ID: 900349861

View in Genome Browser
Species Human (GRCh38)
Location 1:2229230-2229252
Sequence TTTGAGGATCTCCAGCTGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900349861_900349869 15 Left 900349861 1:2229230-2229252 CCGACCAGCTGGAGATCCTCAAA 0: 1
1: 0
2: 0
3: 15
4: 130
Right 900349869 1:2229268-2229290 CCCTTCTCGGCGCCCTCGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 69
900349861_900349866 2 Left 900349861 1:2229230-2229252 CCGACCAGCTGGAGATCCTCAAA 0: 1
1: 0
2: 0
3: 15
4: 130
Right 900349866 1:2229255-2229277 CATGGGCATCCTGCCCTTCTCGG 0: 1
1: 0
2: 2
3: 19
4: 235
900349861_900349871 16 Left 900349861 1:2229230-2229252 CCGACCAGCTGGAGATCCTCAAA 0: 1
1: 0
2: 0
3: 15
4: 130
Right 900349871 1:2229269-2229291 CCTTCTCGGCGCCCTCGTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900349861 Original CRISPR TTTGAGGATCTCCAGCTGGT CGG (reversed) Exonic
900349861 1:2229230-2229252 TTTGAGGATCTCCAGCTGGTCGG - Exonic
900910022 1:5589546-5589568 TTTGAGGTTATCCAGTTGGTTGG - Intergenic
902762032 1:18587542-18587564 GATGAGGATTTCCAGCTGGTGGG + Intergenic
904717898 1:32483058-32483080 TTTCAGGAACTCCAGCCGATAGG - Intronic
905031694 1:34888337-34888359 TCTGAGGATGCCCAGCTGGTAGG + Intronic
907565269 1:55428349-55428371 GTTGAGAATCTGCAGCTGGGAGG + Intergenic
915265722 1:154715841-154715863 TTTTAAAATCTCCAGCTGATAGG - Intronic
915432725 1:155879063-155879085 TTTGAGGATCCAGAGCTGATGGG - Intronic
915622204 1:157092676-157092698 TTTGAGGTTCTCCAGATTGGGGG + Exonic
920186488 1:204162541-204162563 TTTAAGGAACTCCACCTGGCGGG + Intronic
922976064 1:229784502-229784524 GTTGAGGAACTACATCTGGTGGG + Intergenic
923697949 1:236273087-236273109 TTTGAGGATCTTGAGATGGAAGG + Intronic
1062909489 10:1203583-1203605 TTTGAGGATCTCCAGAGGTCTGG + Intronic
1065909301 10:30287436-30287458 TTTCAGGATTTCCAGAAGGTGGG + Intergenic
1068872254 10:61957989-61958011 TTTGAGGTTGTCCACCTGGTTGG + Intronic
1069701326 10:70428676-70428698 TTTCAGGAGTTTCAGCTGGTGGG + Intergenic
1070666507 10:78348897-78348919 TTGGAGGCTCTCCACTTGGTGGG - Intergenic
1072613565 10:97035004-97035026 TTGAAGGGTCACCAGCTGGTCGG + Intronic
1074981654 10:118624826-118624848 ACTGGGCATCTCCAGCTGGTTGG - Intergenic
1075409234 10:122215160-122215182 TTTAAAGATCTCCAGCTTGATGG + Intronic
1075731765 10:124640599-124640621 TTCGAGGCTCTGCAGCTGCTAGG - Intronic
1078055332 11:8004448-8004470 TGTGTCTATCTCCAGCTGGTGGG + Intergenic
1081617984 11:44601672-44601694 TCTGAGAATCTCAAGCTGGCCGG + Intronic
1082098753 11:48153790-48153812 TTTCAGGATCTGAAGCTTGTTGG + Exonic
1083327717 11:61881641-61881663 TTTAAGACTCACCAGCTGGTAGG - Intronic
1085433045 11:76472978-76473000 TTTGAGAATGTCAAGATGGTCGG + Intronic
1087424020 11:97967222-97967244 TTTTAGGATCTTCCACTGGTTGG + Intergenic
