ID: 900344156

View in Genome Browser
Species Human (GRCh38)
Location 1:2203219-2203241
Sequence CTTGGCCCCACCTGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 1, 2: 2, 3: 43, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900344156_900344163 10 Left 900344156 1:2203219-2203241 CCTGCAGCCCAGGTGGGGCCAAG 0: 1
1: 1
2: 2
3: 43
4: 351
Right 900344163 1:2203252-2203274 GATCCCGACAGGCCAGAGAGTGG 0: 1
1: 0
2: 1
3: 12
4: 158
900344156_900344162 -1 Left 900344156 1:2203219-2203241 CCTGCAGCCCAGGTGGGGCCAAG 0: 1
1: 1
2: 2
3: 43
4: 351
Right 900344162 1:2203241-2203263 GGCACAGCTAGGATCCCGACAGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900344156 Original CRISPR CTTGGCCCCACCTGGGCTGC AGG (reversed) Intronic
900014158 1:137348-137370 CTGGGCCGCACGCGGGCTGCTGG + Intergenic
900032176 1:380055-380077 CTTGGCCCCCTCTGGCCAGCTGG - Intergenic
900044021 1:492550-492572 CTGGGCCGCACGCGGGCTGCTGG + Intergenic
900052726 1:608241-608263 CTTGGCCCCCTCTGGCCAGCTGG - Intergenic
900065431 1:727456-727478 CTGGGCCGCACGCGGGCTGCTGG + Intergenic
900344156 1:2203219-2203241 CTTGGCCCCACCTGGGCTGCAGG - Intronic
900707719 1:4090797-4090819 CTTGTCCCCAGCTGTGCTGCCGG + Intergenic
901000478 1:6146594-6146616 CCTGGACCCTCCTGGGCTGGCGG - Intronic
901023548 1:6267298-6267320 CTTGGCCCCTCCTGGTCCTCTGG - Intronic
901308511 1:8250820-8250842 AGGGGCCCCACCTGGGGTGCAGG + Intergenic
901804085 1:11726761-11726783 CTGGGCCCCACCTTGGCTTTAGG - Intergenic
903046934 1:20571576-20571598 CTTAGCCCCAGTTGTGCTGCTGG + Intergenic
905255334 1:36678073-36678095 CTTGGCTCCACATGGGCAGTGGG + Intergenic
905731855 1:40303627-40303649 CCTGGCCCCAGCGGGGATGCGGG - Exonic
906117790 1:43367486-43367508 CTTGGTCCCTCCTGGCCTGCCGG - Exonic
906281867 1:44559971-44559993 CGTGGCTCCTCCTGGGCTGAGGG - Intronic
907305029 1:53508566-53508588 CCTGGTTCCACCTGGGCTGCGGG + Intronic
907490961 1:54808570-54808592 CAAGGCCCCACCTTGGCTGCAGG - Intronic
907493953 1:54829454-54829476 CTTTGCCCTACTTGGGCTCCTGG + Intronic
910088575 1:83434774-83434796 CTTGGGATCACCTGGGCTTCTGG + Intergenic
910506354 1:87953935-87953957 CTTGCCCCTAACTGGGCAGCAGG - Intergenic
914764403 1:150625412-150625434 CTGGGCCCTACCTGGACTACAGG + Intronic
915118812 1:153616064-153616086 CCAGGCCCCGCCTGGGCTTCAGG + Intronic
917678339 1:177341059-177341081 CTTGGCCCCACCTTCTCTACTGG + Intergenic
918174480 1:182030455-182030477 CTTGACCCCCAATGGGCTGCAGG + Intergenic
919762014 1:201103939-201103961 TTTGGCCCCTCCTGGGCTGCAGG - Intronic
920341278 1:205276552-205276574 CTTGGTCCCCACTAGGCTGCGGG + Intergenic
920394593 1:205635015-205635037 CTTGTCCCCACCTGGGGTTGTGG - Intergenic
922734432 1:227971734-227971756 CTGGGCCGCACGCGGGCTGCCGG - Intergenic
922734720 1:227972866-227972888 CTGGGCCGCACGTGGGCTGCTGG - Intergenic
922768820 1:228170987-228171009 CTTGCTCCCACCGGGGCTTCTGG + Intronic
922797957 1:228350932-228350954 CTGGGCCCCACCTGATCTGCGGG - Exonic
923243658 1:232110400-232110422 CTGGACCCCACATGGGCTGGAGG + Intergenic
923432427 1:233936192-233936214 CATGGCCCCCCCAGGGTTGCAGG + Intronic
923563931 1:235062656-235062678 CTCGGGCCCAGCTCGGCTGCGGG - Intergenic
924343485 1:243054923-243054945 CTGGGCCGCACGCGGGCTGCTGG + Intergenic
924598748 1:245469599-245469621 CTTAGCCCCACCTGGAATTCAGG - Intronic
924610159 1:245567062-245567084 CTTGGCCGCGGCTGGGGTGCAGG - Intronic
924709748 1:246522430-246522452 CTTGTCACCACCTGTGCTCCTGG + Intergenic
1063093368 10:2887614-2887636 CTTTGCCCCTCCTGGGATGTGGG - Intergenic
1063374593 10:5546471-5546493 CATGGCCCCACCTGGGCAGGAGG + Intergenic
