ID: 900345824

View in Genome Browser
Species Human (GRCh38)
Location 1:2209838-2209860
Sequence CTGTCTGGACAGAAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 339}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900345824_900345830 -7 Left 900345824 1:2209838-2209860 CCTCCTGCCTTCTGTCCAGACAG 0: 1
1: 0
2: 2
3: 31
4: 339
Right 900345830 1:2209854-2209876 CAGACAGAGCTTGTCGGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 171
900345824_900345831 4 Left 900345824 1:2209838-2209860 CCTCCTGCCTTCTGTCCAGACAG 0: 1
1: 0
2: 2
3: 31
4: 339
Right 900345831 1:2209865-2209887 TGTCGGAGGAGGCGCTTCAGTGG 0: 1
1: 0
2: 1
3: 7
4: 93
900345824_900345832 28 Left 900345824 1:2209838-2209860 CCTCCTGCCTTCTGTCCAGACAG 0: 1
1: 0
2: 2
3: 31
4: 339
Right 900345832 1:2209889-2209911 CGCACATCCCTGCTGCAGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 249
900345824_900345828 -10 Left 900345824 1:2209838-2209860 CCTCCTGCCTTCTGTCCAGACAG 0: 1
1: 0
2: 2
3: 31
4: 339
Right 900345828 1:2209851-2209873 GTCCAGACAGAGCTTGTCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900345824 Original CRISPR CTGTCTGGACAGAAGGCAGG AGG (reversed) Intronic
900137038 1:1122074-1122096 CTGGCTGGGCAGGAGGCTGGGGG + Intergenic
900317958 1:2068840-2068862 CTGGCAGGACAGACAGCAGGTGG + Intronic
900345824 1:2209838-2209860 CTGTCTGGACAGAAGGCAGGAGG - Intronic
900433008 1:2611763-2611785 TGGGCTGGGCAGAAGGCAGGAGG - Intronic
900840222 1:5042690-5042712 CAGGCTGGTCAGAAGGCAGAAGG - Intergenic
902527393 1:17068147-17068169 CTGCCTGGACAGATGGCACCAGG + Exonic
902791030 1:18768167-18768189 CTGTATGGACAGGGGACAGGAGG + Intergenic
903286701 1:22281941-22281963 CTGTCTGGTCTGGAGGCAGGAGG - Intergenic
903674767 1:25056674-25056696 CCCTCTGGTCAGAAGGCATGAGG - Intergenic
903920868 1:26799759-26799781 GTGTCTTGGCAGAAGGCAGAGGG - Intergenic
904197805 1:28798986-28799008 CTGTCTTAACAGATGGCAGCAGG - Intergenic
905025200 1:34845015-34845037 CTGGCTGGGCAGAAGGCAGCAGG + Intronic
905243502 1:36596595-36596617 CAGTCAGGACAGAAGGCACCAGG - Intergenic
907134088 1:52122770-52122792 CTGTCTGGGCAGACAGCAGTAGG - Intergenic
907291547 1:53416625-53416647 CTGTTTGCATAGAAGCCAGGGGG + Intergenic
908495275 1:64688634-64688656 GAGGCTGGACAGAAGGAAGGTGG - Intronic
912571649 1:110628686-110628708 ATGACTTGAAAGAAGGCAGGAGG + Intronic
914085086 1:144447078-144447100 CTGTCTAGAGACAAGGCGGGAGG - Intronic
914363140 1:146953167-146953189 CTGTCTAGAGACAAGGCGGGAGG + Intronic
914488539 1:148133975-148133997 CTGTCTAGAGACAAGGCGGGAGG - Intronic
914588902 1:149089056-149089078 CTGTCTAGAGACAAGGCGGGAGG - Intronic
915014312 1:152719075-152719097 TTGTCTGGGCAGAAGGAAGAAGG + Intergenic
915591690 1:156874548-156874570 CTGTAGGGACACAGGGCAGGAGG - Intronic
915597936 1:156905973-156905995 CTGTCCAGAGAGAGGGCAGGTGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
918269941 1:182888574-182888596 CTGTCAGGACACAGGGTAGGTGG - Intergenic
920419556 1:205822430-205822452 CTGTAGTGACAGACGGCAGGTGG - Intergenic
920707999 1:208268921-208268943 CTGTCTGGAGACAAGGCTGGTGG + Intergenic
921328357 1:214010523-214010545 CTGTGATGACAAAAGGCAGGGGG + Intronic
922212302 1:223495564-223495586 CTGTAGGGACAGAGTGCAGGGGG - Intergenic
922797077 1:228345498-228345520 AGGTCTGGACAGGTGGCAGGAGG - Intronic
924744696 1:246820877-246820899 CTCTCTGGAAAGATGACAGGTGG + Intergenic
