ID: 900348639

View in Genome Browser
Species Human (GRCh38)
Location 1:2224399-2224421
Sequence CACTGCTGGCTCCTTAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900348633_900348639 -5 Left 900348633 1:2224381-2224403 CCATCCAACTCATCTCCACACTG No data
Right 900348639 1:2224399-2224421 CACTGCTGGCTCCTTAAGGTGGG No data
900348634_900348639 -9 Left 900348634 1:2224385-2224407 CCAACTCATCTCCACACTGCTGG No data
Right 900348639 1:2224399-2224421 CACTGCTGGCTCCTTAAGGTGGG No data
900348627_900348639 26 Left 900348627 1:2224350-2224372 CCAGTGTCTTCCTCTTTCTGGTC No data
Right 900348639 1:2224399-2224421 CACTGCTGGCTCCTTAAGGTGGG No data
900348631_900348639 16 Left 900348631 1:2224360-2224382 CCTCTTTCTGGTCCTGGGGCGCC No data
Right 900348639 1:2224399-2224421 CACTGCTGGCTCCTTAAGGTGGG No data
900348632_900348639 4 Left 900348632 1:2224372-2224394 CCTGGGGCGCCATCCAACTCATC No data
Right 900348639 1:2224399-2224421 CACTGCTGGCTCCTTAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900348639 Original CRISPR CACTGCTGGCTCCTTAAGGT GGG Intergenic
No off target data available for this crispr