1064060093 10:12129835-12129857 GCAGGCCCCGCCTGGGCTGCGGG + Intronic
1066367729 10:34793114-34793136 CTTGAGCCCACCTGGGGAGCCGG + Intronic
1066639811 10:37544564-37544586 CTTTTCCCCACAGGGGCTGCTGG + Intergenic
1066646685 10:37617761-37617783 CCTGTCCCCAGCTGAGCTGCCGG - Intergenic
1067155819 10:43780367-43780389 CTGGACCCCACCTGGGCCTCTGG + Intergenic
1067308841 10:45093286-45093308 CTGGGCCCCCCCGAGGCTGCAGG - Intergenic
1068396327 10:56466302-56466324 GTTGGCCCCAGCAGTGCTGCAGG + Intergenic
1070305245 10:75235513-75235535 CCTGGCCCTCCCTGGGCTTCCGG - Intronic
1072640429 10:97207263-97207285 CTTGGCCCACCCTGGGGAGCCGG - Intronic
1073931774 10:108584835-108584857 CTTGGCCCCAGCTTTGCTGCAGG - Intergenic
1076970358 11:129025-129047 CTGGGCCGCACGCGGGCTGCTGG + Intergenic
1077111356 11:863608-863630 GTGGGCCCCACCAGGCCTGCAGG + Intronic
1077234003 11:1471130-1471152 CATGGAGCCACCTGGGCTGTGGG - Intronic
1077239387 11:1502682-1502704 GATGGCCCCACCTGGGCTGTGGG - Intergenic
1077504521 11:2923932-2923954 CCAGGCCCCACCTGGGCTCAGGG - Intronic
1077556640 11:3229112-3229134 CCTGCCCCCACCTGGCCTACAGG - Intronic
1079088980 11:17467603-17467625 CTTGGCCTCATCTGGGTTCCAGG + Intronic
1079187304 11:18248933-18248955 GATGGCGGCACCTGGGCTGCTGG + Intergenic
1079189496 11:18265950-18265972 GATGGCGGCACCTGGGCTGCTGG - Intergenic
1081745185 11:45467993-45468015 TGTGGCCCTACCTGGGCTGATGG - Intergenic
1083203150 11:61132130-61132152 CTGGGTCCAAGCTGGGCTGCCGG + Exonic
1083205295 11:61145267-61145289 CTTTGCCCCACCTGCTCGGCAGG + Intronic
1083235453 11:61348003-61348025 CTTGGCCCAAATTTGGCTGCAGG + Exonic
1083454529 11:62769839-62769861 CTTAGCCAGACCTGGGCAGCTGG - Intergenic
1083812996 11:65116061-65116083 CATGCCCCCACCTGGGGTGGTGG - Exonic
1083920071 11:65777830-65777852 CCTGCCCCCACCTGGTCTCCCGG + Exonic
1083934342 11:65862518-65862540 GTTGGCCCCACCTGGCTGGCTGG - Exonic
1084442424 11:69182354-69182376 CTTGGCCAGACCGGGGCTGAGGG - Intergenic
1084490602 11:69476327-69476349 CCTGGCCCCTCCTAGGCAGCCGG + Intergenic
1084714877 11:70867336-70867358 CTTGGCTCCACACGGGCAGCAGG + Intronic
1084797730 11:71519346-71519368 CCAGGCCCCTCCTGGGCTGGGGG + Intronic
1084955631 11:72689780-72689802 CCTGGAACCAACTGGGCTGCAGG + Intronic
1085524192 11:77154837-77154859 CTTGGCCCCACCTGGCCCCAGGG + Intronic
1087175248 11:95089963-95089985 CTTCGCCCTGGCTGGGCTGCTGG + Exonic
1087891718 11:103543837-103543859 CTTGGCCCCAAATGGGTTGGTGG + Intergenic
1088462267 11:110093618-110093640 CTCGGCCCCACCTGAGCGACCGG - Intronic
1089342991 11:117772265-117772287 CTTGGCCAAAGGTGGGCTGCAGG + Intronic
1089362743 11:117901820-117901842 AATGGCGCCACCTGGGCCGCTGG + Intronic
1089901681 11:121993056-121993078 CATGGCTCCACCTGGGCTGGAGG - Intergenic
1091303911 11:134524447-134524469 GTTGGCCCCTCCTGGGCTGGGGG - Intergenic
1091394101 12:143083-143105 CTCAGCACCACCTGGGCTGCAGG - Intronic
1091677214 12:2500183-2500205 TTTGGTCCCCCCTGGGCTGTGGG - Intronic
1091829682 12:3540688-3540710 CTTGCCCCGTCCTGGGCAGCTGG - Exonic
1092240555 12:6833672-6833694 CTTGGCCCGAGCTGGGAGGCTGG + Intronic
1095954542 12:47798665-47798687 CTTGTCCCTTTCTGGGCTGCCGG - Intronic
1096253296 12:50047379-50047401 CTGGGACACACCTGGGCTGTAGG - Intergenic
1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG + Intergenic
1096846353 12:54409221-54409243 CTTGCCCCTACCTGAGCGGCAGG + Exonic
1101374267 12:104157259-104157281 GGTGGCCCCACCAGGGCTACAGG - Intergenic
1101996986 12:109532751-109532773 ACAGGCCCCACTTGGGCTGCCGG + Intronic
1102033475 12:109758073-109758095 CTTGGCCGCTCCAGGGCTGTGGG + Intronic
