ID: 900357515

View in Genome Browser
Species Human (GRCh38)
Location 1:2271842-2271864
Sequence CCCCAGGATGTCAACCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900357515_900357525 27 Left 900357515 1:2271842-2271864 CCCCAGAGGTTGACATCCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 173
Right 900357525 1:2271892-2271914 GTGGTTTTTGAAGATGCATCTGG 0: 1
1: 0
2: 1
3: 16
4: 194
900357515_900357523 8 Left 900357515 1:2271842-2271864 CCCCAGAGGTTGACATCCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 173
Right 900357523 1:2271873-2271895 CTGGTGATGCTTCCAGAAAGTGG 0: 1
1: 0
2: 3
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900357515 Original CRISPR CCCCAGGATGTCAACCTCTG GGG (reversed) Intronic
900357515 1:2271842-2271864 CCCCAGGATGTCAACCTCTGGGG - Intronic
900733339 1:4277778-4277800 CCCCAGGATGGCAAAGCCTGTGG - Intergenic
901504683 1:9677027-9677049 CCCCAGGATTTCTTCCTCTTTGG + Intronic
902828265 1:18992399-18992421 CCCCAGAATGTCACTCTCTGAGG - Intergenic
905478717 1:38246749-38246771 CCCCAGGCTGGCAGCCTCTCGGG + Intergenic
905744486 1:40402931-40402953 CCCAAGGCTGTCAACCTAAGTGG - Intronic
906945368 1:50290123-50290145 CCCCAAGATGTCCAGGTCTGAGG - Intergenic
907331726 1:53676209-53676231 CCCAAGGGTGTCAGCCTCAGTGG + Intronic
908036617 1:60061609-60061631 CCCCAGGAAATTGACCTCTGTGG + Intronic
912637790 1:111314815-111314837 CCTCAGTAAGTAAACCTCTGTGG - Intronic
916010420 1:160700631-160700653 CGCCAGGATTTTGACCTCTGAGG - Intronic
916387668 1:164294328-164294350 CACCAGGATTTCAAACTTTGTGG + Intergenic
920125452 1:203690771-203690793 CCACAGAATGTTAATCTCTGAGG - Intronic
924835278 1:247640747-247640769 CCCCTAGATGTCACACTCTGAGG + Intergenic
1063220331 10:3961428-3961450 CGCCAGGATTTGCACCTCTGAGG + Intergenic
1063355416 10:5394293-5394315 CCCCAGGATCTCCACTGCTGTGG - Exonic
1063463068 10:6226569-6226591 CCCCAGGATCTTAACTTCGGAGG - Intronic
1069694067 10:70374030-70374052 CCCCTGAACTTCAACCTCTGTGG - Intronic
1069997078 10:72348977-72348999 CCCCAGGATGTCCAGCTCCAGGG + Intronic
1071075983 10:81753493-81753515 CCCTTGGATGTCATCCCCTGTGG - Intergenic
1075266343 10:121002293-121002315 CCCAAGAATCACAACCTCTGGGG - Intergenic
1075482162 10:122791170-122791192 CCCAAGGATATCAAAATCTGCGG - Intergenic
1075688469 10:124379829-124379851 CCCCGGGACCTCAACCTTTGAGG - Intergenic
1077725111 11:4666649-4666671 CCCCTGGATGTCCATCCCTGGGG - Intergenic
1077744659 11:4889205-4889227 CCCAAGGATGCCAAAATCTGAGG + Intronic
1078798198 11:14615330-14615352 TCCAAAGAGGTCAACCTCTGAGG - Intronic
1080657692 11:34270660-34270682 CATCTGGTTGTCAACCTCTGAGG - Intronic
1081630821 11:44688472-44688494 CCCCAGGAGGTTGACCTCTAAGG + Intergenic
1081712903 11:45228945-45228967 CCCCAGGATTTCAAGCTCAGCGG - Intronic
1082091167 11:48090899-48090921 CCTCATGATGTCAAGCACTGTGG + Intronic
