ID: 900357723

View in Genome Browser
Species Human (GRCh38)
Location 1:2272841-2272863
Sequence GGAGGGCGAGGCTCGGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 880
Summary {0: 1, 1: 1, 2: 8, 3: 67, 4: 803}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900357723_900357732 -1 Left 900357723 1:2272841-2272863 CCACGCCCCGAGCCTCGCCCTCC 0: 1
1: 1
2: 8
3: 67
4: 803
Right 900357732 1:2272863-2272885 CCACGCCCCTCCTGCCCCCGAGG 0: 1
1: 0
2: 4
3: 49
4: 370
900357723_900357743 29 Left 900357723 1:2272841-2272863 CCACGCCCCGAGCCTCGCCCTCC 0: 1
1: 1
2: 8
3: 67
4: 803
Right 900357743 1:2272893-2272915 GCGTCTGTGCTTCTTCCAGGCGG 0: 1
1: 0
2: 3
3: 15
4: 144
900357723_900357736 7 Left 900357723 1:2272841-2272863 CCACGCCCCGAGCCTCGCCCTCC 0: 1
1: 1
2: 8
3: 67
4: 803
Right 900357736 1:2272871-2272893 CTCCTGCCCCCGAGGCTCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 205
900357723_900357742 26 Left 900357723 1:2272841-2272863 CCACGCCCCGAGCCTCGCCCTCC 0: 1
1: 1
2: 8
3: 67
4: 803
Right 900357742 1:2272890-2272912 CTGGCGTCTGTGCTTCTTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900357723 Original CRISPR GGAGGGCGAGGCTCGGGGCG TGG (reversed) Intronic
900100556 1:960397-960419 GGAGGGCGAGGCCTGGTGGGGGG + Intergenic
900100675 1:960804-960826 AGTGGGCGGGGGTCGGGGCGCGG + Intronic
900177270 1:1296393-1296415 TGAGGGCCAGGCTGGGGGTGGGG - Intronic
900183468 1:1322560-1322582 GGAGGGGGAGGGACGGGGTGGGG + Intronic
900207984 1:1439734-1439756 GGGGCGCGGGGCACGGGGCGTGG - Exonic
900244228 1:1630202-1630224 GGGGGGCGAGGCTGGGGGCGGGG - Intronic
900244358 1:1630665-1630687 CGCGGGCGAGCCTGGGGGCGAGG + Intergenic
900270619 1:1785572-1785594 GGAGTGCGGGGGGCGGGGCGGGG + Exonic
900349494 1:2227973-2227995 GGAGCGGGCGGCGCGGGGCGGGG + Intergenic
900357713 1:2272819-2272841 GGAGGGGGAGGCTCGGGGCGTGG - Intronic
900357723 1:2272841-2272863 GGAGGGCGAGGCTCGGGGCGTGG - Intronic
900406788 1:2496289-2496311 GGAGAGCTGGGCTCGGGGCCTGG - Intronic
900581894 1:3413512-3413534 GCAGGGCTAGGCTTGGGGAGGGG + Intronic
900607801 1:3531512-3531534 GTGGGGCGGGGCTCGGGGCGGGG - Intronic
900671302 1:3856818-3856840 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
900671305 1:3856825-3856847 GGGGAGCGGGGCGCGGGGCGCGG - Intronic
900749857 1:4388643-4388665 GGAGGGTGGGGCTGGGGACGGGG + Intergenic
900985082 1:6068643-6068665 GATGGGAGAGGCCCGGGGCGGGG - Intronic
901045525 1:6393504-6393526 GGGAGGCGGGGCTCGGGGTGGGG - Intronic
901441627 1:9281721-9281743 GGAGACCGAGGCTCAGGGAGGGG - Intergenic
901443335 1:9292731-9292753 GGGGCGCGGGGCGCGGGGCGCGG - Intergenic
901506612 1:9689526-9689548 GAGGGGCGCGGCCCGGGGCGGGG - Intronic
901529659 1:9844885-9844907 AGAGGGAGAGGCTCAGGGCAGGG + Intergenic
901791289 1:11654822-11654844 GCGGGGCGGGGCGCGGGGCGCGG + Intronic
902036270 1:13460577-13460599 GGAGGGCAAGGCTCGGGGTAAGG - Intergenic
902336731 1:15758602-15758624 GGAAGGGGCGGCGCGGGGCGCGG + Intronic
902586179 1:17439750-17439772 GGGGCGGGAGGCGCGGGGCGCGG + Intergenic
902982699 1:20137378-20137400 GGAGGCCAAGGCTGGGGCCGGGG - Intergenic
903164131 1:21509281-21509303 GGGGCGCGGGGCTCGGGCCGGGG + Intergenic
903190122 1:21651756-21651778 GTAGGGCGTGGCGCGGCGCGGGG - Intronic
903224503 1:21887116-21887138 GGAGGGGCAGGGTAGGGGCGGGG + Intronic
903977696 1:27161970-27161992 GGAGGGCGAGGCTGGAGGATCGG - Intronic
904190189 1:28737289-28737311 TGAGGGAGAGGCGCCGGGCGCGG - Intronic
904210976 1:28886998-28887020 GGAGGGGGAGGCCCGGGCAGAGG - Intergenic
904618958 1:31764161-31764183 CGCGGGCGGTGCTCGGGGCGGGG - Intronic
905092730 1:35442368-35442390 GGAGGGAGAGGCTGGGAGGGAGG + Intronic
905145466 1:35883922-35883944 CGAGGGCGAGGGTCAGGGGGCGG + Intronic
905300195 1:36981671-36981693 GGAGGGCCAGGGTCGGGGGAGGG + Intronic
905617116 1:39408943-39408965 GGAGGACGAGGGCGGGGGCGGGG - Intronic
905789741 1:40783758-40783780 GGCGGGGGAGGGGCGGGGCGGGG + Intergenic
905819624 1:40979642-40979664 GGAGGGCGCGGGGCGGGGCGGGG - Exonic
906114739 1:43349087-43349109 GAGGGGCGAGGCGCGGGGCGCGG + Intronic
906150132 1:43582801-43582823 GGAGGCCGAGGGTGGGGCCGGGG - Intronic
906627042 1:47333885-47333907 GGCCGGCGCGGCGCGGGGCGGGG - Exonic
907107662 1:51898746-51898768 GGAGGGCAAGGCTAGGGGGAAGG + Intergenic
907197492 1:52698364-52698386 GGAGGGGGCGGGGCGGGGCGTGG + Exonic
907272148 1:53297451-53297473 GGTGGGCGGGACTCGGTGCGTGG + Intronic
908477635 1:64505539-64505561 GGAGGGGGCGGGGCGGGGCGCGG - Intronic
908544356 1:65148730-65148752 GGAGGCCGAGGCTCCAGGGGCGG + Intronic
909344847 1:74572901-74572923 GGAGGGAGAGGCTGAGGGTGGGG - Exonic
909391450 1:75125837-75125859 GGATGGCGGGACTGGGGGCGGGG - Intergenic
909657348 1:78046154-78046176 GGAGGGCGAGCCGACGGGCGCGG + Exonic
911527551 1:99004780-99004802 GGAGGACGAGGCACGGGAGGCGG + Exonic
911696563 1:100895997-100896019 GGAGGGCGTGGCTTGCGGCGGGG - Exonic
913009599 1:114670096-114670118 GGAGGGCGGGGCTAGGGGGTGGG - Intronic
913231186 1:116741989-116742011 GGAGGCCGAGGCGGCGGGCGTGG - Intergenic
913449193 1:118981072-118981094 GGAGGCCGAGGCGGGGGGCGGGG - Intronic
913600269 1:120415374-120415396 GGAGGGCGAGGCGGGGTGGGGGG + Intergenic
914086790 1:144461289-144461311 GGAGGGCGAGGCGGGGTGGGGGG - Intronic
914192691 1:145425231-145425253 GGAGGGCGAGGCGGGGTGGGGGG - Intergenic
914590597 1:149103179-149103201 GGAGGGCGAGGCGGGGTGGGGGG - Intronic
914902928 1:151721472-151721494 GCAGGGCGGGGCCGGGGGCGGGG + Intronic
915218680 1:154356744-154356766 GGAGGGGCAGGCTGGGGGCTGGG - Intergenic
915311803 1:155008897-155008919 GGAGGGCCAGGCTTGGGGGGAGG - Intronic
915319978 1:155051253-155051275 GGAGGGGGCGGGCCGGGGCGGGG + Intronic
915325290 1:155078816-155078838 GGAGGGAAGGGCTGGGGGCGTGG + Intergenic
915572401 1:156751610-156751632 GGCGGGCGCGGATCGGGGCAAGG + Intronic
915738006 1:158096745-158096767 GGAAGGCGAGGCTGGGGCAGGGG - Intronic
917438601 1:175045649-175045671 GAATGGCGAGGCTCCGGGCTCGG + Intergenic
917537387 1:175884331-175884353 GGAGGGAGAGGGTCTGGGGGAGG - Intergenic
918105673 1:181413395-181413417 GGAGGGCGAGGGCCAGGGCTGGG + Intronic
918326880 1:183418344-183418366 GGAAGGCGAGGCTCCGGCGGTGG + Exonic
919977022 1:202619359-202619381 GGAGAGGGAGGCTGGGGGTGGGG + Intronic
922513145 1:226186471-226186493 GGAGGCGGCGGCTGGGGGCGCGG - Exonic
922706975 1:227795220-227795242 GGAAGGCGGGGCTGGGGGGGCGG - Intergenic
