ID: 900356839

View in Genome Browser
Species Human (GRCh38)
Location 1:2269031-2269053
Sequence GAGGATCACTTGAACCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47074
Summary {0: 1, 1: 2, 2: 231, 3: 3972, 4: 42868}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900356839_900356847 30 Left 900356839 1:2269031-2269053 CCTTGTTGGTTCAAGTGATCCTC 0: 1
1: 2
2: 231
3: 3972
4: 42868
Right 900356847 1:2269084-2269106 CAGGCACACACCACTACATCTGG 0: 4
1: 174
2: 2008
3: 8984
4: 29747
900356839_900356845 11 Left 900356839 1:2269031-2269053 CCTTGTTGGTTCAAGTGATCCTC 0: 1
1: 2
2: 231
3: 3972
4: 42868
Right 900356845 1:2269065-2269087 TCATGAGTAGCCGAGACTACAGG 0: 1
1: 48
2: 3420
3: 56533
4: 182590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900356839 Original CRISPR GAGGATCACTTGAACCAACA AGG (reversed) Intronic
Too many off-targets to display for this crispr