924840745 1:247707545-247707567 CTTTGGGGAGAGAAGGCAGGTGG + Intergenic
1062879282 10:965113-965135 CTGTGTGGACCACAGGCAGGCGG - Intergenic
1063046673 10:2399265-2399287 CTCCATGGACAGAAGGCAGCAGG + Intergenic
1063244021 10:4199946-4199968 CAGGCTGGAGAGAAGGCATGGGG - Intergenic
1067042127 10:42960545-42960567 CTGGCAGGACAGGAGGCAGCAGG + Intergenic
1067330556 10:45312739-45312761 CTTGCAGGCCAGAAGGCAGGGGG + Intronic
1067776741 10:49169911-49169933 TTTACTGGGCAGAAGGCAGGAGG + Intronic
1068311583 10:55283614-55283636 GTGACTGGATAGAAAGCAGGTGG - Intronic
1072392043 10:94997369-94997391 CTGCCTGTAAAGAAGGCAGGTGG - Intergenic
1072588405 10:96803442-96803464 TTGTCTGTGCAGCAGGCAGGAGG + Intergenic
1073314289 10:102567603-102567625 CTCTCTGGACAGATGACAGTTGG + Intronic
1073371666 10:102995215-102995237 CTGTCTGGAGAGAAAAAAGGAGG - Intronic
1073471849 10:103727444-103727466 CGGGATGGGCAGAAGGCAGGAGG + Intronic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074372850 10:112914192-112914214 CTGTCTGAAAAGAAAGAAGGAGG - Intergenic
1074555095 10:114481623-114481645 GTGTTTGGAGAGGAGGCAGGAGG + Intronic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1075338966 10:121630259-121630281 CTGTCTCGGAAGAAGGAAGGAGG + Intergenic
1075518199 10:123126484-123126506 AAGGCTGGACAGAGGGCAGGAGG - Intergenic
1075792276 10:125093602-125093624 CTGTGTCGAAAGAAGGGAGGGGG - Intronic
1075974905 10:126686533-126686555 CCCTCAGGACAGAAAGCAGGCGG - Intergenic
1076322351 10:129592729-129592751 CTGGCTTAACAGAAGGCAGGTGG - Intronic
1076777335 10:132705014-132705036 GCGTCTGGACAGGTGGCAGGCGG + Intronic
1077536478 11:3127153-3127175 ATTTCTGGACAGGAGGAAGGAGG + Intronic
1080638541 11:34144441-34144463 CTGGCTTAACAGAAGGCAGCCGG + Intronic
1081746224 11:45474226-45474248 CTGTATTGAAAGAAGGTAGGGGG - Intergenic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1082059850 11:47850474-47850496 CCATCTGGAAAGAAGGAAGGAGG + Intergenic
1082834686 11:57642939-57642961 CTGTCTGGGCAGGAGAAAGGAGG - Intergenic
1083049909 11:59767799-59767821 AGGTCTGGACAGAAACCAGGGGG - Intronic
1083431084 11:62613737-62613759 CTGTCAGGCCAAAAGGCTGGTGG + Exonic
1083946452 11:65925787-65925809 CTGCCTGGGCAGAAGGCAACAGG + Intergenic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1085678515 11:78548718-78548740 CTGTCATGTCAGAAGGGAGGAGG - Intronic
1087604968 11:100366332-100366354 CTGCCTGCACACAAGGCAGAGGG + Intergenic
1087621561 11:100548861-100548883 CTGTCTGTAAACAAGGAAGGGGG - Intergenic
1088422838 11:109668025-109668047 CTGTCTAGGCAGCAGGCAAGGGG - Intergenic
1088541875 11:110921381-110921403 CTTTCTGGACAGGGGTCAGGAGG - Intergenic
1089304547 11:117518208-117518230 ATTTCTGGACAGGAGGAAGGAGG + Intronic
1092173580 12:6388375-6388397 CTGCCAGGACAGCAGACAGGAGG - Intronic
1092776635 12:11949661-11949683 CTTTCTGGAGAGTAGGCAGAGGG + Intergenic
1093519733 12:20034448-20034470 CTATCCAGACAGAAGGGAGGAGG - Intergenic
1094452592 12:30598358-30598380 CTGTCTAGCCAGAAGGGAGATGG - Intergenic
1095155162 12:38843824-38843846 CTTGCAGGACAGAAGGGAGGTGG - Intronic
1095923457 12:47554777-47554799 CTGTTGGGTCAGAAGGCATGTGG - Intergenic
1100265777 12:92974486-92974508 TTTTCTGGACAGCAGGCAAGAGG - Intergenic
1101325977 12:103716320-103716342 CTGTCTGGAGAGCAGGCTGGGGG + Intronic
1101338929 12:103823943-103823965 CTGACTGGGCAGAAGGAAGTTGG - Intronic