922775778 1:228213715-228213737 GCGGGGCGGGGCACGGGGCGGGG + Intronic
922795434 1:228337362-228337384 GGACGGCGATGCCCGAGGCGAGG + Exonic
922958615 1:229626002-229626024 GGGCGGCGGGGCGCGGGGCGCGG - Exonic
922964175 1:229674268-229674290 GGAGAGGGAGGCTGTGGGCGGGG - Intergenic
923506505 1:234609902-234609924 GGAGTGCGGGGCGGGGGGCGGGG + Intergenic
923612012 1:235504260-235504282 GGAGAGCCCGGCTCGCGGCGGGG - Exonic
923631056 1:235649825-235649847 GGGAGGCGCGGCGCGGGGCGGGG - Exonic
924052610 1:240093044-240093066 GGAGGGCGAGTCTTTGGCCGCGG - Exonic
924289651 1:242524506-242524528 GGAGGGCGAGGTGCGGGCGGGGG + Exonic
924807633 1:247373856-247373878 GGGGCGCGGGGCGCGGGGCGCGG - Intergenic
1063130449 10:3172998-3173020 GGCGGGCAAGGCGAGGGGCGTGG + Intergenic
1063407671 10:5812965-5812987 GGGCCGTGAGGCTCGGGGCGGGG - Intronic
1063451537 10:6153561-6153583 GGAGGGGGAGGGGCTGGGCGAGG + Intronic
1063604246 10:7508444-7508466 GGAGAGAGAGGCCCGGGGCATGG + Intergenic
1063604259 10:7508483-7508505 GGAGAGAGAGGCTTGGGGCATGG + Intergenic
1064035239 10:11908956-11908978 GGAGGGCGAGGCCCTGGACATGG - Intergenic
1064285126 10:13985220-13985242 CGAGGGCGAGGCTGGGGCCTAGG - Intronic
1064357308 10:14631586-14631608 GCAGGGCTAGGTTTGGGGCGGGG - Intronic
1064645320 10:17454112-17454134 GGGGCGCGCGGCGCGGGGCGCGG + Intronic
1064850259 10:19701703-19701725 GGAGGGGGAGGGTAGGGGAGGGG - Intronic
1065214690 10:23438858-23438880 GCGGGGCGAGGCCGGGGGCGCGG - Intergenic
1065993109 10:31031889-31031911 GGAGGTCAAGCCACGGGGCGCGG + Exonic
1067293298 10:44959727-44959749 GAGGGGCGAGGGGCGGGGCGAGG + Intronic
1067336999 10:45374266-45374288 GGAGGGCATGGCGCGGGCCGCGG - Exonic
1067451671 10:46385481-46385503 GGAGGGAGGGGCTGGGGCCGGGG + Intronic
1067585568 10:47474275-47474297 GGAGGGAGGGGCTGGGGCCGGGG - Intronic
1067769833 10:49115350-49115372 GGAGGCCGGGGCTCCGGGCCTGG - Intronic
1069856297 10:71442955-71442977 GGAGGGCGAGGCAGAGGGAGAGG + Intronic
1070596527 10:77836479-77836501 GGGTGGAGAGTCTCGGGGCGGGG - Intronic
1070800673 10:79243004-79243026 GGACGGCGAGGCTCGCGGGGCGG + Intronic
1070812584 10:79305827-79305849 GCAGGTGGAGGGTCGGGGCGGGG - Intronic
1070950812 10:80429546-80429568 GGCAGGAGAGGCTAGGGGCGGGG - Intronic
1071520444 10:86328890-86328912 GGAGGTAGAGGCTGGGGGTGGGG - Intronic
1072151890 10:92690356-92690378 GCCGGGCGAGGGTGGGGGCGAGG + Intronic
1072692915 10:97583551-97583573 GGAGGGGGCGGGACGGGGCGTGG - Intronic
1073049740 10:100659922-100659944 GGAAGGAGAGGCTCAGGGAGTGG + Intergenic
1073287970 10:102399737-102399759 GGCGGACGAGGCGCGGGGTGGGG + Intronic
1073503821 10:103966972-103966994 GGAGCACGGGGCTCGGGGTGCGG - Intergenic
1073750027 10:106515008-106515030 GGAGGGCGGGGGTGGGGGTGGGG - Intergenic
1074503497 10:114045563-114045585 GTAGGGCCCGGCGCGGGGCGCGG + Exonic
1075048633 10:119165711-119165733 GGTGCGCGCGGCCCGGGGCGGGG - Intergenic
1075334557 10:121598695-121598717 GGAGGAGGTGGCGCGGGGCGCGG - Intergenic
1075683730 10:124349887-124349909 GGCGGGCTAGGCTGGGGGCTGGG - Intergenic
1075707497 10:124510408-124510430 GGAGGCGGAGGCTGGGGGCCGGG - Intronic
1075802413 10:125161220-125161242 GGAGGGCCAGGGGCCGGGCGCGG + Intergenic
1076554290 10:131311817-131311839 GGCGGGCGGGGACCGGGGCGGGG - Intergenic
1076613750 10:131743112-131743134 GGAGGGCAAGGGTGGGGCCGTGG - Intergenic
1076634783 10:131875233-131875255 GGCGGGCAGGGCTCGGGGCTTGG - Intergenic
1076792855 10:132786051-132786073 GCAGCGCGGGGCGCGGGGCGCGG + Exonic
1076834577 10:133014637-133014659 GGCGGGGGAGGCACGGGGCCGGG + Intergenic
1076864365 10:133159956-133159978 GGGGGGCGGGGCCCGGGGTGGGG - Intergenic
1076887171 10:133268172-133268194 GGAGGGAGAGACTCGGGGTGTGG - Intronic
1077018568 11:407392-407414 GGTGGGCGGGGCACGGGGTGGGG + Intronic
1077026561 11:442385-442407 GGAGGCCGTGGCCCGGGGTGGGG - Intergenic
1077026573 11:442407-442429 GGAGGCCGTGGCCCGGGGTGGGG - Intergenic
1077085521 11:747946-747968 GGAGGGCGAGGCTGGGGCTCCGG - Intronic
1077114309 11:876371-876393 GGAGGTCGGGGCTCAGGGAGGGG + Intronic
1077191191 11:1256521-1256543 GGTGGGCGGGGCTGGGGGCGGGG - Intronic
1077204690 11:1336749-1336771 GGAGGGCGGGGGGCGGGGCGTGG + Intergenic
1077214538 11:1389974-1389996 GGGGCGCGGGGCGCGGGGCGCGG + Intronic
1077403470 11:2370214-2370236 GGAGGCTGAGGCTCTGGGCTGGG - Intergenic
1077976356 11:7252179-7252201 GGGGGGCGATGCCCGGGGCCAGG + Exonic
1078190858 11:9091646-9091668 TGAGGCCGGGGCTCGGGGGGCGG - Intronic
1078514347 11:12009370-12009392 GGCGGGCGGGGCTCGGGGCGGGG - Intronic
1078595193 11:12680473-12680495 GGCGGGCGGGCCTCGGGGAGTGG - Intronic
1080418742 11:32092055-32092077 GGAGGCCGAGGCGGGGGGAGGGG + Intronic
1080836292 11:35944017-35944039 GGACGGCGCGGCGAGGGGCGGGG + Intronic
1080836337 11:35944177-35944199 GGGGCGCGGGGCGCGGGGCGCGG + Intronic
1081981558 11:47270081-47270103 GGAGGGGGAGGCCGGGGCCGGGG - Intronic
1083184189 11:61007987-61008009 GGAGGGCGAGGCTTGCGTCCAGG - Intronic
1083648002 11:64184237-64184259 GGAGGCCGAGGCGGGGGGGGGGG + Intergenic
1083660824 11:64251168-64251190 GGAGGGCTAGACTTGGGCCGGGG - Intergenic
1083880555 11:65546405-65546427 GGCGGCGGAGGCCCGGGGCGGGG + Intronic
1083900412 11:65640759-65640781 GGAGGACCAGGCTGGGGGCCTGG + Intronic
1083967022 11:66049238-66049260 GGAAGGCGAGGGGCGGGGCCAGG + Intergenic
1083995080 11:66267683-66267705 GGTGGGCGGTGCCCGGGGCGGGG - Exonic
1084145218 11:67261617-67261639 TGAGGGCGAGGGCGGGGGCGGGG + Intergenic
1084165189 11:67372282-67372304 GGAGGGCCAGGCTGGGAGCTGGG + Intronic
1084175717 11:67421219-67421241 GGTGGGCGGGGCGCGGGGCGGGG + Exonic
1084362496 11:68677857-68677879 GGGGGGCGGGGCTGGGGGCTGGG + Intergenic
1084621199 11:70271125-70271147 GGGGCGCGGGGCTCGGGGAGGGG - Intronic
1085255279 11:75169218-75169240 GGGGGCCGAGGCTGGGGCCGAGG - Exonic
1085542974 11:77289481-77289503 GGAGGCCGAGGCAGGGGGTGGGG + Intronic
1086064811 11:82733379-82733401 GGAGGGCGGGCCGGGGGGCGCGG + Exonic
1086455596 11:86956030-86956052 GTCGGGCGAGTCTGGGGGCGGGG - Intergenic
1087516423 11:99168323-99168345 GGAGGCCGAGGCCGGGGGGGTGG + Intronic
1089274849 11:117327936-117327958 TCCGGGCGAGGCTCTGGGCGAGG - Intronic
1089274853 11:117327948-117327970 TCCGGGCGAGGCTCCGGGCGAGG - Intronic
1089457678 11:118634890-118634912 GGAGGGCGAGGGAGAGGGCGGGG - Intronic
1089850102 11:121488277-121488299 GGAGGGAGAGGCAGGAGGCGAGG - Intronic
1090003645 11:122981933-122981955 GGTGCGGGAGGCTCGGGGCGGGG + Intergenic
