ID: 900350476

View in Genome Browser
Species Human (GRCh38)
Location 1:2232095-2232117
Sequence CCGCCCTCACTGGCCGCCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900350459_900350476 24 Left 900350459 1:2232048-2232070 CCCAGACCCTACTTGTCCTAGAA 0: 1
1: 0
2: 0
3: 6
4: 144
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73
900350467_900350476 8 Left 900350467 1:2232064-2232086 CCTAGAAGGAGTGGCCTGGGAGG 0: 1
1: 0
2: 4
3: 45
4: 393
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73
900350469_900350476 -6 Left 900350469 1:2232078-2232100 CCTGGGAGGCCCCGCCTCCGCCC 0: 1
1: 0
2: 20
3: 101
4: 741
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73
900350463_900350476 17 Left 900350463 1:2232055-2232077 CCTACTTGTCCTAGAAGGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73
900350462_900350476 18 Left 900350462 1:2232054-2232076 CCCTACTTGTCCTAGAAGGAGTG 0: 1
1: 0
2: 0
3: 10
4: 161
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73
900350460_900350476 23 Left 900350460 1:2232049-2232071 CCAGACCCTACTTGTCCTAGAAG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900350476 Original CRISPR CCGCCCTCACTGGCCGCCGT TGG Intronic
900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG + Intronic
903398408 1:23020008-23020030 CCGCCCTCCCCCGCCGCCGCCGG + Intronic
906702690 1:47871514-47871536 CCGCCCTGAATGGCCGCCCAGGG + Intronic
912448743 1:109757203-109757225 CCACCCTCACTGGGCCCTGTGGG - Intronic
912576136 1:110674520-110674542 CCGCCCTCACTGCCGGCCGCGGG - Exonic
917433825 1:174999394-174999416 GCGTCATCACTGGCCGCCGTAGG - Intronic
1066129525 10:32378975-32378997 CCGAGCTCACAGGCAGCCGTGGG - Intergenic
1073450003 10:103603584-103603606 TGGCTCTCACTGGCCCCCGTAGG + Exonic
1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG + Intergenic
1076824695 10:132960991-132961013 CAGCCCTCCCTGGTCACCGTGGG + Intergenic
1078528623 11:12119634-12119656 CCGCCCTCATAGGCCGCCTGCGG + Intronic
1080628838 11:34053565-34053587 CCGCCCCGACTGGCCTCCTTAGG + Intronic
1083246066 11:61429449-61429471 CCGCTCTCCCAGGCCGCCGGGGG + Intronic
1083329694 11:61891690-61891712 CCGCCCTCCCTGGCGGCCAATGG - Intronic
1084471377 11:69361202-69361224 CAGCCCTCACTGGCAGCACTGGG + Intronic
1090982950 11:131739524-131739546 CACCCCACACTGGCCGCCGTTGG + Intronic
1091397212 12:161407-161429 CCTCCCTCACTGGGAGCAGTGGG - Intronic
1104877989 12:132049900-132049922 CCAGCCTCACTGTCCACCGTGGG + Intronic
1112348588 13:98613649-98613671 CCTCCCTCACTGGCCAGCGAAGG + Intergenic
1121452295 14:94016673-94016695 CAGCCCTCACTGGCGGCTGCTGG + Intergenic
1122806860 14:104264215-104264237 CCACCCTCACTGCCAGCCCTCGG - Intergenic
1129540379 15:76342964-76342986 CCGCCCGCTCTGGCCGGGGTTGG - Intergenic
1130900729 15:88205323-88205345 CCGCCCAGACTGGCCTACGTGGG + Intronic
1132797912 16:1734316-1734338 CCTCCCTCCCTGGCCGGCGGTGG + Intronic
1134446885 16:14337722-14337744 CTGCCCACACTGGCCGCACTTGG + Intergenic
1139390866 16:66605545-66605567 GCGCCCGCACTGTCCGCTGTGGG + Intronic
1139505336 16:67395645-67395667 CTGCCCTCATTGGCCTCTGTGGG + Intronic
1141657752 16:85425091-85425113 CGGCCCTCCCTGGGCGCCCTGGG + Intergenic
1153006226 18:500643-500665 CCGTCCTCCCTCGCCGCCGCCGG + Exonic
1153997514 18:10454789-10454811 GCGCGCTCTCTGGGCGCCGTCGG - Exonic
1155300663 18:24426512-24426534 CCGCCTTCACTGTCTCCCGTAGG - Intergenic
1156747469 18:40409858-40409880 CCGCCCTCCCTGGCCTCCCAAGG + Intergenic
1157293260 18:46424864-46424886 CCTTCCTCACTGGCCTCTGTGGG + Intronic
1160736574 19:665358-665380 CCAGCCTCACTGGCCCCCTTGGG + Intergenic