1101357755 12:103996602-103996624 CAGTCTGGACTGCAGGGAGGTGG - Intronic
1101722105 12:107359184-107359206 CTGTGAGGACAAAAGGTAGGAGG + Intronic
1103705415 12:122868559-122868581 CTGTCTGGAAAAAAAGCAAGAGG + Exonic
1103916585 12:124378884-124378906 CTGTGGGGACACAAGGCACGGGG + Intronic
1104065747 12:125304269-125304291 CTGTTTGGCCACAAAGCAGGAGG - Intronic
1104906189 12:132214663-132214685 CAGGCTGGACAGGAGGCAGAGGG - Intronic
1105209596 13:18249992-18250014 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1105303077 13:19152341-19152363 CTGTCTTCAGAGAAGGCTGGGGG - Intergenic
1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG + Intergenic
1106116440 13:26821564-26821586 GTGTCTGGAGAGATGGGAGGAGG + Intergenic
1106304901 13:28500823-28500845 GTGGCTGGAGAGGAGGCAGGAGG + Intergenic
1107219368 13:37963181-37963203 CAGTCAGGAGAGAAGGCAGAGGG + Intergenic
1107888459 13:44893892-44893914 GGATCTGGACAGGAGGCAGGAGG + Intergenic
1108147859 13:47498609-47498631 CTGTCTGGGCACGAGGCAGCAGG + Intergenic
1108519144 13:51230017-51230039 CTATCTGTACAGAGGCCAGGAGG - Intronic
1112796317 13:103060210-103060232 CTGTCTGGGCTGAAAGCAGGCGG + Intronic
1112967655 13:105217852-105217874 CTGTCGGGGAAGCAGGCAGGAGG - Intergenic
1114267931 14:21083668-21083690 CTCCCTGGAAAGAAAGCAGGTGG - Intronic
1114493711 14:23118796-23118818 CTGTCTGGGCCGAAGGTATGTGG + Exonic
1118818255 14:69327762-69327784 CTGCCTGGTCAGGAGGGAGGAGG - Intronic
1119417340 14:74481317-74481339 CTGTTAGGACAGAAGGCAAAGGG - Intronic
1121358006 14:93231276-93231298 CAGCCAGGACAGGAGGCAGGAGG + Intergenic
1122033498 14:98931074-98931096 CTGTGTGCACAGAAGACAGGTGG - Intergenic
1122092776 14:99350969-99350991 CTGTCTGGACAGAGGGCCCGTGG + Intergenic
1123018766 14:105387795-105387817 CTGGCTCGGCAGAGGGCAGGTGG + Intronic
1123482292 15:20643300-20643322 TTGTCTGTGCAGCAGGCAGGGGG - Intergenic
1123712532 15:22999388-22999410 CTGTCTGGACTGTGGGCAAGTGG + Exonic
1124623413 15:31293200-31293222 CTTCCTGGACAGAAGGCAAGGGG - Intergenic
1126735427 15:51727709-51727731 CAGTATGTACAGAAGCCAGGGGG - Intronic
1128931114 15:71705640-71705662 GTGTCAGGACAGCAGCCAGGAGG + Intronic
1129272846 15:74428578-74428600 CTTTCTGGGCAGAAAGGAGGAGG + Intronic
1129670596 15:77605786-77605808 CTGGCTGGCCAGGAGCCAGGAGG - Intergenic
1129688200 15:77698227-77698249 CTGTTTGGACAGAAGGCGTGGGG - Intronic
1130101845 15:80900309-80900331 AAGGCTGGACAGAATGCAGGGGG + Intronic
1130859269 15:87872164-87872186 CTCTCTGGACTGCTGGCAGGTGG + Intronic
1131967352 15:97858539-97858561 CTGACAAAACAGAAGGCAGGAGG + Intergenic
1132283146 15:100637857-100637879 CTGGCTTCACAGAAGGCAGCTGG - Intronic
1133226873 16:4344957-4344979 CTGGCAGGAGAGAAGGCAGAAGG + Intronic
1133266387 16:4586912-4586934 CCGTGTGGACAGCAGGCAGGTGG - Intronic
1135716273 16:24771045-24771067 CTGGCTTAACAGAAGGTAGGTGG - Intronic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137541450 16:49364968-49364990 CTGTCTCCACAGAAGGCAGCTGG - Intergenic
1139469220 16:67169537-67169559 CTAACTGAGCAGAAGGCAGGCGG + Intronic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1140001507 16:71029874-71029896 CTGTGAGCCCAGAAGGCAGGGGG + Intronic
1140161995 16:72505964-72505986 ATGTCTGGACAGAAGCCTTGGGG + Intergenic
1140422940 16:74835725-74835747 CTGTCTCAAAAGGAGGCAGGAGG - Intergenic
1140479512 16:75254818-75254840 CTGTTTGTACAGAAAACAGGTGG + Intronic