1083291672 11:61693952-61693974 CCCCAGCTTGCAAACCTCTGAGG + Intronic
1084516930 11:69642440-69642462 CCCCAGGAATTCAAACTCCGGGG - Intronic
1086642021 11:89170237-89170259 CACCAGGAAGTCATCCTTTGGGG + Intergenic
1089356342 11:117856459-117856481 CCCACGGATGACAAGCTCTGAGG + Intronic
1089679218 11:120110091-120110113 CCCCAGCAGGTCCACCTCTGTGG - Intergenic
1089901257 11:121988187-121988209 ACCCAGGTTGTAAACCTCTTGGG - Intergenic
1090313417 11:125763809-125763831 CACCAGGATGTCAGTCTTTGAGG + Intergenic
1094323772 12:29213874-29213896 CCCCAAGATGGCAAACTTTGTGG + Intronic
1104620745 12:130310860-130310882 CCACAGGAAGTCCCCCTCTGGGG + Intergenic
1104740167 12:131166096-131166118 CCCCAGGATCGGATCCTCTGAGG + Intergenic
1104927729 12:132322293-132322315 CCCTGGGATGTCAGCCCCTGAGG + Intronic
1105756559 13:23470199-23470221 CCCCAGGATGTAAATTTGTGCGG + Intergenic
1107159476 13:37209330-37209352 CCATAGGATGTCCACTTCTGAGG - Intergenic
1108494049 13:51007018-51007040 CCCCATGATCTCATCCTCTGTGG + Intergenic
1109088248 13:58005177-58005199 CCCCAGTATGTCAATTTCAGAGG + Intergenic
1110763106 13:79252370-79252392 ACCCAGGCTGTCACCCTGTGTGG - Intergenic
1117288425 14:54309546-54309568 GCCCTGGATGTCATCCTCAGAGG - Intergenic
1118236728 14:64011995-64012017 CCCCAGAAAGTCAATCTCTGTGG + Intronic
1118354488 14:65001601-65001623 TCCCAGGATATCAAAATCTGTGG - Intronic
1118762004 14:68885652-68885674 CCCCAGGAGCTCCACTTCTGGGG + Intronic
1119636591 14:76278319-76278341 CCCCAGCATGTCAACAGCAGTGG - Intergenic
1120575571 14:86176425-86176447 ACACAGGTTGTCAACCTCTCTGG - Intergenic
1122783513 14:104153632-104153654 TCCCAGGATGCCCAGCTCTGGGG - Intronic
1122992023 14:105240997-105241019 CCCCAGGTTGCCTACTTCTGGGG - Intronic
1123926560 15:25118262-25118284 TCCCAGGAAGTCATCTTCTGAGG - Intergenic
1125517751 15:40332196-40332218 TCCCATGATGCCAAGCTCTGTGG + Intronic
1126620694 15:50636575-50636597 CCCCAGGAAGTTGAGCTCTGTGG - Intronic
1127237353 15:57069125-57069147 CCCCAGGATGCAAACCTCAATGG - Intronic
1128737016 15:70059099-70059121 CCCCAGGGTCTCAGCCTCAGGGG - Intronic
1130386028 15:83413283-83413305 CCCCAGGATGACAAGGTCTCAGG - Intergenic
1130842755 15:87716806-87716828 CACCTCGATGACAACCTCTGTGG + Intergenic
1131354564 15:91733568-91733590 TCCTAGGATGTAAACTTCTGAGG - Intergenic
1132611366 16:817895-817917 CCCCAGGAACTGAACTTCTGTGG + Intergenic
1132800324 16:1748913-1748935 CCCAAGGATGCCAAAATCTGAGG + Intronic
1133380137 16:5322939-5322961 CCCCAGGACCTCAGACTCTGAGG - Intergenic
1136185365 16:28585308-28585330 CCCCAGGATCTCACCACCTGAGG - Intronic
1136995856 16:35187731-35187753 CTCCAGGATGTCACCGTCAGTGG + Intergenic
1138334036 16:56238226-56238248 CCCCAGTCTGACAGCCTCTGAGG + Intronic
1139358996 16:66384999-66385021 CCTCAGCATGCCAGCCTCTGAGG + Intronic