1090032337 11:123217825-123217847 GGAGGGTGAGGGTGGGGGGGGGG - Intergenic
1090548404 11:127791723-127791745 GGAGGGCAAGGCTGGGGGTGGGG - Intergenic
1090619464 11:128548670-128548692 GAAGGGCGAGGTTCGGGCCGAGG + Intronic
1090780259 11:130001861-130001883 GGAGGCCGAGGCCGGGGTCGCGG - Intronic
1090817963 11:130314978-130315000 CGGGGGCGGGGCTCGGGGCGGGG + Intergenic
1091236315 11:134024682-134024704 GGGGGGCGAGGGTCGGCCCGAGG - Intergenic
1091460897 12:642942-642964 GGCGGGCGCGGCGTGGGGCGTGG - Intronic
1091528683 12:1333076-1333098 GGAGGACGAGGATCAGGACGAGG - Intronic
1091550242 12:1530841-1530863 GGCGGGCGAGGCGCGGCCCGCGG - Intronic
1091965774 12:4740165-4740187 GGTGGGCTAGACTCGGGGCACGG - Intronic
1092002617 12:5044468-5044490 GGAGGACCAGGCTCTGGGCACGG + Exonic
1092409554 12:8243117-8243139 GGAGGGCGGGGCCTGGGGTGGGG + Intergenic
1092743266 12:11649958-11649980 GGAGCGCGCGGGGCGGGGCGGGG - Exonic
1092942229 12:13420584-13420606 GGAGAGCAAGGCACAGGGCGGGG - Intergenic
1093638820 12:21501969-21501991 GGTGTGCGCGGCTCGAGGCGGGG - Intronic
1093711585 12:22334721-22334743 AGAGAGCGCGTCTCGGGGCGGGG - Intronic
1093894975 12:24564238-24564260 TGGGAGCGAGGCTCGGGGCTTGG + Intergenic
1096284132 12:50283531-50283553 GGTGGGCGGGGTCCGGGGCGGGG - Intronic
1096465674 12:51846986-51847008 GGTGGGCGAGGAAAGGGGCGGGG - Intergenic
1096747856 12:53739953-53739975 CGAGGGCGAGGGCGGGGGCGGGG + Intergenic
1096747869 12:53739978-53740000 CGAGGGCGAGGGCGGGGGCGGGG + Intergenic
1097046149 12:56189175-56189197 GGAGAGGGAGGCTGGGGGAGGGG + Intronic
1099393735 12:82112274-82112296 GGAGGGTGAAGCGCGGGACGAGG + Intergenic
1100555208 12:95686466-95686488 GGAGGGCAAGGGGCTGGGCGTGG + Intronic
1101131793 12:101697771-101697793 GGAGGGAGAGGCTGGCGGCCGGG - Exonic
1101135437 12:101739076-101739098 GGAGGGAGACGCGCGGAGCGAGG + Intronic
1101421918 12:104557463-104557485 GGAGGGGGATGCACCGGGCGGGG + Intronic
1101752788 12:107596727-107596749 GGAGGGAGAGGCTCTTGGCCTGG - Intronic
1102019336 12:109670820-109670842 GGAGGGTGGGGCGCTGGGCGGGG - Intergenic
1102753891 12:115321113-115321135 GGAGGGGGAGGTTGGGGGAGTGG - Intergenic
1102933387 12:116879017-116879039 GGAAGGGGAGGCTGCGGGCGGGG - Intronic
1103509951 12:121467350-121467372 GGCGTGCGAGGCGCGCGGCGCGG - Intronic
1104859422 12:131916778-131916800 GCATGGCGAGGCTCAGGACGGGG - Intronic
1104977201 12:132557482-132557504 GTGGGGCGGGGCTCGGGGCTCGG + Intronic
1104980136 12:132570034-132570056 GCAGGGCGCGGCATGGGGCGCGG - Exonic
1105011910 12:132761831-132761853 GACGGGCGCGGCGCGGGGCGCGG - Exonic
1105022823 12:132828709-132828731 GGCGGGGGAGGCTCGAGGGGCGG - Intronic
1106027438 13:25968449-25968471 GGAGGCCGAGGCTCGGGAAGTGG - Intronic
1107250044 13:38349493-38349515 TTGGGGCGAAGCTCGGGGCGAGG - Intergenic
1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG + Intergenic
1108327608 13:49348907-49348929 GGAGGGTGAGGGACGGGGCGTGG - Intronic
1109699665 13:66009379-66009401 GGAGGGAGAGGCGCGGCGGGGGG + Intergenic
1110572962 13:77026662-77026684 GCCGGGCGGGGCGCGGGGCGCGG - Intronic
1112216260 13:97434121-97434143 GGCGGGCGGGGATCTGGGCGTGG + Intergenic
1113085663 13:106567516-106567538 GGAGAGCAGGGCGCGGGGCGAGG - Intronic
1113583769 13:111448793-111448815 AGAGGGCGTGGCTGGGGGCCAGG + Intergenic
1113820560 13:113209584-113209606 GGGCGGCGGCGCTCGGGGCGGGG + Exonic
1113868267 13:113543181-113543203 GGAGGGCGAGGGGCAGGGGGAGG - Intronic
1113914620 13:113863204-113863226 GGAGGACGAGGCGCGGCCCGGGG + Intronic
1115399430 14:32939841-32939863 GGAGGAGGAGGCCGGGGGCGGGG + Intronic
1115497330 14:34019217-34019239 GGAGGGAGAGAATAGGGGCGAGG + Intronic
1115993330 14:39171487-39171509 GGAGGCCGAGGCACGGGGGGTGG + Intergenic
1116478670 14:45371024-45371046 GGAGAGAGAGGCTGGGGGAGAGG - Intergenic
1117141105 14:52791675-52791697 GGAGAGCGAGGGGCGGGGCCCGG + Intergenic
1117141124 14:52791716-52791738 GGAGGGCGAGGGGCGGGGCTCGG + Intergenic
1117353577 14:54902919-54902941 GGAGGCCGAGGGGCGCGGCGAGG - Intergenic
1118220720 14:63852943-63852965 GGCGGGGAAGGCGCGGGGCGTGG + Intergenic
1119264264 14:73254822-73254844 TGAGGGCGAGGCTGGGGGCGGGG - Intronic
1119695087 14:76707031-76707053 GGAGGGAGAGGCGTGGGGGGGGG - Intergenic
1121249492 14:92489057-92489079 GAAGGGTGAGGCCAGGGGCGGGG + Intronic
1121412775 14:93759440-93759462 GGAGAGCGAAGGGCGGGGCGGGG + Intronic
1121617058 14:95320089-95320111 GAGGGGCGAGGGGCGGGGCGGGG + Intergenic
1122075310 14:99231620-99231642 GTGGGACGGGGCTCGGGGCGTGG + Intronic
1122118981 14:99541822-99541844 GAAGGTGGAGGCTGGGGGCGAGG + Intronic
1122142126 14:99668731-99668753 GGAAGGGCAGGCACGGGGCGGGG - Intronic
1122145190 14:99684536-99684558 GGTGAGCGGGGCTGGGGGCGGGG + Exonic
1122205712 14:100146917-100146939 GGAGGGCGGGGCTCAGGGGCTGG + Intronic
1122208402 14:100159710-100159732 GGTGCGCCAGGCTTGGGGCGGGG + Exonic
1122265796 14:100546352-100546374 GCGGGGCGAGGGCCGGGGCGGGG - Intronic
1122265805 14:100546369-100546391 GCGGGGCGAGGGCCGGGGCGGGG - Intronic
1122265814 14:100546386-100546408 GCGGGGCGAGGGCCGGGGCGGGG - Intronic
1122265823 14:100546403-100546425 GCGGGGCGAGGGCCGGGGCGGGG - Intronic
1122265832 14:100546420-100546442 GCGGGGCGAGGGCCGGGGCGGGG - Intronic
1122265841 14:100546437-100546459 GCGGGGCGAGGGCCGGGGCGGGG - Intronic
1122265850 14:100546454-100546476 GCGGGGCGAGGGCCGGGGCGGGG - Intronic
1122265859 14:100546471-100546493 GCGGGGCGAGGGCCGGGGCGGGG - Intronic
1122371204 14:101229967-101229989 GGGGGGCGAGGCTGCGGGGGGGG - Intergenic
1122371212 14:101229984-101230006 GGGGGGCGAGGCTGCGGGGGGGG - Intergenic
1122371243 14:101230055-101230077 GGGGGGCGAGGCTGCGGGGGGGG - Intergenic
1122371252 14:101230073-101230095 GGGGGGCGAGGCTGCGGGGGGGG - Intergenic
1122445162 14:101762193-101762215 GGAGGGCGCGGCCCGGGGAGGGG + Intronic
1122620955 14:103057455-103057477 GGAGGGCGCGGCCGCGGGCGGGG - Exonic
1122658524 14:103279115-103279137 GGAGGGCGAGGACCCGCGCGGGG - Intergenic
1122670672 14:103369359-103369381 GGAGGCCAAGGGTCGGGGTGGGG - Intergenic
1122707186 14:103628925-103628947 GCAGGGCGCGGCTCGCGGGGTGG - Intronic
1122874888 14:104659461-104659483 GGAGGGAGGGGCTCTGGGCTGGG - Intergenic
1122905660 14:104800493-104800515 AGAGAGCGAAACTCGGGGCGGGG - Intergenic
1122956676 14:105074565-105074587 GGAGGGTGAGCTTCGGGGCAGGG - Intergenic
1122978548 14:105181059-105181081 GGTGGGCGGGGCGCGGGTCGTGG + Intronic