1140960530 16:79907506-79907528 CTTTCTGGGTAGAAGGCAGCAGG + Intergenic
1141777422 16:86133707-86133729 CTGCCTGGACAACTGGCAGGAGG - Intergenic
1143017081 17:3896632-3896654 CTGTCTGAACAGAAGGTCTGGGG - Exonic
1143355321 17:6323667-6323689 CTCTTTGGAGAGAAGGGAGGTGG - Intergenic
1144166842 17:12620461-12620483 CTGAGAGGAGAGAAGGCAGGGGG - Intergenic
1144711314 17:17403462-17403484 AGGTCTGGACAGAGGGGAGGAGG + Intergenic
1145269927 17:21399412-21399434 ATGTCTGCTCAGAAAGCAGGTGG - Intronic
1146553590 17:33803702-33803724 TTGTCTGAATAGAAGGCAGGCGG - Intronic
1147371839 17:39997763-39997785 CTTACTGTACAGCAGGCAGGAGG + Exonic
1148049652 17:44763461-44763483 CAGGCTGGACAGAAGTGAGGGGG - Intronic
1148172162 17:45530710-45530732 CTTTCTGGAAAGAAGCCAGCTGG - Intergenic
1148363767 17:47036857-47036879 CTTTCTGGAAAGAAGCCAGCTGG + Intronic
1150403364 17:64877628-64877650 CTTTCTGGAAAGAAGCCAGCTGG - Intronic
1150901652 17:69284688-69284710 CTGTCTTAACAGAAGACAGATGG + Intronic
1151163328 17:72184037-72184059 CTGTCCTGAGAAAAGGCAGGAGG + Intergenic
1151680707 17:75621284-75621306 CTGGCTGGGATGAAGGCAGGAGG + Intergenic
1151820234 17:76493082-76493104 CAGTCAGGACAGAAGGAGGGCGG + Intronic
1152086779 17:78224764-78224786 CTGTCTGGGCAGATGGCTGTTGG - Exonic
1152421353 17:80195071-80195093 CTGACTGGAGAGGAGGCAGGAGG - Intronic
1153450251 18:5219189-5219211 CTGTGTGCACAGAAGTCAGAAGG - Intergenic
1153812713 18:8765894-8765916 CTGAGTGGACAGAAGGAAAGAGG - Intronic
1153820643 18:8828664-8828686 CTCTCTGGGCAGATGGCAGAGGG + Intronic
1154121148 18:11653773-11653795 CTGCCTGGACTGGGGGCAGGTGG - Intergenic
1154333787 18:13450411-13450433 ATGTCTGGACAGGGGGCTGGAGG + Intronic
1156916331 18:42467353-42467375 ATGACTGGACAGAAGACAGTAGG - Intergenic
1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG + Intergenic
1157592838 18:48845962-48845984 GTGTTTGGACTGGAGGCAGGGGG - Intronic
1158183287 18:54742428-54742450 CTATCAGAACGGAAGGCAGGAGG + Intronic
1159010823 18:63057594-63057616 CTGCTTGGAAAGAAGGAAGGTGG - Intergenic
1159107354 18:64017783-64017805 CTTTTTGGAAAGAAGGTAGGAGG - Intergenic
1159349957 18:67259601-67259623 CTTACTGCACAGAAGGCAGCAGG + Intergenic
1159921367 18:74230191-74230213 CTGGCCGGTCAGAAGGAAGGAGG + Intergenic
1160707352 19:535814-535836 CTGCAGGGGCAGAAGGCAGGTGG - Intronic
1161015703 19:1981834-1981856 TTGTCTGGGGAGAAGGCACGGGG - Intergenic
1161053186 19:2176214-2176236 CTGTGTGGACCGAGGGCTGGGGG - Intronic
1161156770 19:2735879-2735901 CTTTCTGGACACTAGGCACGAGG + Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161510521 19:4668369-4668391 ATGTCTGGACAGAAGGAGGGAGG - Intronic
1161520862 19:4722972-4722994 CTGTGTGGGAAGAAGGTAGGCGG + Intronic
1161978487 19:7618907-7618929 CTGTGTGGGCAGGAGGCAGCTGG - Intergenic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1163091740 19:15024777-15024799 CTGTCTTGACATAAGGGAGCTGG - Intergenic
1164462584 19:28461705-28461727 CTGGCTGGATAGAAGGTTGGGGG - Intergenic
1164649775 19:29883239-29883261 CTATCTGGAAAGACGGCAGACGG - Intergenic
1165081202 19:33307315-33307337 CTGTCTCCCCAGGAGGCAGGTGG + Intergenic
1165154045 19:33776935-33776957 CTGTCGAGACAGCAGGGAGGAGG - Intergenic
1165244534 19:34490613-34490635 CTGTCTGGGGAGGAGGCATGGGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165920400 19:39294154-39294176 CTGCCTGGAGAGAAGGCAGGCGG - Intergenic