1103562437 12:121799774-121799796 TTCGGCCCTCCCTGGGCTGCAGG + Intronic
1103726356 12:122999233-122999255 CTTGGCTCCTCCTGGGGTGAGGG - Intronic
1103764827 12:123272203-123272225 CTTGGCCAGACCTGGGCGTCTGG - Intronic
1103943337 12:124512733-124512755 CTTGGCCCCACTTGGTCCCCTGG - Intronic
1103999113 12:124849168-124849190 CTGGGGTCCACCTGAGCTGCTGG + Intronic
1104414228 12:128584728-128584750 CATGGCCCCATCTGTGCAGCTGG + Intronic
1104763628 12:131312986-131313008 CATGGCCCAACCTGGGCTCAGGG - Intergenic
1104984582 12:132589478-132589500 GTGGGCCGCACCTGGCCTGCTGG + Intergenic
1105235934 13:18553721-18553743 CTTAGCCACAGCTGGGATGCAGG - Intergenic
1106373397 13:29159869-29159891 CTAGGCTCCACCTGTGTTGCCGG + Intronic
1108253420 13:48588914-48588936 CTTCACCCCATCTGGTCTGCTGG + Intergenic
1109267915 13:60221806-60221828 CTTGGCCCCAGGCTGGCTGCAGG - Intergenic
1109750490 13:66685260-66685282 TTTGGCCACAGCTGGGATGCAGG - Intronic
1111097960 13:83539086-83539108 CTTTGCCCCACCTTGGCTGGTGG - Intergenic
1111556251 13:89884330-89884352 CTTGGCACCACCTGGGCCTCGGG - Intergenic
1113245515 13:108390604-108390626 CTTGCTCCCAGCTGGGCTTCTGG - Intergenic
1113736114 13:112680064-112680086 CTTGGTCCCACCTGAGACGCTGG - Intronic
1115539370 14:34404733-34404755 CTTAGCCCCACCAGAGCTCCTGG - Intronic
1120299842 14:82692477-82692499 CTGGGCCCTACCTGGACTACAGG + Intergenic
1120763653 14:88308419-88308441 CTTGGCCTTCTCTGGGCTGCTGG - Intronic
1122264476 14:100540252-100540274 CTTTGGCCCACCCCGGCTGCTGG - Intronic
1122804669 14:104250388-104250410 AGTGCCCCCACCTGGGCAGCTGG + Intergenic
1122898974 14:104774289-104774311 CTTGGCACCTCAGGGGCTGCCGG - Intronic
1123050741 14:105540831-105540853 CTTGGCCCCATGTGGGGTGAGGG + Intergenic
1123135130 14:106021201-106021223 CTGAGCCCCACCTGAGCTGCAGG + Intergenic
1123145780 14:106128828-106128850 CTGAGCCCCACCTGAGCTGCAGG + Intergenic
1123164508 14:106313923-106313945 CTGAGCCCCACCTGAGCTGCAGG + Intergenic
1123186034 14:106517867-106517889 CTGAGCCCCGCCTGAGCTGCAGG + Intergenic
1123585682 15:21759071-21759093 CTGAGCCCCACCTGAGCTGCAGG + Intergenic
1123622324 15:22201659-22201681 CTGAGCCCCACCTGAGCTGCAGG + Intergenic
1124250043 15:28101125-28101147 CTTGGCCGCAGCTGTCCTGCTGG - Intergenic
1125713667 15:41806556-41806578 CTTGGCCCTTCCTGGGCAGTGGG + Intronic
1127267927 15:57376385-57376407 CCTGGACCCGCCGGGGCTGCCGG - Intronic
1127632830 15:60842299-60842321 CTTGGCTGCCCATGGGCTGCAGG + Intronic
1128391423 15:67185312-67185334 CTTCTCTCTACCTGGGCTGCTGG - Intronic
1128441340 15:67711861-67711883 CTTGGTCCCACCTTGACTCCTGG - Intronic
1128548027 15:68580302-68580324 CTGGGACCCAGCTGGGCAGCTGG - Intronic
1128725371 15:69984010-69984032 TGTGGCTCCACCTGGGCAGCAGG - Intergenic
1128860808 15:71070171-71070193 CTTGGCCCAGCCAAGGCTGCAGG - Intergenic
1129328727 15:74816070-74816092 CTTGGCCCGGGCTGGGCTCCCGG - Intronic
1129609173 15:77039278-77039300 CTGGGCACCACCTCAGCTGCTGG + Intergenic
1131067378 15:89442920-89442942 CTGTGCCCCATCTCGGCTGCTGG - Intergenic
1132472982 16:117173-117195 GCTGGCCCCTCCTGGGGTGCAGG - Intronic
1132758153 16:1495962-1495984 CTTGCCCGCTGCTGGGCTGCAGG + Intronic
1132994642 16:2816888-2816910 CTAGGCCCCACCCGGCCTTCAGG + Intergenic
1133056092 16:3146074-3146096 CTTCCCCTCACCTGGGCTGTAGG - Exonic
1136693326 16:32052971-32052993 CTGAGCCCCACCTCAGCTGCAGG - Intergenic
1136793817 16:32996194-32996216 CTGAGCCCCACCTCAGCTGCAGG - Intergenic
1136876094 16:33858185-33858207 CTGAGCCCCACCTCAGCTGCAGG + Intergenic
1137060389 16:35787949-35787971 TGTGGCTCCACTTGGGCTGCAGG - Intergenic