1096181395 12:49552677-49552699 TTTGATGAGCTGCACCTGGTGGG + Intronic
1100358079 12:93850376-93850398 TTTGATGATCTTCAGATGGAAGG + Exonic
1101241639 12:102844893-102844915 TTTCAGGTTCTCCAGCTTGCAGG + Intronic
1101598792 12:106190342-106190364 TTTGAGGAGCTGCAGATTGTGGG - Intergenic
1102519148 12:113468214-113468236 CTTGAGCGTCTCCAGCTGCTTGG + Exonic
1103937337 12:124483537-124483559 CTTGAGGTTCTGCTGCTGGTTGG - Intronic
1104239205 12:126971144-126971166 TATGAGAAACACCAGCTGGTTGG + Intergenic
1109369791 13:61408077-61408099 TTTGAAGAACACCAGCTGGTTGG + Intergenic
1109715543 13:66217343-66217365 TTTGAAGATATGCAGATGGTGGG + Intergenic
1109821591 13:67664275-67664297 TTTGAGGTTTTCCAGATGGAAGG + Intergenic
1110582193 13:77143550-77143572 TCTCAGGATCTCCAGCTTGCAGG + Intronic
1114535398 14:23419201-23419223 CTTGAGGTCCTCCAGCTGCTGGG + Exonic
1116918682 14:50549581-50549603 CTTGATGGTCTCCAGCTGGGTGG - Intronic
1121742205 14:96262084-96262106 CTGGAGGAGCTACAGCTGGTGGG - Intronic
1122859593 14:104576558-104576580 GTTGAGGGTCTCCAGCTGGGTGG - Intronic
1123797416 15:23785995-23786017 TGTGAGGACCCCCAGCTAGTTGG + Intergenic
1125060426 15:35414936-35414958 TTTGAGGTTCTCCCTCTTGTAGG + Intronic
1126377128 15:48007713-48007735 CTTGAGGATCTGCATCTGGCTGG - Intergenic
1126710110 15:51445864-51445886 TATGAGGTTTTCCAGCTGGTTGG + Intergenic
1130151220 15:81313195-81313217 ATCGAGGAGCTCCAGCTGTTGGG - Exonic
1132293185 15:100717453-100717475 TGTGACGCTCTCCAGCTGGGAGG - Intergenic
1132797343 16:1731656-1731678 TTTGAGGATTTCCTGTTAGTAGG + Intronic
1134567356 16:15263075-15263097 TGTGAGGTCCTGCAGCTGGTAGG - Intergenic
1134735136 16:16493625-16493647 TGTGAGGTCCTGCAGCTGGTAGG + Intergenic
1134932385 16:18218592-18218614 TGTGAGGTCCTGCAGCTGGTAGG - Intergenic
1136362169 16:29787722-29787744 TTTAAGGATCTGCATCTGGCTGG - Intergenic
1136782529 16:32916533-32916555 CTTGAGGAGCCCCAGCTGATGGG + Intergenic
1136887265 16:33937317-33937339 CTTGAGGAGCCCCAGCTGATGGG - Intergenic
1138351489 16:56348371-56348393 TGTCAGGATCGCCATCTGGTGGG + Intronic
1138464781 16:57181505-57181527 TTAGAGGACACCCAGCTGGTTGG - Intronic
1138610694 16:58121581-58121603 TTTGAGTATCTCCAGCTCATGGG - Intronic
1203085188 16_KI270728v1_random:1180521-1180543 CTTGAGGAGCCCCAGCTGATGGG + Intergenic
1144556426 17:16286518-16286540 TTTGAGGATATTCAGCCAGTGGG + Intronic
1146138359 17:30342989-30343011 TTTAAGGATATACAGCTAGTAGG + Intergenic
1146502571 17:33376923-33376945 TTTGAGGATCCCCATTTTGTAGG + Intronic
1147142790 17:38468703-38468725 CTTGAGGAGCCCCAGCTGATGGG + Intronic
1151533037 17:74719895-74719917 TTTGAGGTTCTGGGGCTGGTAGG - Intronic
1158490683 18:57907021-57907043 CTTGAAGATCTCCATCTGCTGGG - Intergenic
1158955733 18:62536083-62536105 TTTTAGGATGTCCAGCTACTTGG + Intronic