1166594671 19:44034920-44034942 ATGCCTGGACATAAGGAAGGCGG + Intergenic
1166933867 19:46319355-46319377 CCTTCAGGACAGGAGGCAGGTGG - Intronic
1168692338 19:58384810-58384832 CTGCCTGGAGAGTGGGCAGGTGG + Intergenic
926195234 2:10759674-10759696 CTGTGAGTACAGAAGGCCGGAGG + Intronic
927616361 2:24600681-24600703 CTATCTGGAAAGAAAGCAAGAGG - Intronic
927724270 2:25409084-25409106 CTGTCTGGAAAAGTGGCAGGTGG + Intronic
927862815 2:26570775-26570797 CTGTATGGACAGCAGGCTGGAGG + Intronic
928232866 2:29515012-29515034 CTGGCTGGAGAGAAGGCCAGGGG - Intronic
928805178 2:35141223-35141245 CTGACTAGACACAAGCCAGGTGG - Intergenic
929149336 2:38733606-38733628 TTTTCTGGACAGGAGACAGGTGG - Exonic
930707476 2:54519164-54519186 CTGCCTGGACAGGTGGCAGAGGG - Intronic
931213168 2:60216498-60216520 CTGTTTGGACCTAAGTCAGGAGG - Intergenic
932173401 2:69577774-69577796 CTGTCTCCACAGGAGGCAGGAGG + Intronic
932570537 2:72936173-72936195 CTGACTGGACACAAGTGAGGTGG - Intergenic
932806072 2:74784574-74784596 TTGGCTGGAGATAAGGCAGGAGG + Intergenic
933723007 2:85410129-85410151 CTGGCAGGACAGCAGGCTGGGGG + Intronic
933943704 2:87266461-87266483 CTGTGTGGACAGTGGGCTGGAGG + Intergenic
934122859 2:88856967-88856989 CTGTGAGGACAGAAGGCTTGTGG + Intergenic
935582270 2:104766883-104766905 CTGTCTGGCAGGAAGGCAGCCGG + Intergenic
935746324 2:106193434-106193456 CTGCCTGGAGACAGGGCAGGAGG - Intronic
935856878 2:107284194-107284216 ATGTCTGGACAGAAGGAAATTGG - Intergenic
936336516 2:111595118-111595140 CTGTGTGGACAGTGGGCTGGAGG - Intergenic
937610329 2:123853390-123853412 CTTTGTGGTCAGAAGGCAGTGGG + Intergenic
937932485 2:127218106-127218128 CTGTCTGAGCAGTGGGCAGGAGG + Intronic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
940051394 2:149468812-149468834 ATGTCTGAAGAGAAGGCAGCTGG - Intronic
940129737 2:150367782-150367804 CTGACTTAACAGAAGACAGGTGG + Intergenic
943718485 2:191178299-191178321 CTGTATGAACAGAAGACATGGGG + Intergenic
946016325 2:216606858-216606880 CTGTGAGGAAGGAAGGCAGGTGG - Intergenic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
948259302 2:236591042-236591064 CTGTCTGAGCAGGAGGCAGGAGG - Intergenic
948264816 2:236628700-236628722 CTGTCAGCAAAGAAGGGAGGTGG + Intergenic
948799330 2:240424367-240424389 CTGTGGGGGCAGAAAGCAGGAGG + Intergenic
948962801 2:241354657-241354679 CAGTCTGGAGGGAAGGCAGCAGG - Intergenic
1170695824 20:18657768-18657790 CTTTCTGGGCAGTTGGCAGGAGG + Intronic
1171290753 20:23981659-23981681 CAGTCTGCACAGACGACAGGGGG + Intergenic
1172066333 20:32223291-32223313 CTGTCTGGAAAGAATGAGGGGGG - Intronic
1172110529 20:32542026-32542048 CTGTCTGGACAGGCGGGTGGTGG + Intronic
1172906277 20:38372169-38372191 CTTTCTGGAAAGAGGGAAGGAGG + Intronic
1173642590 20:44614511-44614533 CTGTGGGGACAGAAGGCAAGGGG - Intronic
1175060535 20:56238236-56238258 CTGTCAGGACCGTGGGCAGGTGG - Intergenic
1175304594 20:57967138-57967160 CTGGCTGGGAAGAAGGCAGTGGG + Intergenic
1175458271 20:59131449-59131471 CTGACTTGACAGAGGGGAGGTGG + Intergenic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175924331 20:62464661-62464683 CCTTCTGGACAGACGGCAGTCGG - Exonic
1176293225 21:5057221-5057243 CTGCCTGGACAGCATGCAGATGG - Intergenic
1177229579 21:18302301-18302323 TTAGCAGGACAGAAGGCAGGGGG + Intronic
1177752655 21:25304725-25304747 GTGTCAGAACAGAAGGAAGGCGG + Intergenic
1177901821 21:26926254-26926276 CTGTCTAAACAGAAGGTAGTTGG + Intronic