1139471580 16:67180650-67180672 CCCCACACTGTCGACCTCTGGGG + Exonic
1142225340 16:88874379-88874401 TCCCAGGACGTCTACCTCCGAGG + Intergenic
1142496998 17:311191-311213 CCCCAGGATCTCAGCCTTGGAGG + Intronic
1142722175 17:1783823-1783845 TCCCATGATGTCAAGCTCTAAGG + Intronic
1143009596 17:3858650-3858672 CCCCAGGATGCCACCCTCCAGGG - Intergenic
1143916219 17:10295250-10295272 CCCATTGATGTCAACCTCTTGGG + Intergenic
1144631027 17:16872549-16872571 CCTCAGCAGGGCAACCTCTGGGG + Intergenic
1145787344 17:27602878-27602900 CCACAGGCTGTCAACATCTCTGG - Intronic
1146922316 17:36722052-36722074 CCCCAGGCTGACAACATCTCTGG - Intergenic
1147179579 17:38675661-38675683 TCCCAGGATGCCCCCCTCTGAGG + Intergenic
1147317869 17:39629429-39629451 CCCCAGGGTCTCAATCTCTGGGG - Intronic
1147442256 17:40454344-40454366 CCCCTGGATTTCACCATCTGTGG + Intronic
1147636669 17:41968118-41968140 CCGCAAGATGTCATCCTCAGGGG + Exonic
1148676858 17:49450826-49450848 CCCCAGGAAGGCAGGCTCTGTGG + Intronic
1148969403 17:51466175-51466197 CCCCTGAATGCCAAGCTCTGTGG - Intergenic
1149542863 17:57481107-57481129 CCCCAGGCTGTTAACCATTGTGG + Intronic
1149784236 17:59421951-59421973 GCCCATGATGTAAACGTCTGTGG - Intergenic
1152650245 17:81489199-81489221 CACCGGCATGTAAACCTCTGTGG + Intergenic
1152719115 17:81914229-81914251 CCCGAGGGTGTCCAGCTCTGCGG - Intronic
1154502142 18:15002347-15002369 CCCCAAGATGCCATCCTCTCTGG + Intergenic
1158208703 18:55022962-55022984 CACCAGAATGTCAACATATGAGG - Intergenic
1158419817 18:57283257-57283279 CCCCAGCATGCCCACCTCTTGGG - Intergenic
1160406464 18:78649697-78649719 GCCCGGGGTGCCAACCTCTGCGG - Intergenic
1161565838 19:5001941-5001963 CTCCAATATGTGAACCTCTGTGG + Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1166008644 19:39925213-39925235 CTCCAGGATGCCTCCCTCTGAGG - Intronic
1167672505 19:50861578-50861600 CCCTAGGCTGTGAATCTCTGTGG - Intronic
925197810 2:1940883-1940905 ACCCAGGATTTCTAACTCTGCGG - Intronic
926321962 2:11754707-11754729 CACCAGGCTGTCATCCTCAGTGG - Intronic
928272265 2:29867034-29867056 GCCCTGGATGCCAACTTCTGGGG + Intronic
933001172 2:76925401-76925423 CCCCTTGATTTCAGCCTCTGAGG + Intronic
935204349 2:100884669-100884691 CCCCAGGCTGACTCCCTCTGAGG - Intronic
936060845 2:109294830-109294852 CCCCAAGATGCCCAGCTCTGGGG - Intronic
937040193 2:118814859-118814881 CCCCAGGATGCCAACCTTCGGGG + Intergenic
938501320 2:131832519-131832541 CCCCAGGATGCCATCCTCTCTGG + Intergenic
1168762153 20:356609-356631 AACCAGGACGACAACCTCTGAGG + Intronic
1170593176 20:17786659-17786681 CTCCAGGATGCCAGACTCTGGGG + Intergenic
1170742317 20:19068959-19068981 CCCCAGGAGGTCAACCTTTGTGG - Intergenic
1172641949 20:36445770-36445792 CCCCAAGATGTCCACATCTTTGG + Intronic
1176104350 20:63378854-63378876 CCCCAGGATGAGCAGCTCTGAGG + Intergenic