1164668879 19:30062040-30062062 TTTGTGGAGCTTCAGCGGGTGGG + Intergenic
1165725645 19:38110763-38110785 TTGGGGGATTTGCAGCTGGTAGG - Intronic
925285686 2:2714243-2714265 TTTCATCATCTCCTGCTGGTTGG - Intergenic
925736836 2:6971169-6971191 TTGCAGGAGCTCCAGCTGGTTGG + Intronic
925886015 2:8394293-8394315 TCTGAGGGTCTCCAGCTGCCAGG + Intergenic
928899069 2:36298317-36298339 TCTGAGGATGTTCATCTGGTTGG - Intergenic
928979325 2:37121934-37121956 CTTTAGGATCTCCAGTTGTTTGG + Intronic
929099688 2:38299621-38299643 TATGTGGATCTCCAGGTGTTAGG + Intronic
931283513 2:60814021-60814043 TTTCAGGATGTCGAGGTGGTTGG - Intergenic
932097698 2:68866234-68866256 AATGTGGACCTCCAGCTGGTGGG + Exonic
932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG + Intronic
934950393 2:98571702-98571724 TTTGGGGGTATTCAGCTGGTGGG - Intronic
935533334 2:104261971-104261993 TTAGAGGATCTCCAGTTATTTGG - Intergenic
936559941 2:113528754-113528776 ATGGAGGACTTCCAGCTGGTTGG + Intergenic
937249963 2:120517403-120517425 TTTAAGTAACTACAGCTGGTGGG - Intergenic
941831024 2:169959835-169959857 TTTTAGGTTTTCCAACTGGTTGG + Intronic
941967851 2:171317491-171317513 TTTGATTTTCTCCAGCAGGTAGG - Exonic
943165230 2:184314101-184314123 TTGGAGGATCTGCAACTGTTAGG - Intergenic
948594886 2:239073551-239073573 TTTGGGCAACTCCAGCTGGTGGG - Intronic
1168979170 20:1990397-1990419 CTTGTGGGTCTCCAGGTGGTTGG + Intronic
1169492765 20:6085195-6085217 GTTGAGGACCTCTGGCTGGTAGG + Exonic
1173888429 20:46481941-46481963 GTTGAGGATCTTCAGATGGGGGG + Intergenic
1175339581 20:58219690-58219712 TTTTATGAGCTCCGGCTGGTTGG + Intronic
1178292068 21:31377235-31377257 TCTGAGTTTCTCCAGCAGGTGGG - Intronic
1179559248 21:42202325-42202347 GTTGAAGATCTCAGGCTGGTGGG + Intronic
1179622858 21:42630314-42630336 TTTGAGGGTCACCTGCTGGGTGG + Intergenic
1182070160 22:27457981-27458003 TTGTGGGATCTCCAGGTGGTGGG - Intergenic
1183782051 22:40005267-40005289 TTTTAGGATCATCTGCTGGTTGG - Intronic
1184811416 22:46835276-46835298 TTTGTAGATCTCCATCTGTTTGG - Intronic
952261406 3:31743982-31744004 TTCCAGAATCTCAAGCTGGTGGG - Intronic
952581891 3:34843770-34843792 TTAGCGGATTTCCAGCTGGTGGG - Intergenic
957512605 3:81208692-81208714 TTTGAGTCACTCCAGATGGTAGG + Intergenic
962312491 3:134336558-134336580 TTGGAGGAGCTCAAGCTGGCTGG - Intergenic
964037017 3:152211437-152211459 TTCTGGGATCTCCAACTGGTAGG + Intergenic
975669908 4:76770648-76770670 CTGGAGGGTCTCCAGCTTGTGGG - Exonic
984220607 4:176970257-176970279 ATTGGTGATCTCCTGCTGGTTGG + Intergenic
987798981 5:22668494-22668516 GTTGAGGATCTGCATCTGGTGGG + Intronic
988081885 5:26425746-26425768 GTTAAGGATCTTGAGCTGGTGGG - Intergenic
989763067 5:45043675-45043697 TTTGAGGACATGCGGCTGGTAGG - Intergenic
990599873 5:57347487-57347509 CTGGAGGGTCTCCTGCTGGTGGG + Intergenic