1178365684 21:31987169-31987191 CTGGCTGGATTAAAGGCAGGGGG + Intronic
1179064729 21:38014527-38014549 CTGTCTGGACATGAAGCATGGGG + Intronic
1179555699 21:42174233-42174255 CAGGCTGGAGAGGAGGCAGGTGG + Intergenic
1179864035 21:44206429-44206451 CTGCCTGGACAGCATGCAGATGG + Intergenic
1179923782 21:44521626-44521648 GTGCCTGGAAATAAGGCAGGAGG - Intronic
1180033515 21:45229050-45229072 CTGCTTGGCCAGAAGGCAGAAGG - Intergenic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1180766668 22:18349407-18349429 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1180779645 22:18512971-18512993 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1180812361 22:18770292-18770314 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1181198520 22:21204539-21204561 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1181329000 22:22074819-22074841 CAGTCTGGACAGAGAGCAGCAGG + Intergenic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181401218 22:22651261-22651283 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1181648312 22:24245630-24245652 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1181703183 22:24632341-24632363 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1181911463 22:26241649-26241671 CTGTTTGGGAAGAAGGCAGGAGG + Intronic
1182359431 22:29738078-29738100 CTGGCTGGAGGGGAGGCAGGCGG - Intronic
1182572586 22:31249821-31249843 GTGTCTGGACAGGGGGAAGGGGG + Intronic
1182658284 22:31906786-31906808 GTGTCTGGGAAGAGGGCAGGCGG + Exonic
1183005143 22:34894980-34895002 CTTTCTGAACAGCAAGCAGGTGG + Intergenic
1183776293 22:39968273-39968295 GTATCTGGAAAGAAGGCAGTGGG + Intronic
1183934916 22:41256621-41256643 GGGTCTGGTCTGAAGGCAGGTGG - Intronic
1203228285 22_KI270731v1_random:90298-90320 CAGTCTGCACAGAGGACAGGGGG - Intergenic
949765057 3:7516965-7516987 CTGACTGTCCAGAGGGCAGGTGG - Intronic
950048260 3:9964698-9964720 GTGTCTGGACATAAGGTTGGAGG - Intronic
950720103 3:14876621-14876643 CTGGCTGAACAGAAGGTAGCTGG + Intronic
951508149 3:23472211-23472233 CTGGCTGGACAGAAAGTAAGTGG - Intronic
952980607 3:38731913-38731935 CTGGCTGGCAAGAAGACAGGAGG - Intronic
955070883 3:55571637-55571659 CTGTTTGGTCAGAAAGCAGAGGG - Intronic
955343458 3:58143480-58143502 CTGTCTTCCCAGAAGGCATGTGG - Exonic
956701950 3:71966477-71966499 CTGACAGGAGAGAAGGCAAGAGG + Intergenic
957846572 3:85744593-85744615 ATGTTTGGACAGAATGAAGGTGG + Intronic
960668108 3:120130848-120130870 CTGTCTCCTCAGAATGCAGGTGG - Intergenic
961017572 3:123479552-123479574 CTGTCAGGGCAGAATGCAAGCGG + Intergenic
961075569 3:123978766-123978788 ATGTCTGGATAGAATGGAGGGGG + Intronic
961308118 3:125973742-125973764 ATGTCTGGATAGAATGGAGGGGG - Intronic
961677689 3:128577684-128577706 CTGTTGGGGCAGAGGGCAGGTGG - Intergenic
961822287 3:129581168-129581190 CTGTGTGAACAGCAGGCAGCAGG - Intronic
961912222 3:130329880-130329902 CTCTCTGGAAAGAAGGAAAGAGG + Intergenic
962368060 3:134798616-134798638 CTTTGTGTCCAGAAGGCAGGAGG - Intronic
963626576 3:147680952-147680974 GTCTCTGGACAGAAGGCAAATGG + Intergenic
963793158 3:149604788-149604810 CTGGCAGGCCAGAAGGCAGGTGG + Intronic
965211330 3:165793328-165793350 CTGTCTGAAGAGATGGTAGGAGG - Intronic
967356512 3:188577926-188577948 CTTTCTGGAAAGAAGGAAGGCGG - Intronic
967868110 3:194206812-194206834 CTGACTGGAAAGAAGGCACAAGG - Intergenic
968046487 3:195626653-195626675 CTGTCTGGAGAGAAGACATTAGG - Intergenic