1137530707 16:49277144-49277166 TTTGGCGCTCCCTGGGCTGCAGG - Intergenic
1138148894 16:54637096-54637118 CTTGTCCCCCCATGGGCTGAGGG - Intergenic
1138213870 16:55186114-55186136 TTTGGCCCCAGATTGGCTGCAGG + Intergenic
1138512225 16:57515330-57515352 CCGGGGCCCACCTGGACTGCAGG + Exonic
1139671082 16:68492880-68492902 ACTGGCTCCACCTGGGTTGCTGG - Intergenic
1141125467 16:81397826-81397848 CCTGGGCCCACTTGAGCTGCTGG + Intergenic
1141172808 16:81701835-81701857 CCTGGCCCCCCCTGGCCTGCTGG - Intronic
1141286997 16:82681839-82681861 CTGGACCCCACCTGGAGTGCAGG - Intronic
1141367606 16:83457730-83457752 CTTGGCTCGGCCTGGCCTGCTGG - Intronic
1142182742 16:88679152-88679174 CTGGGCCCCTCAGGGGCTGCAGG - Intronic
1142199882 16:88756012-88756034 CTGGGCCACACCTGGACTCCAGG - Intronic
1142201324 16:88762407-88762429 CTGGCCCCCATCTGAGCTGCAGG + Intronic
1142254043 16:89005557-89005579 CATGGCCTCACATGAGCTGCAGG + Intergenic
1203096079 16_KI270728v1_random:1257887-1257909 CTGAGCCCCACCTCAGCTGCAGG - Intergenic
1142457193 17:63389-63411 CTGGGCCGCACGCGGGCTGCTGG + Intergenic
1142629733 17:1217008-1217030 TGTGGCCCCACCTAGGCAGCAGG - Intronic
1142696278 17:1635493-1635515 CTTGGCCCGAGCTAGGCTGGAGG + Exonic
1142741580 17:1934799-1934821 CTTGTACCCACCTGGGCCCCCGG + Exonic
1142964328 17:3571481-3571503 CTTGGCGCCTCCTTGGCTGGTGG - Intronic
1143017282 17:3897747-3897769 CTGGGACCCACCAGGGCTCCAGG + Exonic
1143776202 17:9200543-9200565 CTTGACCTCATCTGGGCTACAGG + Intronic
1144460423 17:15454282-15454304 CTGGGACCCACCTGGGCTGGGGG - Intronic
1144775705 17:17783592-17783614 CTCTGCCCCAGCCGGGCTGCAGG + Intronic
1145781482 17:27566543-27566565 CGTGAGCCCACCTGGGCTGGAGG + Intronic
1145995041 17:29100175-29100197 CAGGGCCCAACCTGGGCTCCAGG + Intronic
1146670373 17:34733448-34733470 CAGGGCCCCTCCTTGGCTGCTGG - Intergenic
1147582702 17:41636163-41636185 CTTTGCCCCACATTTGCTGCTGG - Intergenic
1148588005 17:48794580-48794602 CTCCTCCCCACCTGGGCTGTGGG - Intronic
1149584250 17:57774744-57774766 CTGGCACCAACCTGGGCTGCAGG - Intergenic
1149779075 17:59381999-59382021 AATAGCCCCAGCTGGGCTGCTGG - Intronic
1150480292 17:65503932-65503954 CTAAGCCCCACCTGGGATGCTGG + Intergenic
1151122606 17:71808978-71809000 CTTGGCCCCTCCAGTGCAGCAGG + Intergenic
1151450307 17:74194702-74194724 CCAGGCCCCACCTGTGCTGAGGG + Intergenic
1151469464 17:74309167-74309189 CTTGGTCCCTTCTGGGCTCCAGG - Intronic
1151724237 17:75875345-75875367 CTGGGCCCTCCCAGGGCTGCTGG - Intronic
1152242480 17:79167751-79167773 CCTGGCCCTACCTGGGGTCCAGG + Intronic
1152722701 17:81930728-81930750 CCAGGGCCCACCTGGCCTGCTGG + Intergenic
1153044690 18:844981-845003 CTTGGTCTCACCTGGACTGGTGG - Intergenic
1154513610 18:15136277-15136299 CTTAGCCACAGCTGGGATGCAGG + Intergenic
1155154566 18:23147847-23147869 ATGTGCCCCACGTGGGCTGCGGG - Intronic
1157248013 18:46071169-46071191 CTCTACCCCACGTGGGCTGCAGG - Intronic
1157567524 18:48689746-48689768 CTTAGCCCCTCCTGGACAGCAGG - Intronic
1157721790 18:49931086-49931108 CTTAGCTCCAGCTGAGCTGCAGG - Intronic
1160647552 19:200494-200516 CTGGGCCGCACGCGGGCTGCTGG + Intergenic
1160844440 19:1160233-1160255 CTGGGCCCCAGCCGGGCTGCAGG - Intronic
1161579563 19:5073368-5073390 CTGCTCCCCACCGGGGCTGCTGG - Intronic
1162946849 19:14049152-14049174 GTTGGCCCCACTAGGGGTGCTGG - Exonic
1162965791 19:14155468-14155490 CTGGGCCTCACCTGGGCTTTCGG - Exonic
1163454737 19:17399828-17399850 CTAGGCCTCACCGGGGCTGTTGG + Intergenic
1163699590 19:18780663-18780685 CCTGGCCCCCCATGGGCTTCTGG - Exonic
1163786184 19:19276020-19276042 CTTGGCCACACCTGGGCTAAAGG - Intronic
