ID: 900350476

View in Genome Browser
Species Human (GRCh38)
Location 1:2232095-2232117
Sequence CCGCCCTCACTGGCCGCCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900350462_900350476 18 Left 900350462 1:2232054-2232076 CCCTACTTGTCCTAGAAGGAGTG 0: 1
1: 0
2: 0
3: 10
4: 161
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73
900350459_900350476 24 Left 900350459 1:2232048-2232070 CCCAGACCCTACTTGTCCTAGAA 0: 1
1: 0
2: 0
3: 6
4: 144
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73
900350467_900350476 8 Left 900350467 1:2232064-2232086 CCTAGAAGGAGTGGCCTGGGAGG 0: 1
1: 0
2: 4
3: 45
4: 393
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73
900350469_900350476 -6 Left 900350469 1:2232078-2232100 CCTGGGAGGCCCCGCCTCCGCCC 0: 1
1: 0
2: 20
3: 101
4: 741
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73
900350460_900350476 23 Left 900350460 1:2232049-2232071 CCAGACCCTACTTGTCCTAGAAG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73
900350463_900350476 17 Left 900350463 1:2232055-2232077 CCTACTTGTCCTAGAAGGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900350476 Original CRISPR CCGCCCTCACTGGCCGCCGT TGG Intronic