1123035500 14:105470235-105470257 GGCGGGCGAGGGGCGGGGGGCGG - Exonic
1123037998 14:105479085-105479107 TGAGGCCGAGCCCCGGGGCGGGG - Intronic
1123687367 15:22808432-22808454 GTAGGGCGTGGCTCAGGGCTGGG + Intronic
1124088050 15:26570398-26570420 GGAGGGCGAGGCCCGCGAGGAGG - Intronic
1124696382 15:31867903-31867925 GGAGGGGGAGGGGCGGGGGGCGG + Intronic
1124883308 15:33661542-33661564 GGTGGGTGAGGCTGGGGGAGGGG + Intronic
1125505662 15:40266242-40266264 GGGGGGCGAGGCTCCTGGTGGGG - Exonic
1125685190 15:41559495-41559517 GAAGGCCGAGGCTCGGAGCCGGG + Intronic
1127103282 15:55588387-55588409 GGCGGGCGAGGGACGTGGCGCGG + Intronic
1127103360 15:55588630-55588652 GGAGCGCCGGGCGCGGGGCGGGG - Intronic
1127257832 15:57306761-57306783 AGAGGCCGAGGACCGGGGCGCGG - Intergenic
1127893812 15:63277534-63277556 GGTGGGTGGGGCTCGGGGTGGGG - Exonic
1127917494 15:63467168-63467190 GGAGAGCGGGGCTCGGGTCTGGG - Intergenic
1128078331 15:64841858-64841880 GGGGGGCGGGGCCGGGGGCGGGG - Intergenic
1128126187 15:65194858-65194880 GGAGGGGGAGGGTCGGGGGGGGG - Exonic
1128344140 15:66842850-66842872 GGAGGGCGCGGCTCCGGGCGCGG + Intergenic
1128547644 15:68578854-68578876 CGAGCGGGAGGCTCGGGGCACGG + Intergenic
1128636449 15:69305512-69305534 GTGGGGCGAGGCTCGGAGTGAGG + Intronic
1129108146 15:73322949-73322971 GGAGCCAGAGGCCCGGGGCGGGG + Exonic
1129854018 15:78811504-78811526 GGAGTCCGAGGGGCGGGGCGGGG - Intronic
1130301185 15:82680686-82680708 GGAGGACGAGGCCAAGGGCGCGG - Exonic
1131828749 15:96341151-96341173 GGGGGGCGAGGGCGGGGGCGGGG + Intergenic
1132145205 15:99425414-99425436 GGAGGGTGAGGCTGGGGTGGGGG + Intergenic
1132178472 15:99733555-99733577 CCGGGGCGGGGCTCGGGGCGGGG + Intronic
1132178478 15:99733567-99733589 TCGGGGCGGGGCTCGGGGCGGGG + Intergenic
1132462238 16:61361-61383 TGAGGACGGGGCTGGGGGCGGGG - Intronic
1132480666 16:164874-164896 GCGGGGCGGGGCGCGGGGCGGGG + Intronic
1132480696 16:164932-164954 GCGGGGCGGGGCGCGGGGCGGGG + Intronic
1132579820 16:679823-679845 GGAGGCGGCGGCTGGGGGCGGGG + Intronic
1132663762 16:1072723-1072745 GGAGGGGGCGGGGCGGGGCGGGG - Intergenic
1132683507 16:1153174-1153196 GGGGCGCGGGGCGCGGGGCGCGG - Intergenic
1132683510 16:1153181-1153203 GGGGCGCGGGGCGCGGGGCGCGG - Intergenic
1132683514 16:1153188-1153210 TGAGGCCGGGGCGCGGGGCGCGG - Intergenic
1132727514 16:1345410-1345432 GGCGGGGGAGGCTGGGGGCCTGG - Intronic
1132741385 16:1414863-1414885 GCAGGGCGGGGCGCGGGGCTGGG - Intergenic
1133048071 16:3100180-3100202 GGAGAGCGAGGCGCGGGACGCGG - Intergenic
1133234235 16:4380388-4380410 GGAGGGCGGGACACGGAGCGTGG + Intronic
1134056502 16:11173539-11173561 TGAGGGAGAGGCTCGTGGAGAGG + Intronic
1134134197 16:11668683-11668705 GGCGGGCGCGGCTCGGGGGAGGG + Intronic
1134275342 16:12770884-12770906 GAAGGGGGAGGGGCGGGGCGGGG + Intronic
1134277585 16:12790680-12790702 GGAGGCCGAGTGGCGGGGCGGGG + Intronic
1134520012 16:14914272-14914294 GGAGGGGAAGGGTCGGGGCAGGG - Intronic
1134553921 16:15151965-15151987 GGAGGGGAAGGGTCGGGGCAGGG + Intergenic
1134707685 16:16312926-16312948 GGAGGGGAAGGGTCGGGGCAGGG - Intergenic
1134831534 16:17327618-17327640 GGAGGCCGAGGCGGGGGGGGGGG - Intronic
1134959858 16:18399199-18399221 GGAGGGGAAGGGTCGGGGCAGGG + Intergenic
1136395625 16:29991225-29991247 GGAGGGCCAGGCTGGGGCAGGGG - Intronic
1136535056 16:30894197-30894219 GGCGGGCCCGGGTCGGGGCGGGG - Exonic
1136540270 16:30924543-30924565 AGAGGGTGAGGCTGGGGGCGGGG - Intronic
1137280561 16:46973320-46973342 GGAGTGCGCGGCTCGCGGCGAGG + Intronic
1137300536 16:47144039-47144061 GGCGCGCGAGGCGCGGCGCGGGG - Intergenic
1137559241 16:49492464-49492486 GGAGGCCGAGGCCGGGGCCGGGG + Intronic
1137655416 16:50154162-50154184 GGAGGGCGGGCCGCGGGGGGCGG + Exonic
1138247576 16:55479121-55479143 GCAGAGCGGGGCTGGGGGCGGGG - Exonic
1139433508 16:66923763-66923785 GGAGTGCCAGGCTCGTGTCGGGG - Intronic
1139545021 16:67645969-67645991 TGAGGGCGGGGCTGGGGGCTTGG + Intronic
1140946201 16:79770560-79770582 GCGGGGCGGGGCTGGGGGCGCGG - Intergenic
1141432989 16:83980550-83980572 GGAGGGCCAAGCTGGGGGCCAGG - Intronic
1141509771 16:84504798-84504820 GGTGGGTGCGGCTCGGGGCGGGG + Intronic
1141655868 16:85416290-85416312 GGAGGGAGGGGCCCGGGGCCGGG + Intergenic
1141973055 16:87495755-87495777 GGTGGGAGAGGGTCGGGGGGTGG - Intergenic
1141989513 16:87602310-87602332 GGAGCGCGGGGCTGGGGGCGCGG + Intronic
1141995421 16:87634103-87634125 GGAGGGACAGGCACGGGGCATGG + Intronic
1142005706 16:87688695-87688717 GGACGGGGATGCTGGGGGCGGGG + Intronic
1142006006 16:87689878-87689900 GGTGGACGAGGAGCGGGGCGGGG + Exonic
1142012898 16:87726194-87726216 GACGGGCGAGGCGCGGGGTGGGG - Intronic
1142012985 16:87726483-87726505 GACGGGCGAGGCGCGGGGTGGGG - Intronic
1142013043 16:87726675-87726697 GACGGGCGAGGCGCGGGGTGGGG - Intronic
1142120314 16:88383591-88383613 GGAGCGAGGGGCTCGGGGAGCGG + Intergenic
1142252714 16:88999848-88999870 GGAGGGCGGGGGGCGGGGGGCGG + Intergenic
1142413159 16:89926255-89926277 GCGGGGCGGGGCTGGGGGCGGGG + Intronic
1142656757 17:1399750-1399772 GGAGGGCGAGTCCCGGGGCGGGG - Intronic
1142848190 17:2692103-2692125 GGGAGGCGCGGCGCGGGGCGAGG + Intronic
1142872041 17:2827444-2827466 TGAGGGTGGGGCTCGGGGCTGGG + Intronic
1142876382 17:2853889-2853911 GGAGGCCGGGGGCCGGGGCGCGG + Intronic
1142894244 17:2964064-2964086 GGAAGGTGAGGCTGGGGGAGAGG + Exonic
1143155413 17:4833431-4833453 GGAGGGGGAGGGCCGGCGCGAGG - Exonic
1143524377 17:7463579-7463601 GGAGGGCCAGGCTCTGGGGCAGG + Exonic
1143548532 17:7614630-7614652 GGAGGGGGAGCCGCGGGGGGCGG + Exonic
1143575013 17:7787079-7787101 GGAGGGCGTGGGCCGGGGCTGGG + Intronic
1143904592 17:10198647-10198669 GGGGGGCGGGGCTCAGGGGGAGG + Intergenic
1144029368 17:11305762-11305784 GCAGGTGGAGGCTCGGGGCAGGG - Intronic
1144656730 17:17042095-17042117 GGAAGGCGAGCCTGGGAGCGAGG + Intergenic
1144695791 17:17303308-17303330 GGAGGCGGAGCCCCGGGGCGGGG - Intergenic
1144947712 17:18978236-18978258 GGAGGGCAAGGCTCTGGACGGGG + Exonic
1145031310 17:19507346-19507368 GGGGCGCGGGGCTCGGGGCTCGG - Intronic
1145266739 17:21383326-21383348 CGAGGCAGAGGGTCGGGGCGGGG - Intronic
1146438868 17:32876707-32876729 AGAGGGGGCGCCTCGGGGCGCGG - Intronic
1146646440 17:34580036-34580058 GGAAGGCGAGGAGCGAGGCGGGG + Intergenic
1146928787 17:36763581-36763603 GGAGTGTGAGGGTGGGGGCGGGG - Intergenic
1147132455 17:38417580-38417602 GGAGAGTGCGGCTCAGGGCGAGG + Intergenic