1163813916 19:19452287-19452309 CTTGGCCCCACCTGGGCTGTGGG - Intronic
1164777565 19:30864771-30864793 TGTGGCACCACATGGGCTGCTGG - Intergenic
1165045050 19:33098093-33098115 CTGGGCCCCACCTTGACAGCTGG - Intronic
1166011938 19:39949148-39949170 CCAGGCCACACCTGGGCTACTGG + Intergenic
1166377380 19:42335181-42335203 CCTGTCCCCACCAGGGCTGCTGG + Exonic
1166691625 19:44824914-44824936 CTTTGCCCTGCCTGGGCTCCAGG + Intergenic
1166873723 19:45885273-45885295 CTTGATGCCCCCTGGGCTGCTGG - Exonic
1167250725 19:48397134-48397156 CATGGCCCCATCTGGGATGTGGG - Intronic
1168100570 19:54138828-54138850 CTTTCCCCCACCTGGGGTACAGG + Intronic
926977063 2:18525874-18525896 CTTGCTCCCACCTGGGCCCCTGG + Intergenic
927111044 2:19863924-19863946 CTCAGCGCCACCTGGGCTCCAGG + Intergenic
927915078 2:26930425-26930447 CTTGTCCCAACCTGGGGGGCAGG + Intronic
929145645 2:38705175-38705197 CTTGTCCAGACCTGGGCTGGAGG - Intronic
929542037 2:42829955-42829977 CATGGCCCCAGTAGGGCTGCTGG + Intergenic
931772149 2:65506743-65506765 TTTGGCCCCACCTGGGTCCCAGG - Intergenic
932216595 2:69970122-69970144 CACGGCCCCACCTGGACTGCTGG + Intergenic
935643308 2:105310601-105310623 CTCGGCCTCACCTGGGATTCTGG - Intronic
936172281 2:110186524-110186546 CTTTGCACCACCTGGGCTAAAGG - Intronic
936389196 2:112055932-112055954 TCCGGCCCGACCTGGGCTGCAGG + Intronic
937425634 2:121796292-121796314 CTTGGCCCCTCCTTAACTGCAGG + Intergenic
937913441 2:127087447-127087469 CGTGGCACCACCCTGGCTGCAGG - Intronic
938376969 2:130814344-130814366 GCTGGTCCCACCTGGCCTGCGGG + Intergenic
938513851 2:131980888-131980910 CTTAGCCACAGCTGGGATGCAGG + Intergenic
938925307 2:136034876-136034898 TTTTGCCCCACTTGGGCTGATGG + Intergenic
938990427 2:136622805-136622827 CTTGGCCCCACCAGTGTTGCAGG - Intergenic
939057619 2:137383119-137383141 CTTGGCCCCACATGGGTTGGTGG - Intronic
940326995 2:152435921-152435943 CTTGACCCAGCCTGGACTGCTGG + Intronic
940559748 2:155280771-155280793 CCTGGACCTACCTGGGCTGGGGG - Intergenic
942711099 2:178837433-178837455 CTGGGCATCCCCTGGGCTGCTGG + Exonic
944565063 2:200981547-200981569 TTTGGCACCACCTGGCCAGCAGG + Exonic
947379647 2:229532840-229532862 CCTGGCCCCCTGTGGGCTGCTGG + Intronic
947435482 2:230068622-230068644 CTTGGAGCCCCCTGAGCTGCTGG + Exonic
947550522 2:231042106-231042128 CTGGGCCCGACCTGGGCAGTGGG + Intronic
947875792 2:233467548-233467570 CCTGCTCCCTCCTGGGCTGCTGG + Intronic
948309223 2:236972533-236972555 CTTGCACCCTCCAGGGCTGCTGG - Intergenic
948523861 2:238558642-238558664 CTGGGCCCCTCCAGGGCTCCAGG + Intergenic
948560221 2:238847270-238847292 CCTGGCCCTACCCGGGTTGCTGG - Intergenic
948794000 2:240392915-240392937 CTTGGCCGGAGCTGGGCTTCGGG - Intergenic
948864528 2:240768578-240768600 CCATGCCCCACCTGGGCTGCTGG + Intronic
1170981787 20:21221014-21221036 CCTGAGCCCAGCTGGGCTGCTGG + Intronic
1171031854 20:21683844-21683866 CTTGGCCCCACCTCTGTTTCAGG - Intergenic
1171195418 20:23193912-23193934 CTTGTCCCTCCCTGGGCTGTTGG + Intergenic
1171256478 20:23692415-23692437 CATGCCCCCTCCTGGGCAGCTGG - Intergenic
1171263832 20:23754345-23754367 CATGCCCCCTCCTGGGCAGCTGG - Intergenic
1171486182 20:25488150-25488172 CTGGGCCACATGTGGGCTGCTGG - Intronic
1172175136 20:32967586-32967608 CCAGGCCCTACCTGGGATGCCGG + Intergenic
1172933502 20:38602058-38602080 GCTGGGCCGACCTGGGCTGCAGG + Exonic
1173609839 20:44358935-44358957 CTTGGCCCTCCCTGGACTTCCGG + Intronic
1174420364 20:50395496-50395518 CTGGGCCCCACCAGGGCAGGAGG - Intergenic
1175001372 20:55633445-55633467 CTTGGCCCCATCTGGACTTTGGG - Intergenic
1175055199 20:56191470-56191492 CCTGGATCCACCTGGGCTGGGGG - Intergenic
