTGTGCAGTCACCACATGCCAGG - Intergenic
1023851792 7:44154236-44154258 CTGTCCACACACCAGCTTGCTGG - Intronic
1024001741 7:45194467-45194489 GTGTCCAGTTTCCACCTGGCTGG + Intergenic
1024223469 7:47305522-47305544 TGGCCCAGTTACCAGCTGGGGGG - Intronic
1024357483 7:48429175-48429197 TTGTCCATTCACCAGTTGATGGG + Intronic
1029434161 7:100552734-100552756 TTGTCCCGGCAGGAGCTGGCAGG + Intronic
1029939805 7:104468199-104468221 GTGTCCAGTCACCAGCTTCAAGG - Intronic
1031237408 7:119194849-119194871 TTGTCCAGTAACTTTCTGGCTGG - Intergenic
1033367235 7:140681054-140681076 GTGTCCAGTTACCAGCAGGCAGG + Exonic
1036474675 8:9082352-9082374 TTGCCAAGTCACCAGTAGGCAGG + Intronic
1037901371 8:22691335-22691357 TTGTCCTGGCACCAGTTGGAAGG + Exonic
1039439256 8:37583636-37583658 TTGTCCATTCACCTGCTGTATGG + Intergenic
1039495805 8:37979206-37979228 TTGTCCCTACAACAGCTGGCTGG - Intergenic
1040388846 8:46932883-46932905 TTGTCCTGTGAGCAGCTGGAAGG - Intergenic
1043991975 8:86766253-86766275 TTATCCACTCACCAGTTGACGGG - Intergenic
1044249042 8:89984726-89984748 TTTTCCAACCACCAGGTGGCGGG - Intronic
1044854883 8:96465792-96465814 TAATCCAGTCACAACCTGGCTGG + Intergenic
1046271154 8:111899164-111899186 TAGTCCAGGCACCTGCTGGGCGG - Intergenic
1046773428 8:118138858-118138880 TTGTGCAGTCACCAGAAAGCTGG - Intergenic
1047410368 8:124619690-124619712 TTCTGCAATCACTAGCTGGCTGG + Intronic
1048662755 8:136624289-136624311 TTATCCATTCACCTGCTGGTGGG + Intergenic
1048689201 8:136940191-136940213 TTGTGATATCACCAGCTGGCTGG + Intergenic
1049048813 8:140174800-140174822 TTATCCATTCACCAGCTGACGGG + Intronic
1049521556 8:143094055-143094077 TTGTCAAAGCCCCAGCTGGCTGG - Intergenic
1053607999 9:39679914-39679936 TTGTTCACTCCCCAGCTTGCAGG - Intergenic
1053865842 9:42436274-42436296 TTGTTCACTCCCCAGCTTGCAGG - Intergenic
1054245533 9:62662495-62662517 TTGTTCAGTCCCCAGCTTGCAGG + Intergenic
1054559660 9:66697026-66697048 TTGTTCACTCCCCAGCTTGCAGG + Intergenic
1055664838 9:78542954-78542976 TGAGCCAGTCACCTGCTGGCTGG + Intergenic
1058853886 9:109040827-109040849 TTATCCATTCACCAGCTGATGGG + Intronic
1060437537 9:123607112-123607134 TTATCAAGTGACCAGCTGGAGGG + Intronic
1061792812 9:133067311-133067333 TTGTCCTGTCACCAACTAGCTGG + Intronic
1186066731 X:5774563-5774585 TTATCCATTCATCTGCTGGCAGG + Intergenic
1186446711 X:9635912-9635934 TTTTCCAGGCAGCAGCTGACAGG - Intronic
1186635626 X:11401291-11401313 TTGTCCAGTCATGAGCTGGTTGG - Intronic
1187821980 X:23297557-23297579 TTGGCCACTCTCCAGCTGGAAGG + Intergenic
1189941087 X:46121959-46121981 TTATCCATTCATCAGTTGGCAGG + Intergenic
1192189392 X:68981508-68981530 CTGTACATTCACCATCTGGCTGG + Intergenic
1193749771 X:85327157-85327179 TTGTGGAGTCTCCTGCTGGCAGG + Intronic
1195322078 X:103728463-103728485 TTTTCCAGCTCCCAGCTGGCAGG - Exonic