968308166 3:197663388-197663410 CTGTCTGGAGAGAAGACATTAGG + Intergenic
968588923 4:1448217-1448239 CTGCCAGGACAGAAGGAGGGTGG + Intergenic
969092978 4:4709933-4709955 TTATATGGAAAGAAGGCAGGCGG - Intergenic
969354468 4:6617357-6617379 CTTTGGGGACAGAAGGAAGGTGG - Intronic
969453233 4:7286687-7286709 GTGCCAGGCCAGAAGGCAGGAGG - Intronic
969456723 4:7304474-7304496 CTGGATGGACGGGAGGCAGGAGG - Intronic
970359866 4:15298269-15298291 GTGTCTGTAAAGAAGGCATGGGG - Intergenic
970595030 4:17592245-17592267 CTGTCTGGAGCAAGGGCAGGTGG - Intronic
977224905 4:94383888-94383910 CTGTCTAGACAGAAGATAGTAGG + Intergenic
980631792 4:135446679-135446701 CTGTGTGTACAGTAGACAGGTGG + Intergenic
982326068 4:154129193-154129215 CTTTCTGGTCTGAGGGCAGGTGG + Intergenic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
984903910 4:184609499-184609521 CTGTCTAGACAGCAGGCAAGGGG + Intergenic
985477728 5:89216-89238 GTGTGTGGACAGAGGGGAGGAGG - Intergenic
985492524 5:187911-187933 CTGTCAGGTCAGAGGGCAGCAGG + Exonic
986021603 5:3809440-3809462 GTCACTGGAGAGAAGGCAGGTGG + Intergenic
986456760 5:7927633-7927655 AGGTGTGCACAGAAGGCAGGTGG + Intergenic
987383343 5:17306621-17306643 CAGTCTGGGCAGGAGGCAGCAGG - Intergenic
992626373 5:78639113-78639135 CTGTGTGGACAGGTGGCTGGGGG - Intronic
992643182 5:78787411-78787433 CTGTCAGGACCCAAGACAGGAGG + Intronic
993050615 5:82922274-82922296 CTGTCTGGACAGGACACAGCTGG - Intergenic
996308646 5:122078254-122078276 GTGTCTGGAGTGAAGGAAGGAGG + Exonic
997619557 5:135276937-135276959 CTGTTTGGAAAGATGGCAGATGG - Intronic
999438429 5:151582259-151582281 GTGTGTGGACAGAACCCAGGGGG - Intergenic
1001710218 5:173772417-173772439 CAGCCGGGGCAGAAGGCAGGAGG - Intergenic
1002447173 5:179296655-179296677 CGGCCTGGGCAGAGGGCAGGAGG + Intronic
1003054622 6:2806897-2806919 CTGTCTGGACAGCAGGCAAGAGG + Intergenic
1004198090 6:13523870-13523892 CTCTCAGAACAGAAGGCAGTTGG - Intergenic
1004604765 6:17183553-17183575 TTGTCTGTGCAGCAGGCAGGAGG + Intergenic
1005420128 6:25640275-25640297 CTCTGTTGACAGGAGGCAGGAGG + Intergenic
1005870292 6:29970454-29970476 CTATCTGCACAGAAGGTATGAGG + Intergenic
1006169160 6:32083175-32083197 CTGTCTGGACTCCAGGAAGGAGG - Intronic
1006298903 6:33182928-33182950 CTGTTTGGTCAGAATGAAGGTGG - Intronic
1007032649 6:38641886-38641908 CTGACTGGGCTGGAGGCAGGAGG + Intergenic
1009926881 6:70130663-70130685 CTGCCTGGTCAGGAGGCAGGCGG - Intronic
1013631821 6:111993135-111993157 CTGTATGGAGAGAAGGCTGTGGG + Intergenic
1014832999 6:126124936-126124958 CAGTCTGGGCAAAAGACAGGAGG - Intergenic
1019102954 6:169646981-169647003 CCCTCTGGACAGATGGCATGAGG + Intronic
1019173753 6:170149338-170149360 CTGTCTACACAGAAGGCTTGTGG - Intergenic
1019173842 6:170149803-170149825 CTGTCTACACAGAAGGCTTGTGG - Intergenic
1019723367 7:2586954-2586976 ATCTCTGCACAGAAGCCAGGGGG - Intronic
1019937511 7:4266073-4266095 CTGTCAGGTGAGAAGGAAGGGGG - Exonic
1020470326 7:8527328-8527350 ATGGCTGGACAGTAGGCAGAAGG + Intronic
1022498584 7:30868517-30868539 ATGTATGGACAGAGGGCAGGTGG + Intronic
1022668572 7:32433510-32433532 CTGACTGGTCAGAAGCCATGTGG - Intergenic
1023262292 7:38370246-38370268 CTGTCTGGCCAGACGACTGGAGG - Intergenic
1023900270 7:44471497-44471519 CTGTCAGCAGAGAAGTCAGGAGG - Intronic
1024119852 7:46225717-46225739 CTGTTTGGACAGAAGAGAGCAGG + Intergenic
1026902598 7:74045302-74045324 CTGTCTGGACAGAGGGCTGATGG + Intronic