1176382797 21:6121425-6121447 CCCCAGGTTGTGAGCCCCTGGGG + Exonic
1177434592 21:21034503-21034525 CACCTTGATGTAAACCTCTGTGG - Intronic
1179740672 21:43416814-43416836 CCCCAGGTTGTGAGCCCCTGGGG - Exonic
1181518528 22:23432174-23432196 GCCAAGGATGTCACCTTCTGGGG + Intergenic
1181963033 22:26636823-26636845 GCCCATGAAGTCAATCTCTGTGG + Intergenic
1183638023 22:39076805-39076827 CCCCAGGCCGTCACCCTCGGAGG - Intronic
1183677242 22:39306454-39306476 CCCCAGGATGCTGACTTCTGGGG + Intergenic
1183987924 22:41579478-41579500 CCCCAGGATCTCCATCTCAGAGG + Intronic
1185376620 22:50485566-50485588 CCCTAGAATGTCAGCCCCTGGGG - Exonic
950136761 3:10586568-10586590 CCCCAGGGGGAGAACCTCTGAGG + Intronic
951745576 3:25973940-25973962 CCCCAGCATCTCCACCTCTTAGG - Intergenic
953460060 3:43074860-43074882 ACCCAGGATGTAAACTTTTGAGG + Intergenic
955753128 3:62203066-62203088 GCCCTGGTTGTCACCCTCTGAGG - Intronic
961415288 3:126752488-126752510 TCCCCCGATGTCATCCTCTGAGG + Intronic
964813024 3:160685961-160685983 CCCCAGGATACCAAAATCTGAGG + Intergenic
968933495 4:3597167-3597189 CCCCAGGAGCTCTGCCTCTGAGG + Intergenic
969638711 4:8384053-8384075 CCCCAGGAGGTGTCCCTCTGCGG + Intronic
970211627 4:13715957-13715979 CCCAGGGATGTCCAGCTCTGCGG - Intergenic
978565233 4:110074142-110074164 CCCCAGGATACCAAAATCTGAGG + Intronic
979053635 4:115969265-115969287 CCTCAGGATGTGAACCTGTATGG - Intergenic
979646978 4:123081038-123081060 CCACAGGATGTTAACAGCTGGGG - Intronic
983654547 4:170069520-170069542 ATCCTGGATTTCAACCTCTGGGG - Intronic
983730099 4:170982855-170982877 CCCGAGGATAGCAACATCTGTGG - Intergenic
984512550 4:180696084-180696106 CCACATGATGTAAACATCTGTGG + Intergenic
984869201 4:184311688-184311710 CCCCAGGGTGTGAACTTCTTTGG + Intergenic
985132746 4:186755743-186755765 TCCCAGGGTGTCAAGCTTTGTGG - Intergenic
985481085 5:111326-111348 CCCCAGGATGACTCCCACTGGGG - Intergenic
990517049 5:56539983-56540005 CCACAAAATGCCAACCTCTGAGG + Intronic
990677605 5:58205279-58205301 CCCAAAGGTGTCAACTTCTGTGG - Intergenic
991200727 5:63988340-63988362 CTCCAGGAAGCCAACTTCTGTGG - Intergenic
994245640 5:97472159-97472181 CCCTAGGATGGCAGGCTCTGCGG + Intergenic
998131405 5:139653197-139653219 CCCCAGCCTGTCTCCCTCTGCGG - Intronic
998773732 5:145574709-145574731 CCTGAGGATGTCAAAATCTGTGG + Intronic
998908844 5:146936145-146936167 CCCCAAAATGTCAACATATGTGG - Intronic
1001756073 5:174171099-174171121 CCCCTTCTTGTCAACCTCTGTGG + Intronic
1004263774 6:14131553-14131575 CCCCAGGAAGACCACCTCAGGGG + Exonic
1004628857 6:17402324-17402346 CCCAAGGATGTAAAACTCTAGGG + Intronic
1004735580 6:18402978-18403000 CCCCAAGACATCAACCTCTTTGG - Intronic
1005632398 6:27720856-27720878 CACCAGGAACTGAACCTCTGAGG - Intergenic
1006915924 6:37593971-37593993 CCCCAGAAGGTCAAGCTCTAGGG - Intergenic