1147134777 17:38428522-38428544 GGGGGCCGGGGCTCCGGGCGGGG - Exonic
1147374775 17:40016949-40016971 GGAGGGCTTGGCTCAGGGCTGGG - Exonic
1147407029 17:40219565-40219587 GGGGAGGGGGGCTCGGGGCGGGG + Intronic
1147702599 17:42405295-42405317 GGAGGGCGAGGAGCTGGGCGAGG - Exonic
1147722711 17:42548612-42548634 AGAGGCCGAGGCTGGGGCCGGGG + Intergenic
1147723923 17:42554833-42554855 TGGGGCCGAGGCTGGGGGCGGGG + Exonic
1148142385 17:45338082-45338104 GGAGGGCCTGGCACAGGGCGGGG + Intergenic
1148339152 17:46863133-46863155 GGAGGGCGTGGCTCTGGAGGAGG - Intronic
1148419247 17:47531642-47531664 GGCGGGCGGGCCTCGGGTCGGGG + Intronic
1148647984 17:49230215-49230237 GGGGTGCGCGGCTCGGGGAGGGG + Intronic
1148797309 17:50203239-50203261 GGAGGGCGTGGAGAGGGGCGGGG - Intergenic
1150137652 17:62704330-62704352 GGGGGGCGAGGCCGGGGTCGGGG + Intronic
1150311187 17:64130300-64130322 GGAGGGGCTGGCTCGGGGCGGGG + Intronic
1150625376 17:66837858-66837880 AGAAGGAGAGGCTTGGGGCGAGG + Intronic
1150643437 17:66964529-66964551 GGGGGCCGAGGCTCGAGGGGCGG + Intergenic
1151513622 17:74578168-74578190 GAAGGGTGAGGCTGGGGGTGGGG + Intergenic
1151580189 17:74973021-74973043 GAAGGGTGAGGACCGGGGCGGGG - Intronic
1151642328 17:75405359-75405381 GGGCGGCGAGGCTTGGGACGTGG - Exonic
1151703182 17:75753991-75754013 GGTGGGCGCGGATCGGGGGGCGG - Intronic
1151828701 17:76537589-76537611 GGGGCGCGGGGCGCGGGGCGCGG + Exonic
1151919278 17:77141277-77141299 GGAGGGCGAGCAGGGGGGCGGGG - Intronic
1152077616 17:78168930-78168952 GGGGCGCGAGGCTGGGGGTGGGG - Intronic
1152175152 17:78782328-78782350 GGCGGGCGGGGCGCGGGGCGCGG - Intergenic
1152362430 17:79838961-79838983 GGGGGCCGAGGCGCGGGGCTCGG - Intronic
1152656957 17:81524219-81524241 GGAGGCCGAGGCTCAGGCCTCGG + Intergenic
1152697570 17:81804502-81804524 GGGGGGCGCGGCTGGGGGCGGGG + Intronic
1152711217 17:81871241-81871263 GGAGGCGGCGGGTCGGGGCGGGG - Intronic
1152718583 17:81911515-81911537 GGAGGGCGGGAGGCGGGGCGGGG - Intergenic
1152745414 17:82036491-82036513 TGAGGGCGAGGCTGGGGCTGGGG + Intronic
1152798110 17:82317763-82317785 GGAGGTCAAGGCCTGGGGCGGGG + Intergenic
1152834551 17:82520479-82520501 GGAGGACGGGGGTCGGGGCCAGG - Intronic
1152853062 17:82648743-82648765 GGAGGGGGCGGGGCGGGGCGGGG + Intergenic
1152853109 17:82648847-82648869 GGAGGGGGAGGGGCGGGGCGGGG + Intergenic
1153419341 18:4886490-4886512 GGAGGGCGAGCCAAGGGGGGTGG - Intergenic
1154210922 18:12377589-12377611 GGGGGGCGTGGCTGGAGGCGGGG + Intergenic
1154294048 18:13134669-13134691 GGAGTGCGGGGCGCAGGGCGCGG - Intergenic
1155130803 18:22933205-22933227 GGAGGGCGATGGTTGGGGAGGGG - Intronic
1157491931 18:48129659-48129681 GGAGGGAGAGGCTCCGGGCACGG + Intronic
1157566705 18:48683439-48683461 GGAGGGTGAGGCTCGGGGGCAGG - Intronic
1158620942 18:59032056-59032078 GGAGTGCGGGGTTGGGGGCGGGG - Intergenic
1158729881 18:60011080-60011102 GAATGGCGAGGCTCCGGGCTCGG + Intergenic
1159768752 18:72522793-72522815 GGTGGGGGAGGGTCGGGGAGAGG + Intergenic
1159813714 18:73047267-73047289 GGAGGCCGGGGGTCGGGGGGGGG + Intergenic
1160499903 18:79396393-79396415 GGGGGGCGCGGCCCGGGCCGTGG - Intronic
1160500922 18:79400790-79400812 GGAGGGCGGGACGCGGGGCGGGG - Intronic
1160567858 18:79798209-79798231 GGCGGGGGCGGCTCGGGGCCGGG + Intergenic
1160659516 19:291557-291579 GGAGGGGAGGGCTAGGGGCGGGG + Intergenic
1160659519 19:291562-291584 GGAGGGCTAGGGGCGGGGAGGGG + Intergenic
1160662129 19:306108-306130 GGAAGGCGAGGCTGGGGTGGGGG + Exonic
1160738702 19:676323-676345 GCGGGGCGGGGCGCGGGGCGGGG - Intergenic
1160784422 19:892885-892907 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160784425 19:892892-892914 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160784428 19:892899-892921 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160784431 19:892906-892928 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160784434 19:892913-892935 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160784437 19:892920-892942 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1160791580 19:925966-925988 GGTGGGGGAGGGGCGGGGCGGGG + Intronic
1160815059 19:1031323-1031345 GGAGGCCGAGGGTGGTGGCGGGG + Intronic
1160823021 19:1067114-1067136 GGGGGGCGCGGCCCGGGGCTGGG + Intronic
1160838857 19:1137290-1137312 GTGGGGGGAGGCTCGGGCCGGGG + Intronic
1160838870 19:1137317-1137339 GTGGGGGGAGGCTCGGGCCGGGG + Intronic
1160838883 19:1137344-1137366 GTGGGGGGAGGCTCGGGCCGGGG + Intronic
1160838895 19:1137371-1137393 GTGGGGGGAGGCTCGGGCCGGGG + Intronic
1160838945 19:1137500-1137522 GGGGGGTGAGGCTCGGGCTGGGG + Intronic
1160944159 19:1633453-1633475 GGAGGGCAGGGGGCGGGGCGGGG - Intronic
1160975489 19:1790432-1790454 GGAGGGAGAGGGTAGGGGAGAGG - Intronic
1160991567 19:1862456-1862478 GGAGGGCGAGGCTAGGAGCGCGG - Intronic
1161064652 19:2231645-2231667 TGAAGGCCAGGCTCGGGGCTTGG - Exonic
1161150098 19:2702859-2702881 GTGGGGCGGGGCTCCGGGCGCGG + Intergenic
1161288279 19:3479745-3479767 GGAGGCAGAGGCTCAGGGGGAGG + Intronic
1161288331 19:3479939-3479961 GGAGGCAGAGGCTCAGGGGGAGG + Intronic
1161296805 19:3524254-3524276 GGAGGGCGGGGCGCAGTGCGAGG + Intronic
1161298575 19:3532100-3532122 GGAAGCCCAGGCTCTGGGCGGGG - Intronic
1161311376 19:3595963-3595985 GGCGGGCGGGGCTGGAGGCGGGG - Intronic
1161596163 19:5152096-5152118 GGAGGGTGAGCCTCGGGGGGGGG + Exonic
1161733606 19:5977512-5977534 GGGGGCCGAAGTTCGGGGCGGGG + Intronic
1161769202 19:6222268-6222290 GGAGGAGGAGGTGCGGGGCGAGG + Exonic
1161808828 19:6459860-6459882 CGAGGGCGGAGCTGGGGGCGTGG + Intronic
1161852709 19:6746017-6746039 GGGGGGCGAGGCTACCGGCGGGG - Intronic
1161925014 19:7293774-7293796 AGAGGGTGAGTCTGGGGGCGCGG - Exonic
1162001318 19:7746704-7746726 GGAAGGGGAGGCTGGGGACGGGG - Intronic
1162003859 19:7764991-7765013 GGAGGGAGAGGCTGGGGATGGGG + Intronic
1162018972 19:7860188-7860210 GGTGGGCGAGGCAGGGGGTGGGG - Intronic
1162019709 19:7862924-7862946 GGAGGGCGGGTCAGGGGGCGCGG - Intronic
1162031849 19:7920878-7920900 GCAGGACGAGCCTGGGGGCGGGG + Intronic
1162118278 19:8445309-8445331 GGGTGGCGAGGCTCGAGGCCCGG - Intronic
1162344414 19:10111118-10111140 GGTGGGCGAGGCCGGGGCCGGGG + Exonic
1162403961 19:10462397-10462419 GGAGGCCAAGGCGGGGGGCGGGG - Intronic
1162567635 19:11453082-11453104 GGTGGGGGAGGCTCAGGGCTGGG + Exonic
1162909513 19:13841745-13841767 TGAGGGTGAGGCTGGGGGCTGGG - Intergenic
1162924459 19:13923306-13923328 GGAGGACGAGGCTGGTGGCGGGG - Intronic