1028482105 7:91318091-91318113 CTATCTGGAGAGATGGCACGGGG + Intergenic
1029860763 7:103569333-103569355 CAGTCAGGACAAAAGCCAGGAGG - Intronic
1030372820 7:108719679-108719701 CTATCTGGACAGGGTGCAGGTGG - Intergenic
1031528603 7:122850576-122850598 TTGTCTGGAAAGAAGGGAGCTGG + Intronic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1032455298 7:132068596-132068618 CTATCTGGTGAGAAGGAAGGGGG - Intergenic
1033069936 7:138192783-138192805 CTGTCATGGCAGCAGGCAGGAGG - Intergenic
1036168090 8:6456731-6456753 CTGTCTGATCAAAAGGCATGAGG + Intronic
1037180422 8:15998399-15998421 TTTTCTGGCCAGAAGGCACGAGG - Intergenic
1037422451 8:18717750-18717772 CTGTATGGAGAGAAGGCAAAGGG - Intronic
1037818757 8:22125501-22125523 CGATCTGGAGAGAGGGCAGGGGG + Exonic
1038059182 8:23893110-23893132 CTATCTAGAGAGAAGGCAGTCGG - Intergenic
1038542768 8:28402751-28402773 CTGTGTGTGCAGGAGGCAGGAGG - Intronic
1039806810 8:41006981-41007003 CCTTTTGGACAGAATGCAGGAGG - Intergenic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1049244450 8:141554552-141554574 CTGCCTGCTCAGAAGGCACGAGG + Intergenic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049592184 8:143467771-143467793 CTGCCTGGGCAGAGGGCGGGAGG - Intronic
1049905439 9:212454-212476 CTCTCTGGACAGAGGGCTGATGG + Intergenic
1050556385 9:6792953-6792975 GTGTCTGGAGAGAAGACAGTAGG - Exonic
1052834515 9:33240574-33240596 CTGTGGGGACAGAAGGGAGCAGG + Intronic
1053286201 9:36850964-36850986 CTGTGGGGGCAGAAGGCAGGTGG + Intronic
1054744085 9:68836785-68836807 CTGTCTTACCAGAAGCCAGGTGG + Intronic
1055130246 9:72766593-72766615 CTGTGTAGGCAGGAGGCAGGGGG + Intronic
1056383227 9:86074545-86074567 GTGTCTGCACTGAAGGAAGGCGG + Intronic
1058929366 9:109703963-109703985 CAGTGTGGACTGAAGGCAAGTGG - Intronic
1059349622 9:113655278-113655300 CTGTCTGCGCTGAAGGCAGCAGG - Intergenic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1061824653 9:133250561-133250583 CTTTCTGGACAGAAGCAATGTGG - Intronic
1061878228 9:133555539-133555561 CGGTCTGGAGAGGAGACAGGTGG - Exonic
1061929752 9:133826409-133826431 CTCTCTGGGGAGAAGCCAGGAGG + Intronic
1062173374 9:135147707-135147729 GTGCCTGGACAGAGGCCAGGTGG - Intergenic
1062253860 9:135611752-135611774 GTGACTGGAGACAAGGCAGGGGG - Intergenic
1062525075 9:136974903-136974925 CTGCCTGGGCCGCAGGCAGGGGG + Intergenic
1185842239 X:3402655-3402677 CCGTCATGACAGAAGGCAAGGGG - Intergenic
1185992409 X:4906126-4906148 ATATCTGGAAAGAATGCAGGTGG + Intergenic
1186450644 X:9670530-9670552 CTGTCTAGGCAGCAGGCAAGGGG + Intronic
1187073161 X:15908706-15908728 CTTTCTGGACAAAGGGCAAGTGG + Intergenic
1187313946 X:18174412-18174434 CTATCTGGAAAGAAGGAAAGGGG + Intronic
1188862438 X:35272963-35272985 CTGTCTAGAAAGAAGGGAGCAGG + Intergenic
1196298872 X:114031559-114031581 CAGTCATGACAGAAGGCAGAAGG + Intergenic
1198962433 X:142196209-142196231 CTGTCTGGACAGAAGAGGGAGGG - Intergenic
1199719692 X:150533875-150533897 GTACCTGGCCAGAAGGCAGGGGG + Intergenic
1199841501 X:151653972-151653994 CTGTCTTGAAAGAAGAAAGGAGG - Intronic
1200292005 X:154884414-154884436 CTCTATGGACAGAAAGCAGATGG + Intronic
1200338843 X:155380151-155380173 CTCTATGGACAGAAAGCAGATGG + Intergenic
1200347626 X:155460541-155460563 CTCTATGGACAGAAAGCAGATGG - Intergenic
1200933220 Y:8715766-8715788 CTGGCTGGAGAGCAGACAGGAGG - Intergenic
1201383535 Y:13413330-13413352 CGGTGTGGATAGAGGGCAGGAGG - Intronic