ID: 900357723

View in Genome Browser
Species Human (GRCh38)
Location 1:2272841-2272863
Sequence GGAGGGCGAGGCTCGGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 880
Summary {0: 1, 1: 1, 2: 8, 3: 67, 4: 803}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900357723_900357743 29 Left 900357723 1:2272841-2272863 CCACGCCCCGAGCCTCGCCCTCC 0: 1
1: 1
2: 8
3: 67
4: 803
Right 900357743 1:2272893-2272915 GCGTCTGTGCTTCTTCCAGGCGG 0: 1
1: 0
2: 3
3: 15
4: 144
900357723_900357736 7 Left 900357723 1:2272841-2272863 CCACGCCCCGAGCCTCGCCCTCC 0: 1
1: 1
2: 8
3: 67
4: 803
Right 900357736 1:2272871-2272893 CTCCTGCCCCCGAGGCTCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 205
900357723_900357732 -1 Left 900357723 1:2272841-2272863 CCACGCCCCGAGCCTCGCCCTCC 0: 1
1: 1
2: 8
3: 67
4: 803
Right 900357732 1:2272863-2272885 CCACGCCCCTCCTGCCCCCGAGG 0: 1
1: 0
2: 4
3: 49
4: 370
900357723_900357742 26 Left 900357723 1:2272841-2272863 CCACGCCCCGAGCCTCGCCCTCC 0: 1
1: 1
2: 8
3: 67
4: 803
Right 900357742 1:2272890-2272912 CTGGCGTCTGTGCTTCTTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900357723 Original CRISPR GGAGGGCGAGGCTCGGGGCG TGG (reversed) Intronic