1162958508 19:14112950-14112972 GGAGAGAAAGGCTTGGGGCGGGG + Intronic
1163434888 19:17289572-17289594 GGCGGGCGGGGGTCGGGGGGGGG + Intergenic
1163529686 19:17842258-17842280 TGGGGGCGGGGCTCGGGGAGGGG - Intronic
1163601454 19:18251689-18251711 GGAGGCCGAGGGCGGGGGCGGGG - Intronic
1163631377 19:18419547-18419569 GGGCGGTGAGGCCCGGGGCGCGG + Exonic
1163655668 19:18543527-18543549 GGCGGCCGCGGCTGGGGGCGGGG - Exonic
1163790900 19:19305659-19305681 GGAGGGTGAGGGGCGGGGCTGGG - Intronic
1163799122 19:19354470-19354492 GGAGGGCCAGGCTGGGGCTGGGG - Intronic
1164264723 19:23604173-23604195 GGAGGCCGAGGGTGGGGGGGGGG + Intronic
1164639035 19:29811722-29811744 CGAGGGCCGGGCGCGGGGCGCGG - Intergenic
1165079249 19:33298344-33298366 GGAGGGCGAGGCCCCCGGGGGGG - Intergenic
1165460276 19:35940120-35940142 GGCGGGCGAGCCCCGGGGCCTGG - Exonic
1165600729 19:37054065-37054087 GGGCGGCGAGGCTGGGGGAGGGG - Intronic
1165763474 19:38336081-38336103 GAAGGGCGAAGGGCGGGGCGGGG + Intronic
1165770032 19:38374684-38374706 GGAGCCCAAGGCCCGGGGCGGGG - Exonic
1165858650 19:38895062-38895084 GGAGGGCGAGGAGGGAGGCGGGG - Intronic
1165940784 19:39413740-39413762 GGAGGGCGAGGGGCAGGGCTGGG - Intronic
1166121604 19:40690425-40690447 GGAGAGGGGGGCTCGGGTCGGGG - Intronic
1166296804 19:41893653-41893675 GGAGGAGGAGGCTGGGGGCCTGG + Intronic
1166306897 19:41940401-41940423 GGCGGGGGAGGGGCGGGGCGGGG - Intergenic
1166354698 19:42220153-42220175 TGTGGGCGGGGCTCAGGGCGAGG - Intergenic
1166571833 19:43802120-43802142 GGAGGAGGAGGCTGGGGGCCTGG - Intronic
1166836173 19:45669286-45669308 GGAGGGAGAGGCACGCGGAGTGG - Intronic
1166949402 19:46416550-46416572 GAAGGGGGAGGCGAGGGGCGGGG - Intergenic
1167103728 19:47419052-47419074 GGAGGGTAGGTCTCGGGGCGGGG - Exonic
1167147919 19:47694079-47694101 GGAGGGAGAGGGGAGGGGCGGGG - Intronic
1167369009 19:49069980-49070002 GGAGGGCAAGGCTGGGGGGAGGG - Exonic
1167379993 19:49133209-49133231 GGAGGGAGAGGCAGGGGGAGGGG - Intronic
1167467330 19:49657288-49657310 GGAGGGGGTGGCTAGGGGTGAGG - Intronic
1167741727 19:51327917-51327939 GGTGGGCGGGGCCGGGGGCGGGG + Intronic
1167874224 19:52398207-52398229 GAAGGGCGAGGCTAGGGGAACGG - Intronic
1168064172 19:53909793-53909815 GGAAGGCGAGGTACGGGGCGAGG + Intronic
1168411290 19:56141649-56141671 GGAGGGGGAGGGGCGGGACGGGG + Intronic
1168461922 19:56567011-56567033 ACAGGGCGGGGCTTGGGGCGCGG - Intergenic
925210933 2:2045380-2045402 GGTGGGAGAGGCTCTGGGAGGGG + Intronic
925419958 2:3703727-3703749 GGCGAGCGAGGAGCGGGGCGCGG + Exonic
926047630 2:9721429-9721451 GGAAGGGGAGGCACAGGGCGTGG + Intergenic
926087845 2:10031276-10031298 GGAGGGCAAGGCTTGGGGCAGGG + Intergenic
926095874 2:10080317-10080339 GCAGGGGGAGGCGCGGGGCGAGG + Exonic
926801813 2:16665871-16665893 GGACGGGGAGGGGCGGGGCGGGG - Intronic
927887330 2:26726775-26726797 GGTGGGCCAGGGTGGGGGCGGGG + Intronic
927989158 2:27435234-27435256 GGAGGGAGAGGTTCTGGGCAGGG + Intronic
928303383 2:30146830-30146852 GGAGGCCGAGGACAGGGGCGGGG + Intergenic
928320931 2:30282381-30282403 GCAGGGTGGGGCTCGGGGAGCGG - Intronic
928549434 2:32357005-32357027 GGGAGGCGGGGCCCGGGGCGCGG - Intergenic
930124350 2:47783892-47783914 GGTGGGCGGGGCGGGGGGCGGGG + Intronic
931253748 2:60553779-60553801 GGAGGGGGAGGTGCGGGGCGGGG + Intergenic
931587292 2:63841751-63841773 GGAGGGGGCAGCTAGGGGCGCGG + Exonic
932292400 2:70593690-70593712 GGAGAGCCAGGCTGGGGGAGTGG + Intergenic
933658089 2:84905594-84905616 GGCGGGTGAGGGGCGGGGCGGGG + Intronic
934045563 2:88170421-88170443 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
934045566 2:88170428-88170450 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
934525548 2:95049482-95049504 GGGGGGAGAGGCAAGGGGCGGGG + Intronic
934604156 2:95681625-95681647 GCAGGGTGAGGCTGGGGGCTGGG + Intergenic
934665037 2:96163970-96163992 GGGGGCGGAGGCTGGGGGCGCGG - Intergenic
934763932 2:96870024-96870046 GGAGCCCGAGCCTAGGGGCGCGG - Intronic
934966910 2:98731236-98731258 GGGGCGCGGGGCGCGGGGCGCGG - Intergenic
935645293 2:105329577-105329599 GGGGTGCGGGGCTCAGGGCGCGG - Intronic
936103550 2:109604381-109604403 GGAAGGGGAGGGGCGGGGCGGGG + Intronic
936167886 2:110139787-110139809 GGAGGGTGAGGATAGAGGCGGGG + Intronic
936537546 2:113323859-113323881 GCAGGGTGAGGCTGGGGGCTGGG + Intergenic
936976176 2:118224492-118224514 GGAGAGCTCGGCCCGGGGCGCGG + Intergenic
937418618 2:121737050-121737072 GTGTGGCGAGGCGCGGGGCGGGG + Intergenic
937904537 2:127046418-127046440 GCAGGGCCAGGATCGGGGCTGGG - Intergenic
938070740 2:128306920-128306942 GGAGGCTGAGGCACAGGGCGTGG + Intronic
938260451 2:129892053-129892075 GGAGGGCCAGGCTGGCGGGGAGG - Intergenic
938370167 2:130763619-130763641 GGTGGGTGGGGCACGGGGCGTGG - Exonic
938397799 2:130963789-130963811 GGCGCGCGCGGCTCGGAGCGAGG - Intronic
938795947 2:134718635-134718657 GCTGGGCGAGGCGCGGGGCTCGG - Intronic
945119549 2:206443705-206443727 GGGGCGCGGGGCTCGGGGCTGGG - Exonic
946248437 2:218399915-218399937 GGAGGGGGAGGGAGGGGGCGCGG - Exonic
947625203 2:231614481-231614503 GGCAGGGGAGGCTGGGGGCGGGG - Intergenic
947752167 2:232538834-232538856 GGAGGGAGAAGCTCAGGGAGGGG + Intergenic
947796465 2:232896753-232896775 TGAGGGTGAGGTTAGGGGCGTGG + Intronic
948116042 2:235494654-235494676 GGGGCGCGCGGCTCCGGGCGCGG + Exonic
948149295 2:235732589-235732611 GGCGGGAGAGGCTTGGGGAGAGG - Intronic
948402065 2:237691899-237691921 GGAGCGCGGGGGGCGGGGCGGGG + Intronic
948468701 2:238164179-238164201 CGTGGGTGAGGCCCGGGGCGTGG + Exonic
948494751 2:238340130-238340152 GCAGGGCCAGGGTCGGGGGGAGG - Intronic
948873110 2:240813462-240813484 GGATGGCGGGGCTGGGGGTGCGG - Intronic
948983834 2:241508373-241508395 AGAGGGAGGGGCCCGGGGCGGGG - Intronic
1168991993 20:2103001-2103023 GGCGGCCGAGGCCCCGGGCGAGG + Exonic
1169065665 20:2693120-2693142 GGAGGCGGAGGCTGCGGGCGCGG - Exonic
1169118628 20:3082837-3082859 GGCGGGCGCAGCTCGGGGTGCGG + Intronic
1169171805 20:3471223-3471245 GGAGGCCGGGGCTGGGGGCCGGG + Exonic
1169345143 20:4823297-4823319 TGAAGGCAAGGCGCGGGGCGCGG - Intronic
1169363543 20:4972132-4972154 GGAGGGCCAGGCTCATGGCTGGG - Intronic
1169673816 20:8132568-8132590 GGGGCGCGGGGCGCGGGGCGCGG - Intronic
1170026188 20:11891336-11891358 GGAGGTCCAGGCAGGGGGCGCGG + Intronic
1170562653 20:17570223-17570245 GGAGGCCGAGGCGTGGGCCGAGG + Intronic
1171121495 20:22572640-22572662 GGAGGGGGAGGCTTGCCGCGGGG + Intergenic