1175199995 20:57270361-57270383 CTGGGCCCCAGCTGGCCTGCAGG - Intergenic
1175574268 20:60048960-60048982 CATGAGCCCACCTGGGCTGCTGG - Intergenic
1175862423 20:62157395-62157417 CCTGGCCACACCTGAGCAGCAGG - Intronic
1176254263 20:64142651-64142673 CCTGTCCTCACCTGGGCTTCAGG - Intergenic
1176286468 21:5021673-5021695 CTGGGCCTCACCTGGCTTGCAGG + Intergenic
1176779933 21:13182007-13182029 CTTAGCCACAGCTGGGATGCAGG - Intergenic
1178840286 21:36133038-36133060 CTTGTCCCCTCCTGGGCTGGTGG + Intergenic
1178941788 21:36912787-36912809 CTTTGCTCCCCCTGGTCTGCAGG - Intronic
1179709575 21:43205531-43205553 CCAGGCTCCAGCTGGGCTGCTGG + Intergenic
1179870713 21:44241802-44241824 CTGGGCCTCACCTGGCTTGCAGG - Intergenic
1179903271 21:44406070-44406092 CGAGGCCCACCCTGGGCTGCAGG - Intronic
1181035212 22:20166687-20166709 CCTGCCCCAACCTGGGCTCCTGG - Intergenic
1181041520 22:20194787-20194809 CCTGGCCCCACATGGGCACCCGG + Intergenic
1181475351 22:23164652-23164674 CATTGCCGCACCTTGGCTGCAGG - Intergenic
1183211777 22:36455538-36455560 CTTCACCCCACCTGGGCCGCAGG + Intergenic
1183655027 22:39179645-39179667 CTCGCCCTCACCAGGGCTGCTGG - Intergenic
1183689993 22:39383031-39383053 CTTGGCCCCAGCTGCCCAGCAGG + Exonic
1184246784 22:43239867-43239889 CTTGGCATCACCTGGACTCCTGG + Intronic
1184645369 22:45892147-45892169 CTTGGCCACACCCGGGCCCCGGG + Intergenic
1184687904 22:46104689-46104711 GTGGGGCCCACCTGGGCTCCCGG + Intronic
1185121676 22:48975139-48975161 GTAGGCCCCTCATGGGCTGCAGG - Intergenic
1185239492 22:49735103-49735125 CTCGGCCTCGGCTGGGCTGCTGG + Intergenic
1185246623 22:49776345-49776367 GGTGGCCCCAGGTGGGCTGCAGG - Intronic
949980218 3:9498069-9498091 CATGGCCCAACGTGGGCTGCTGG - Intergenic
950542791 3:13622173-13622195 AGGGACCCCACCTGGGCTGCAGG + Intronic
952776505 3:37051770-37051792 CTGTGCCCCACCTGGGCTCATGG - Intergenic
952880977 3:37986255-37986277 CTTTGCCACACCTGGGCATCAGG - Intergenic
953752422 3:45618850-45618872 CTGGGACCCACCAGGACTGCAGG + Intronic
953905775 3:46867645-46867667 CATGGCCCGCCCTGGCCTGCCGG + Intronic
954664871 3:52246274-52246296 CTTGGAAGCCCCTGGGCTGCAGG - Exonic
956679609 3:71765873-71765895 CATGGCCACACTTGGGCAGCTGG + Intergenic
957685921 3:83503176-83503198 CTTGGCCCCAAATGGGTTGGTGG + Intergenic
960156162 3:114298816-114298838 CTGAGCCCTACCTGAGCTGCTGG + Intronic
960947697 3:122978192-122978214 CCTGGCCCCACCTGGGCCCCAGG + Intronic
962401013 3:135058698-135058720 CTGGGCCCCAGCTGTACTGCAGG - Intronic
962840460 3:139227927-139227949 CCAAGCCCAACCTGGGCTGCAGG - Intronic
962953118 3:140239084-140239106 TTTGGCCACATCTGGGTTGCAGG + Intronic
963049644 3:141129900-141129922 GAGGGCCCCACCTGGGCTGTGGG + Intronic
963121206 3:141778392-141778414 CCTGGCCCTGCCCGGGCTGCAGG + Exonic
963284378 3:143418817-143418839 CCTGCCAGCACCTGGGCTGCTGG - Intronic
963313997 3:143739156-143739178 CTGGGCCCCACGAGAGCTGCAGG - Intronic
964296425 3:155239370-155239392 CTTGGCCTCTCCAGGGCAGCAGG - Intergenic
965603861 3:170480830-170480852 CTTGGCCCCACATGTGTTGGTGG + Exonic
965734973 3:171810299-171810321 CTCCGCCCAACCTGGGCAGCTGG - Intronic
968617323 4:1583614-1583636 GATGGCTCCACCTGAGCTGCTGG - Intergenic
968760734 4:2441837-2441859 CTGGGCCACACCTTGGGTGCTGG + Intronic
968818990 4:2836144-2836166 CAGGGCCCCAGCTGGGCTTCGGG - Exonic
969704588 4:8784840-8784862 CTGGGTCCCACCTGGGCCGTGGG - Intergenic
969857770 4:10014051-10014073 CTAGGCTTCACCTGGGGTGCTGG - Intronic
973827664 4:54724836-54724858 CTGGGCCACATGTGGGCTGCAGG + Intronic
976477328 4:85499579-85499601 CTTGGCCCCACCAAGGCTGCAGG - Intronic
978830307 4:113076280-113076302 CTTGGCCGCATGTGGCCTGCGGG + Intronic