1008804892 6:55415078-55415100 CCCCAGGAAGTCTTGCTCTGGGG - Intergenic
1016901768 6:149109818-149109840 CCCCAGGATATTGTCCTCTGTGG + Intergenic
1016920169 6:149284947-149284969 CTCGAGGATGACAACCTCAGAGG + Intronic
1017925995 6:158912239-158912261 CCCCAGGATGGCAACAGATGGGG - Intergenic
1018105077 6:160478085-160478107 CTCCAGGATGACAAACTCAGCGG + Intergenic
1018113192 6:160556980-160557002 CCCCAGGATGACAAACTCAGCGG + Intronic
1018291640 6:162298059-162298081 CCTGTGGGTGTCAACCTCTGAGG - Intronic
1019777154 7:2918608-2918630 CCCCTGAATTTCAGCCTCTGAGG - Intronic
1023033733 7:36112454-36112476 ACCCAAGATTTCAATCTCTGGGG - Intergenic
1023579763 7:41669146-41669168 CCTCAGCATCTCTACCTCTGAGG - Intergenic
1027232109 7:76278770-76278792 ACCCAGGAGGTCAACCTCATTGG - Intronic
1027410915 7:77916655-77916677 ACCCAGGATACCAACCTCTGAGG + Intronic
1029043686 7:97604254-97604276 CCCCAGGATACCAAAATCTGGGG - Intergenic
1029532080 7:101132139-101132161 ACCCAAAATGTCACCCTCTGAGG + Intronic
1029673535 7:102050381-102050403 CCCCAGGATTTAACCTTCTGGGG + Intronic
1030346891 7:108444251-108444273 CCCCAGGATATCAAAATCAGAGG - Intronic
1034729179 7:153369085-153369107 CCCCATGTTGCCAACCTCTGTGG - Intergenic
1035023908 7:155814485-155814507 CCCCAGGGTGGCAACCCGTGTGG - Intergenic
1039915994 8:41860765-41860787 TCCCAGGAAGTGACCCTCTGAGG + Intronic
1040843091 8:51805084-51805106 CCCCAACAAGTCAACCACTGGGG + Intronic
1045229663 8:100290979-100291001 CCCCAGGAGGTTGACCTCTAAGG - Intronic
1047011590 8:120678827-120678849 CTCCAAGAGGTCAACCTCTATGG + Intronic
1049269371 8:141686170-141686192 CCCCAGGAGGTGAGGCTCTGAGG - Intergenic
1049705850 8:144041614-144041636 CACCAGGATGGCCTCCTCTGTGG + Intronic
1049787298 8:144457108-144457130 CCACATGATGTCATCCCCTGTGG - Intronic
1049967658 9:793848-793870 CTCCTGGAAGTCATCCTCTGGGG - Intergenic
1051089354 9:13387756-13387778 CCCCAGGATGGCTTCCTCAGAGG + Intergenic
1052972002 9:34382226-34382248 CCCCTGGCTCTCAATCTCTGGGG - Intronic
1054456647 9:65434650-65434672 CCCCAGGAGCTCTGCCTCTGAGG - Intergenic
1055052679 9:71995884-71995906 CCCCTAAATGTCAACCTCTTTGG - Intergenic
1055517416 9:77047275-77047297 CCCCAGGAGGCAAACCTGTGTGG - Intergenic
1057212368 9:93207072-93207094 CCCCAGGATATTACCCTCTGGGG - Intronic
1057799843 9:98184113-98184135 CCCAAGGATATCAAAATCTGTGG - Intronic
1058646048 9:107132380-107132402 CCCTAGAATGTCAACCTCTGAGG - Intergenic
1062498338 9:136841999-136842021 CCCCAGGATGCCATCCTCTCTGG - Intronic
1187102868 X:16212896-16212918 CCCCAGCCTATCAGCCTCTGTGG + Intergenic
1190331230 X:49236591-49236613 ACCCAGGATGCCAACATCTAGGG + Intronic
1196344994 X:114644488-114644510 TCCCATGATGTGAACCTCCGAGG - Intronic
1197715449 X:129703012-129703034 CCCAAGGAGGTCAGGCTCTGAGG - Intergenic
1200805966 Y:7434283-7434305 CCTCAGGAAGTCACCCTCTATGG + Intergenic