992109340 5:73478123-73478145 TTTGAGGACATCCAAATGGTTGG + Intergenic
992888671 5:81184243-81184265 CTTGAGCATCTCCTGCTGGGAGG + Intronic
995416072 5:111914739-111914761 TTTGTGGAACTTCAGCTTGTTGG - Intronic
997237705 5:132283326-132283348 TTTGATGATCTCCAGTTGAGTGG + Intronic
997488245 5:134250094-134250116 TTTGAGGATCTTAGGCTGATAGG - Intergenic
1003949805 6:11106859-11106881 TTTGAGTATCTGGAGCTGTTAGG + Intronic
1007045939 6:38774262-38774284 TTTGAGGATCTGGAGCTAGTAGG + Intronic
1007715731 6:43855026-43855048 TCTGGGGTTCTCCAGCTGGGAGG + Intergenic
1026273434 7:68856212-68856234 TTTGAGAATATCAAGCTGGAAGG - Intergenic
1028119230 7:87039142-87039164 TTTTAGGTTTTCCAGTTGGTTGG - Intronic
1028867895 7:95735010-95735032 TTTGAGCATACCCAGATGGTGGG + Intergenic
1028909021 7:96186914-96186936 TTTGAGTATCTCTGGGTGGTAGG - Intronic
1031006468 7:116478592-116478614 TTTGATGACCTCCAGATTGTAGG + Intronic
1031241850 7:119255069-119255091 TTTTAAGATGTCCTGCTGGTAGG + Intergenic
1033522032 7:142170131-142170153 TTTCAGGGTCACCAACTGGTTGG - Intronic
1035259622 7:157653135-157653157 TGTGAGGAGCCCCAGCAGGTGGG - Intronic
1036417207 8:8561759-8561781 TTTGTCCATCGCCAGCTGGTAGG - Intergenic
1037438070 8:18885498-18885520 TGTGAAGAACTCCAGCTGCTTGG - Intronic
1037627866 8:20623843-20623865 CTTGTAGATCTCCAGCTTGTAGG - Intergenic
1037712504 8:21366478-21366500 TTTGAGGATCTTTTGCTGGCTGG - Intergenic
1037794027 8:21976503-21976525 TTACCTGATCTCCAGCTGGTGGG - Exonic
1040960544 8:53027450-53027472 TGTGAAGAACTCCAGCTGGTGGG - Intergenic
1040989476 8:53334812-53334834 TACGAGGATCTCCAGCTTATGGG - Intergenic
1043459394 8:80444393-80444415 ACTCAGGATCTCTAGCTGGTAGG + Intergenic
1044349420 8:91146262-91146284 TTTGAGGATCTCCATTTTGAAGG - Intronic
1045281926 8:100756903-100756925 TTTGAGAATCTGCATCTGGCTGG + Intergenic
1045900952 8:107279480-107279502 TTTGAGGATGCCCATATGGTGGG + Intronic
1047453868 8:124991200-124991222 GTTGTGGTTCTCTAGCTGGTGGG - Intergenic
1048464504 8:134654487-134654509 CTAGAGGACCTCCAGCTGTTCGG + Intronic
1049892925 9:87610-87632 GTGGAGGACTTCCAGCTGGTTGG - Intergenic
1053734149 9:41087672-41087694 GTGGAGGACTTCCAGCTGGTTGG - Intergenic
1054694249 9:68343880-68343902 GTGGAGGACTTCCAGCTGGTTGG + Intronic
1055989282 9:82088275-82088297 TTTGAGGTTCTCCAAAAGGTAGG - Intergenic
1061140890 9:128765782-128765804 TGTGGGGATCTCCAGGTGGTCGG + Intronic
1186143987 X:6606720-6606742 TTAGATGATGTCGAGCTGGTGGG + Intergenic
1187704057 X:21991966-21991988 TTTCAGCATCTCCAGCAGCTAGG - Intronic
1188024621 X:25195253-25195275 AATGAGGATCTCCAGCTGAGAGG - Intergenic
1191630580 X:63317448-63317470 TTTCAGGATCCCCAGCAGATTGG - Intergenic
1196152851 X:112393367-112393389 TTTGAAGAGCACCAGCTGATTGG - Intergenic
1197795468 X:130293356-130293378 TAAGAGGATATCAAGCTGGTGGG - Intergenic