981172804 4:141644381-141644403 CTTGACTCCTCCTAGGCTGCTGG + Intronic
982717514 4:158824529-158824551 CTTTCCCCCACCTCTGCTGCTGG + Intronic
983722837 4:170878688-170878710 CTGGGCCACACGTGGCCTGCGGG - Intergenic
985555519 5:556098-556120 CTTGGCTCCACCTGCGCTTCTGG + Intergenic
985771758 5:1816214-1816236 CTTGGGGCCACGTGGGCTGCAGG + Exonic
986333700 5:6736979-6737001 CTTGGGCAGACCTGGGCCGCGGG + Intronic
987290716 5:16505724-16505746 CTTGGCCCCACCTTGGAGCCGGG - Intronic
989475514 5:41869614-41869636 CTGGCCCGCGCCTGGGCTGCAGG - Intronic
989550178 5:42726053-42726075 CTTGGCTCCAAGTGTGCTGCTGG + Intergenic
991920615 5:71653039-71653061 CATGGCCCACCTTGGGCTGCAGG - Intronic
997225146 5:132204300-132204322 CTTGCCCTCAACTGGCCTGCAGG - Intronic
997899557 5:137753081-137753103 GTTGACCCCACTTGGGCTGTTGG + Exonic
999443482 5:151620696-151620718 CTTGGCCCCGCCTGACATGCAGG - Intergenic
1002099756 5:176851585-176851607 CGGGGCCACACCTGGGCTGGGGG + Intronic
1002432050 5:179209335-179209357 CTTGCCCACAGCCGGGCTGCAGG - Intronic
1002729822 5:181326379-181326401 CTGGGCCGCACGCGGGCTGCTGG - Intergenic
1002741644 5:181438813-181438835 CTTGGCCCCCTCTGGCCAGCTGG + Intergenic
1006375159 6:33667953-33667975 TTCGGGCCCACCTGGGCTCCCGG - Exonic
1007168671 6:39847109-39847131 CATGGCCCCACCTGGCCCCCGGG - Intronic
1007177022 6:39903881-39903903 CTTGCCCTCACCTGGGTTCCAGG - Exonic
1007386517 6:41523735-41523757 CTTGTCCCCACCTGCCCTGAAGG + Intergenic
1011477985 6:87766521-87766543 CTGGGCCCCATCAGGGTTGCTGG + Intergenic
1014384667 6:120785920-120785942 CTTGGCCCCATCTGGACTTTGGG + Intergenic
1015462245 6:133504788-133504810 CTTGGCCTGACCTGGGTTGCAGG + Intronic
1016985890 6:149895559-149895581 CTTGGCCCCAGTAGGACTGCTGG - Intronic
1017082642 6:150683912-150683934 CTTGCCACCACCCTGGCTGCAGG - Intronic
1017291610 6:152744562-152744584 GTTGGCCCCTCTAGGGCTGCAGG + Intergenic
1019246784 6:170714578-170714600 CTTGGCCCCCTCTGGCCAGCTGG + Intergenic
1019416873 7:931933-931955 CTTGGCCATTCCTGGGCTGGTGG - Intronic
1019433544 7:1010615-1010637 CCTGGCTCCCCCTGGGCTGCAGG + Intronic
1019784614 7:2967309-2967331 ATTGGCCCCACCTGGATTTCAGG + Intronic
1020089831 7:5332883-5332905 CTTGGCCTTGTCTGGGCTGCTGG + Exonic
1020144163 7:5630047-5630069 CTAGGACACACCTAGGCTGCTGG + Intronic
1020461995 7:8436698-8436720 CATAGCCCATCCTGGGCTGCGGG + Intronic
1022806160 7:33824508-33824530 CATAGCTCCACCTAGGCTGCAGG - Intergenic
1023866317 7:44240108-44240130 CTTGTCCAGACCTGGGCTGCCGG + Intronic
1023969193 7:44978856-44978878 CCTGGGCCTACCTGAGCTGCAGG + Exonic
1024074490 7:45811632-45811654 CTGGGCCGCACGCGGGCTGCCGG - Intergenic
1024128296 7:46323396-46323418 CCTTGTCCCACCTGGGCTCCTGG - Intergenic
1025052533 7:55742439-55742461 CTGGGCCGCACGCGGGCTGCCGG + Intergenic
1025052918 7:55743896-55743918 CTGGGCCGCACGCGGGCTGCTGG + Intergenic
1025130129 7:56370700-56370722 CTGGGCCGCACGCGGGCTGCCGG + Intergenic
1025130449 7:56371998-56372020 CTGGGCCGCACGCGGGCTGCCGG + Intergenic
1025131084 7:56374589-56374611 CTGGGCCGCACGCGGGCTGCCGG + Intergenic
1025250607 7:57348994-57349016 CTGGGCCCCACCAGGGCAGGAGG + Intergenic
1026777642 7:73240669-73240691 CTGGGCTCCAACTGGGCTCCTGG + Intergenic
1027018497 7:74794041-74794063 CTGGGCTCCAACTGGGCTCCTGG + Intergenic
1027069532 7:75151877-75151899 CTGGGCTCCAACTGGGCTCCTGG - Intergenic
1027305435 7:76891211-76891233 CTTGGGATCACCTGGGCTTCTGG + Intergenic
1032051538 7:128653500-128653522 CTGGGCCGCACGTGGGCTGCTGG - Intergenic
1033452277 7:141472529-141472551 CCTGGCCTCCCCAGGGCTGCTGG - Exonic