1171201680 20:23247001-23247023 AGAGAGCGAGGGTCGGGGTGGGG - Intergenic
1171458131 20:25283295-25283317 GGAGGGCTGGGGTCGGGGCTGGG - Intronic
1172596527 20:36154501-36154523 AGAGGGCGGGGCGCGGGGGGAGG + Intronic
1172633257 20:36393037-36393059 GGAAAGGGAGGCTGGGGGCGGGG + Intronic
1172644576 20:36461684-36461706 GGAGGGCGAGGGCGGGGGCGGGG - Intronic
1172774007 20:37396915-37396937 GGAGGAGGAGGCTCGGGGTGGGG - Intronic
1172873024 20:38147503-38147525 GCAGGGCCAGGCTCAGGGAGGGG - Intronic
1173569629 20:44067947-44067969 GGAGGCCGAGGCTAGGGCTGGGG - Intronic
1173735870 20:45360822-45360844 GGAGGCCGAGGCTTGGGCCTGGG + Intergenic
1173843925 20:46176389-46176411 GGTGGGGGAGACTCGGGGTGGGG - Intronic
1174386247 20:50190128-50190150 GGTGGGCGGGGCTAGGGGCGGGG + Intergenic
1174480548 20:50828278-50828300 GGAGGGCTAGGCGTGGGGAGAGG + Intronic
1174511627 20:51057817-51057839 TGAGGGCCAGCCTCGGGGCAGGG + Intergenic
1174570954 20:51500829-51500851 GGAGGGTGAGGGTGGGGGTGGGG - Intronic
1174804178 20:53592701-53592723 GGAGGGCGCTGCTGGGGGCCCGG - Intronic
1175108223 20:56629212-56629234 GGAGGCCCAGGCGCCGGGCGGGG - Intergenic
1175415356 20:58797228-58797250 GCAGGGCGAGGCTGTGGGCAGGG + Intergenic
1175884447 20:62281190-62281212 AGAGCGCGAGGCTCCGGGTGGGG + Intronic
1175939448 20:62531322-62531344 GGAGGGGCAGGCTCAGGGAGGGG - Intergenic
1176005583 20:62860963-62860985 GGAGGCCGAGGCCGGGGCCGGGG - Intronic
1176135640 20:63520939-63520961 GGGGGGCGAGGGGCGGGGCTGGG + Intronic
1176137534 20:63530712-63530734 AGAGGGCGTGGCTGGGGTCGTGG - Intronic
1176194253 20:63830418-63830440 GGGCGGGGCGGCTCGGGGCGCGG - Intronic
1176234751 20:64049101-64049123 GGCGGGGGGGGCTCGGGCCGGGG - Intronic
1176412609 21:6457268-6457290 GGTGGGCGTGGCCAGGGGCGGGG - Intergenic
1176549059 21:8213698-8213720 GGAGGGAGGGGCACGGGCCGGGG - Intergenic
1176556953 21:8257918-8257940 GGAGGGAGGGGCACGGGCCGGGG - Intergenic
1176567991 21:8396736-8396758 GGAGGGAGGGGCACGGGCCGGGG - Intergenic
1176575895 21:8440955-8440977 GGAGGGAGGGGCACGGGCCGGGG - Intergenic
1178824665 21:36005029-36005051 GGAGGGAGAGGCAGGGGGAGGGG + Intergenic
1179133753 21:38661392-38661414 GGAGGGAGAGGCGCGGTGCCCGG + Intronic
1179600782 21:42476133-42476155 GGAGGGGGAGGGTGGGGGCACGG - Intronic
1179688103 21:43065590-43065612 GGTGGGCGTGGCCAGGGGCGGGG - Intronic
1179783816 21:43718831-43718853 GGGGCGCGGGGCGCGGGGCGCGG + Intergenic
1179794777 21:43776445-43776467 GCGGGGCGGGGCGCGGGGCGGGG + Exonic
1179794783 21:43776457-43776479 GCGGGGCGGGGCGCGGGGCGGGG + Intergenic
1179882824 21:44300522-44300544 GAAGGGCCAGGCTCTGGGGGTGG - Intronic
1179913502 21:44462232-44462254 GGAGGGGGAGGCTCGGGGTTTGG - Intergenic
1180008471 21:45034201-45034223 GGTGTGCGGGGCTCGGTGCGGGG + Intergenic
1180064268 21:45404996-45405018 GCAGGGCAAGGCCCGGGGAGGGG - Intergenic
1180559142 22:16601736-16601758 GGAGGGCGGGCCGCGGGGCCCGG - Intergenic
1180560104 22:16609137-16609159 GGAGGGCGCTGCTGGGGGCCCGG - Intergenic
1180609376 22:17085543-17085565 GGAGGGCGCGGCGCTGGGCCAGG + Intronic
1180793839 22:18592269-18592291 GGAAGGCGAGGCCCTGGGAGTGG - Intergenic
1180991827 22:19941716-19941738 GGCGGGCGGGGTGCGGGGCGCGG - Exonic
1181064475 22:20299109-20299131 AGAGGGCGCGGCTGGGAGCGCGG + Intergenic
1181064636 22:20299631-20299653 AGTGGGCGCGGCTCGGAGCGTGG + Intergenic
1181082782 22:20425537-20425559 GGCGGGCGAGGCTGGCGGCACGG + Exonic
1181167153 22:20989857-20989879 GGAGAGCGAGGCTCAGGTCGAGG - Intronic
1181227901 22:21403051-21403073 GGAAGGCGAGGCCCTGGGAGTGG + Intergenic
1181250752 22:21531788-21531810 GGAAGGCGAGGCCCTGGGAGTGG - Intergenic
1181280588 22:21717125-21717147 GGAGGCCGGGGCTGGGGGGGCGG + Intronic
1181941804 22:26483648-26483670 GGTGGGCGGCGCTCGGAGCGCGG - Intronic
1182423130 22:30258056-30258078 TGAGGGCTGGGCTCGGGGAGGGG - Intergenic
1182585698 22:31343356-31343378 GGCGGGAGAGGCTGGGGGAGGGG - Intronic
1183201580 22:36388327-36388349 GGAGGCGGCGACTCGGGGCGCGG + Intergenic
1183535200 22:38397381-38397403 GGAGGGCGCTGCTGGGGGCCTGG - Intronic
1183742404 22:39676053-39676075 GGAGGGAGAGGCTGGAGGCAGGG + Intronic
1184086779 22:42270350-42270372 GGAGGCCGAGGGACTGGGCGGGG - Intronic
1184086911 22:42270717-42270739 GGAGGGCGCGCGGCGGGGCGGGG + Intronic
1184141815 22:42581969-42581991 GCAGGACGAAGCTCGCGGCGCGG - Intergenic
1184236770 22:43187181-43187203 GGAGGGCGGGGCGGGGGGGGGGG - Intergenic
1184243956 22:43226626-43226648 GGAGGGTGGGGGTGGGGGCGGGG + Intronic
1184412228 22:44331870-44331892 GGCGGGCGCGGCGCGGGGCTCGG - Intergenic
1184451720 22:44586432-44586454 GGATGGTGAGGCGCAGGGCGGGG - Intergenic
1184680775 22:46071284-46071306 GCGGGGCGAGGCGCGGGGCCCGG + Intronic
1184759719 22:46537520-46537542 GGCGGGCCCGGCGCGGGGCGGGG + Intergenic
1184806327 22:46796897-46796919 GGAGGGCCAGGCAGGTGGCGGGG + Intronic
1184892861 22:47390163-47390185 GAAGGCCGAGGCTCGGTGAGGGG - Intergenic
1184932539 22:47691939-47691961 GGTGGGCGAGGATGGGGGCCAGG - Intergenic
1185037920 22:48489430-48489452 CGCGGGCGCGGCGCGGGGCGCGG + Intergenic
1185055253 22:48575847-48575869 GGCGGGCCAGGCTCGGGGCCGGG - Intronic
1185314004 22:50170965-50170987 GGCGGCCGGGGCGCGGGGCGCGG + Intronic
1185397420 22:50600307-50600329 GGCGGGCGAGGCGGGAGGCGCGG - Intronic
1185409345 22:50674203-50674225 GGGGGCCGAGCCACGGGGCGGGG - Intergenic
1203253946 22_KI270733v1_random:130013-130035 GGAGGGAGGGGCACGGGCCGGGG - Intergenic
1203262002 22_KI270733v1_random:175092-175114 GGAGGGAGGGGCACGGGCCGGGG - Intergenic
950050798 3:9987364-9987386 GGAAGCCGAGGCTTGGGGCGCGG - Intronic
950056187 3:10026572-10026594 GGAAGCCAAGGTTCGGGGCGCGG - Intronic
950228957 3:11259456-11259478 GGTGGCCGAGGCTCGGGTCTTGG - Exonic
951543933 3:23806918-23806940 GGAGGGCAGGGCGGGGGGCGCGG - Intronic
954110170 3:48429229-48429251 TGAGTGCGGGGCTCGGGGCCAGG - Intronic
954375811 3:50193676-50193698 GCAGCGCGGGGCGCGGGGCGCGG + Intronic
954419775 3:50412619-50412641 GGAGGGAGAGGATAGGGGTGGGG + Intronic
954539765 3:51385524-51385546 AGAGGGCGAGGGCGGGGGCGGGG + Intronic
955230961 3:57098363-57098385 GGTGGCCGAGGCTCGGGGAAAGG - Exonic
955239368 3:57165456-57165478 GGAGGGCCAGGCTGTGGGGGCGG - Intronic
955387744 3:58492458-58492480 GGCGGGCGATGCTCCGGGCCCGG - Intronic
955856394 3:63278189-63278211 GGAGGGCGAGGAGGTGGGCGAGG - Exonic
956659501 3:71583858-71583880 GGAGGTAGAGGGTCGGGCCGGGG - Intronic