1160966498 19:1749130-1749152 CCCTCCTCACTGGACGCCGTTGG - Intergenic
1162293094 19:9793170-9793192 CCGGCTTCACTGGGCACCGTGGG + Intronic
1163151204 19:15415641-15415663 CCGCCCTCCCTGGCCTCCCAAGG - Intronic
1163777864 19:19228417-19228439 TCGCCCACACTGGCTGCAGTCGG - Exonic
1164417928 19:28061691-28061713 CTGACCTCACTGGCCACCATAGG - Intergenic
1166367198 19:42283895-42283917 CCGCCCCCATTGGCCGCCCCGGG - Intronic
1167787370 19:51646963-51646985 CCACCCCCACTGGACGCCGATGG + Intergenic
925746815 2:7050757-7050779 GCTCCCTCACTGGCCTCCATGGG + Intronic
934119934 2:88828892-88828914 CGGCCCTCACTGGAGGCCTTAGG - Intergenic
934978335 2:98821912-98821934 CCGCTCTCCCGGGCCGGCGTCGG + Exonic
938465087 2:131520008-131520030 CCGCCCTCACAGGCCACCCCAGG - Intergenic
1168765698 20:380766-380788 CCGCCCTCGCTGGCCCCCTAGGG - Exonic
1170524796 20:17226916-17226938 CCGCCCTCATTGGCCGCTGGCGG + Intronic
1172258377 20:33538651-33538673 CCACCGTCCCTGGCCTCCGTTGG + Intronic
1172775303 20:37403545-37403567 CCGCCCTCTCAGGCCACCCTAGG - Exonic
1173844080 20:46177141-46177163 CCGCCCTCACTGGCTGGCACTGG - Intronic
1174042254 20:47708357-47708379 CCTCCCTCACTGTCCCCCTTGGG - Intronic
1176052048 20:63125005-63125027 CAGCCCTCAGTGGCCGCCGCTGG - Intergenic
1180949384 22:19714394-19714416 CCGCCCCCCCGGGCCGCCCTGGG + Intergenic
1183351605 22:37337678-37337700 CCCCCCTCTCTGTCCGCCTTGGG + Intergenic
1184663511 22:45976244-45976266 CCGCCCTCCCGGGCCTCCGCAGG + Intronic
954137718 3:48589695-48589717 CCGTCCTCACTGGGCCCAGTGGG + Exonic
963236681 3:142963400-142963422 CAGCCCCCGCCGGCCGCCGTCGG + Exonic
969691559 4:8706818-8706840 CGTCCCTCACTGGGAGCCGTGGG + Intergenic
970394720 4:15654910-15654932 CCGGCGTCACTGGCCGCCCTCGG - Intronic
979984143 4:127294527-127294549 CCCCACTCACTGGCTGCTGTTGG + Intergenic
983904405 4:173169130-173169152 CCGACCTCCCTGGCCGCCGCCGG + Intronic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
992115461 5:73534725-73534747 CCTCCCTCACTGCCTGCCATTGG - Intergenic
993095640 5:83474691-83474713 CCGCCCCCATTGGCCTCGGTGGG - Intronic
1000509097 5:162159993-162160015 CCTCCTTGACTGGCCGCTGTTGG - Intergenic
1002187029 5:177459282-177459304 CCGCCCTCACTGACCCACCTGGG - Intronic
1016330275 6:142946572-142946594 CCGCCCGCAGCGGCAGCCGTGGG - Intergenic
1016429095 6:143964241-143964263 CAGCCCTCACTGGCGGCCCTGGG + Intronic
1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG + Exonic
1019828327 7:3301605-3301627 CCGCCGCCACCGGCCGCCGAGGG - Exonic
1022559859 7:31336679-31336701 CCGCCCGCAGTGGGCGCCCTGGG - Intergenic
1024529823 7:50382675-50382697 ACGCCCTCACTGGCCACCTGAGG + Exonic
1032298925 7:130668806-130668828 CCGCCCTCCCCGGCCGCCCTCGG + Exonic
1047454681 8:124998372-124998394 GCGCCCTCATTGGCCGGCGGCGG + Intergenic
1049343275 8:142125199-142125221 GCACCCTCCCTGGCCGCCGGTGG + Intergenic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1059129079 9:111725496-111725518 CCGCCCTCCCTGGACCCAGTGGG - Intronic
1060979622 9:127785127-127785149 CCGCGCCCCCTGGCGGCCGTCGG + Intergenic
1062045630 9:134423241-134423263 CTGCCCTCACTGCCCGACGATGG + Intronic
1062367668 9:136218921-136218943 CGGCCCTCACTGGCTGGGGTGGG + Intronic
1062381292 9:136288112-136288134 CCTCCCCCACTGGCCACCGTCGG - Intronic
1189037170 X:37505304-37505326 GCGCCCGCACTGCCCGCCCTGGG + Intronic
1189335584 X:40168924-40168946 CCGCCCGCCCTGGCCGGCGCAGG + Intronic
1200138350 X:153885664-153885686 GCTCCCCCACAGGCCGCCGTGGG - Intronic
1201762514 Y:17555512-17555534 CCGCCACCACTGGCTGCCCTGGG - Intergenic
1201839038 Y:18350476-18350498 CCGCCACCACTGGCTGCCCTGGG + Intergenic