1034268484 7:149792284-149792306 CTGGGCCCCCTCTAGGCTGCTGG + Intergenic
1034443726 7:151101226-151101248 CAGGGCCCCTCCTGGGCTGGTGG + Intronic
1035133119 7:156674322-156674344 CGTGGCCCCACCTGGGCATGGGG + Intronic
1035501358 8:93383-93405 CTTGGCCCCCTCTGGCCAGCTGG - Intergenic
1037678019 8:21068614-21068636 CTTGTCCACACCTGAGCAGCTGG - Intergenic
1039873650 8:41567520-41567542 CTTGTCCCCACCTGCGCTCACGG - Intergenic
1040395662 8:46997859-46997881 ATTTGACTCACCTGGGCTGCAGG - Intergenic
1042869354 8:73383376-73383398 CTTGGCTCCAGCTGGACTCCTGG + Intergenic
1043358595 8:79442492-79442514 CTTGACCCCACCTGGTATTCTGG + Intergenic
1044525017 8:93241830-93241852 CTTGGCCCCCTCTGGACTTCGGG - Intergenic
1048324583 8:133429230-133429252 TTTGGCCCCTCCATGGCTGCTGG - Intergenic
1048503183 8:134997118-134997140 CTTCTCCCCACATGGCCTGCAGG - Intergenic
1049109427 8:140634422-140634444 CTGGGCCCCAGCCGGGCCGCAGG - Intronic
1049173243 8:141175008-141175030 GCTGGACACACCTGGGCTGCAGG + Intronic
1049460031 8:142722484-142722506 CTTGGCCTTCCCTGGGCTACTGG - Intergenic
1049746348 8:144264873-144264895 CTCGGGCCCACCCCGGCTGCTGG + Intronic
1051598989 9:18853245-18853267 ATTGGCTCCACCTGGCCAGCAGG - Intronic
1052619194 9:30883485-30883507 CTTGGCCCCTCCAGTGCAGCAGG - Intergenic
1056756468 9:89385085-89385107 CATGGCCACACCAGGGCAGCTGG - Intronic
1057190864 9:93086876-93086898 CATGGCCCCAACATGGCTGCTGG - Intergenic
1057593570 9:96395058-96395080 CATGGCCCCTACTGAGCTGCAGG + Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1057858898 9:98624364-98624386 CTTGGCCCCCATTGGGATGCTGG + Intronic
1058574056 9:106381093-106381115 CTTGGCACAACCTGGGATGATGG - Intergenic
1060483243 9:124030242-124030264 CTTGGGACCACCCCGGCTGCAGG - Intronic
1060488602 9:124065461-124065483 CTGAACTCCACCTGGGCTGCAGG - Intergenic
1060530788 9:124346133-124346155 CTTGGCCTGGCCTGGGCTCCTGG + Intronic
1060555967 9:124507316-124507338 CACCGTCCCACCTGGGCTGCCGG - Exonic
1061310231 9:129757264-129757286 AGTGGCCCCACCTCTGCTGCTGG + Intergenic
1061916961 9:133760298-133760320 CTTCGCCCCACTGAGGCTGCTGG - Intergenic
1061925923 9:133806031-133806053 CTTGGCCCCTCCCTGTCTGCGGG - Intronic
1061949124 9:133926380-133926402 CTTAGCACCTGCTGGGCTGCCGG - Intronic
1062421514 9:136484621-136484643 CTTGTCCCCAGCTGGGCCGGCGG + Exonic
1062536455 9:137023203-137023225 CCTGGCCCCAGCTGGGCTACAGG + Intronic
1062634944 9:137485812-137485834 CTGGGCCCCATGTGGGCTGAGGG + Intronic
1062702520 9:137914795-137914817 CCTGGCCTCACCTGTGCTGTTGG - Exonic
1062754234 9:138278891-138278913 CTGGGCCGCACGCGGGCTGCTGG - Intergenic
1203577794 Un_KI270745v1:21648-21670 CTGGGCCACACGCGGGCTGCTGG - Intergenic
1187279176 X:17844446-17844468 CTTGGCACCACCTGGGCCAAAGG - Intronic
1190888962 X:54552518-54552540 CTTGGCCCTACTTGGGCTTTGGG + Intronic
1191029954 X:55959046-55959068 CCTGGCCCCACCAGTGCAGCTGG + Intergenic
1192051702 X:67730280-67730302 CTTGGCCTCCACTGGGCAGCAGG + Exonic
1193392738 X:80948629-80948651 TTTGGCCCCACCAGTGCAGCAGG - Intergenic
1196004803 X:110824130-110824152 TTTGGGCCCACCAAGGCTGCTGG + Intergenic
1197377894 X:125705040-125705062 CTTGGCCCCTCCAGGGCAGCAGG - Intergenic
1198779850 X:140222452-140222474 CTTGGCCCCTCCAGTGCAGCAGG + Intergenic
1199552905 X:149077426-149077448 TTTGGCCCCAAGTGGGCTGATGG - Intergenic
1200210638 X:154345348-154345370 CTGGGTCCTGCCTGGGCTGCTGG - Intergenic
1200220214 X:154386744-154386766 CTGGGTCCTGCCTGGGCTGCTGG + Intergenic
1201447757 Y:14076944-14076966 CTTGTCCACACCTTGGCTCCAGG - Intergenic
1201963758 Y:19709440-19709462 CTACGCCCCACCTGGCCTCCAGG + Exonic