957054814 3:75435283-75435305 GGAGGGCGAGGCCTGGGGTAGGG + Intergenic
957225770 3:77443860-77443882 GGAGGGAGGGGCTCTGGGCTGGG - Intronic
957864033 3:85999258-85999280 GGAGGCCGAGGGTTGGGGGGTGG + Intronic
958980084 3:100709885-100709907 GGAGGACGAGGCCGGGGGGGAGG + Intronic
962520975 3:136196881-136196903 CGAGGGCGGGGCTTGGGGCCTGG - Intronic
962804251 3:138915710-138915732 GGAGGGCGCAGCGCAGGGCGGGG + Intergenic
963241234 3:143004575-143004597 GGAGGCCGAGGCGGGGGGGGGGG - Intronic
965558135 3:170038074-170038096 GGAGCGCGCGGGGCGGGGCGGGG + Exonic
968087155 3:195878920-195878942 GTGGGGGGAGGCACGGGGCGTGG + Intronic
968422769 4:499282-499304 GCAGGGCGAGGCTCCAGGTGGGG + Exonic
968550684 4:1222195-1222217 CAAGGGCGAGGGGCGGGGCGGGG + Intronic
968551106 4:1223714-1223736 GGAGGGGGAGCATCTGGGCGGGG - Intronic
968584250 4:1408618-1408640 GGCGGGCGAGGCCTGGGTCGGGG + Intergenic
968640530 4:1712354-1712376 GGAGGCCGAGGGGCGGGGCCCGG - Exonic
968653126 4:1767751-1767773 GGGGCGCGGGGCGCGGGGCGGGG - Intergenic
968850325 4:3074111-3074133 GGGTGGGGAGGCTGGGGGCGGGG - Intergenic
968879722 4:3292879-3292901 CGGGGGCGGGGCACGGGGCGGGG - Intergenic
969422108 4:7103464-7103486 GAAGGGCGGGGTTCGGGGCAAGG - Intergenic
969756395 4:9153101-9153123 GGAGGGCGGGGCCTGGGGTGTGG - Intergenic
970593235 4:17577390-17577412 GGCGGGCGCGCCTTGGGGCGGGG - Exonic
971196060 4:24472279-24472301 GGAGGCAGAGGCTCGGGAGGGGG - Intergenic
971201319 4:24511772-24511794 GGATGACAAGGCTCGGGGCTTGG - Intergenic
971207339 4:24583863-24583885 GGAGGGCCTGGGTGGGGGCGCGG - Intronic
971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG + Exonic
973271789 4:48269695-48269717 GGAGTGCGATACTCCGGGCGAGG - Intronic
973954571 4:56049604-56049626 GGATGGCGAGGCGCGGGAAGAGG - Intergenic
974003113 4:56530531-56530553 CTGGGGCGGGGCTCGGGGCGGGG + Intergenic
974003119 4:56530543-56530565 TCGGGGCGGGGCTCGGGGCGGGG + Intergenic
974036390 4:56821744-56821766 GGAGGGCGGGGGAAGGGGCGGGG + Intergenic
975715872 4:77205499-77205521 GGAGGGGGCGGCTGGGGGCGGGG - Intronic
976226477 4:82798595-82798617 GGAGCTCGAGGGTGGGGGCGGGG + Exonic
976390062 4:84497866-84497888 GGAGGGCGAGGCGGAGGGCAGGG + Exonic
976431505 4:84966956-84966978 GGAGAGAGGGGCGCGGGGCGGGG - Intergenic
976704662 4:88007933-88007955 GGAGGCCGCGGCTCCGGCCGGGG - Exonic
977937967 4:102827563-102827585 GGAGGGGGAGGGGCGGAGCGTGG - Intronic
980930049 4:139176681-139176703 GGAGCGCGGGGCGCGGGGCAGGG - Intronic
983484576 4:168318501-168318523 GGAGTGCTGGGCTCGGGGCGCGG - Intronic
983533299 4:168832671-168832693 GGAGGGCTCGGCTCAGGTCGGGG - Intronic
985520971 5:373790-373812 GGAGCGCCAGGCGCGTGGCGGGG - Intronic
985550143 5:528671-528693 GGGGAGCGGGGCGCGGGGCGGGG - Intergenic
985595180 5:784758-784780 TGGGGGCGGGGCTGGGGGCGGGG - Intergenic
987189053 5:15454738-15454760 GTAGTGGGAGGCTCGGGGAGAGG - Intergenic
989100563 5:37818917-37818939 GGAGGGGGAGGCGCAGGGCAGGG - Intronic
990608007 5:57429596-57429618 GGAGGGCTAGGCAGGGGGAGGGG + Intergenic
991475332 5:67012386-67012408 GGAGGGTGAGGCTGGGGTCCAGG - Intronic
992769627 5:80035285-80035307 GGCGGGGGAGGGCCGGGGCGGGG - Intronic
993925204 5:93857496-93857518 TGACAGCGAGGCTCGGGGAGGGG - Intronic
995162045 5:108993622-108993644 CGAGGGCGAGGGTGAGGGCGAGG + Intronic
995199357 5:109409772-109409794 GGAGTGTGGGGGTCGGGGCGAGG - Intronic
996329182 5:122311419-122311441 GGTGGGCGAGCTTCGGGGGGAGG + Intronic
996567259 5:124892741-124892763 GCAGGGCTAGGCTCTGGCCGGGG - Intergenic
997402221 5:133612051-133612073 GGACGCCGAGGCTCGTGGCCGGG - Intronic
997436588 5:133880138-133880160 GGAAGGAGAGGCTCAGGGCAAGG - Intergenic
997975436 5:138439180-138439202 GCCGGGCGCGGCGCGGGGCGGGG - Exonic
998071102 5:139198469-139198491 AGAGGGCGGGGCTAGGGGCGGGG - Intronic
998149117 5:139746996-139747018 GGAGGGCGAAGGACCGGGCGAGG - Intergenic
998152589 5:139765658-139765680 GGAGACCGAAGCGCGGGGCGCGG + Intergenic
998228874 5:140346659-140346681 GGAGGGGGCGGCGCCGGGCGGGG - Intergenic
998262070 5:140639367-140639389 TGAGGGCGGGGCTCGGCGAGTGG - Intronic
998583696 5:143404505-143404527 GGTGGGGGACGGTCGGGGCGCGG - Intronic
998658116 5:144205194-144205216 GGCGCGCGGGGCTTGGGGCGGGG - Intronic
998936464 5:147234774-147234796 GGAGGGCGACGTTGGGGGAGAGG - Intergenic
999244161 5:150144561-150144583 GGAGAGCGGGGCTCGGGCTGGGG - Intronic
999410175 5:151343604-151343626 GGAAGGGGAGGCAAGGGGCGAGG + Intronic
1000116602 5:158159824-158159846 GGAGGAGGATGCTGGGGGCGGGG - Intergenic
1001191648 5:169637520-169637542 GAAAGCCGAGGCTCGGGGAGAGG + Intronic
1001314709 5:170633734-170633756 GGAGGGGGGGGCGGGGGGCGGGG + Intronic
1001529967 5:172454632-172454654 GGTGGGCGGGGGTCGGGGCCGGG - Intergenic
1001653258 5:173329784-173329806 CGCGGGCGGGGCGCGGGGCGGGG - Intergenic
1001993434 5:176135093-176135115 GGAGGGAGAGGCTGGGGGCGAGG + Intergenic
1002006418 5:176238357-176238379 GCGGGGCGGGGCTCGGGGCGGGG + Exonic
1002140398 5:177134058-177134080 GGAGGGCCAGGCGCGATGCGGGG + Intronic
1002219962 5:177672280-177672302 GCGGGGCGGGGCTCGGGGCGGGG - Intergenic
1002448712 5:179307125-179307147 GCAGGGCGAGGGTCTGGGCCGGG - Intronic
1002452424 5:179326474-179326496 GGGGGGCGGGGCCGGGGGCGGGG - Intronic
1002508664 5:179698681-179698703 GGCGCGCGCGTCTCGGGGCGGGG - Intronic
1002622098 5:180494938-180494960 CGGGGGCGCGGCCCGGGGCGGGG - Intronic
1002638394 5:180619208-180619230 GGACGGCGAGACCCCGGGCGCGG - Intronic
1002888893 6:1317225-1317247 GGAGGGGTAGGCTGGGGGGGGGG - Intergenic
1002919351 6:1555235-1555257 GGAGCGCGGGGCTCAGGGCCAGG - Intergenic
1003872801 6:10415187-10415209 GGAGGGCGAGGAGAAGGGCGAGG + Exonic
1004044252 6:12011274-12011296 GGAGGGGGAGGCGGGGGGGGGGG - Intronic
1004529373 6:16439355-16439377 GGGGGGCGGGGCCGGGGGCGGGG + Intronic
1005348337 6:24911130-24911152 GGAGGGGGAGGCGCGGCGCGGGG + Intronic
1005838216 6:29723646-29723668 GGAGTGGGAGCCTGGGGGCGAGG - Exonic
1005847515 6:29792898-29792920 CGAGGGCGGGGCTCGGTGGGCGG + Intergenic
1005851747 6:29828035-29828057 GGAGTGGGAGCCTGGGGGCGAGG - Exonic
1005851875 6:29828496-29828518 CGAGGGCGAGGCTCGGTGGGCGG + Intronic
1005875349 6:30006788-30006810 GGAGTGGGAGCCTGGGGGCGAGG - Intergenic
1005931715 6:30489714-30489736 GGAGTGGGAGCCTGGGGGCGAGG - Exonic
1006043256 6:31271858-31271880 GGAGTGGGAGCCTGGGGGCGAGG + Exonic
1006300984 6:33193396-33193418 GGTGTGCCAGGCTGGGGGCGGGG - Intergenic
1006369205 6:33633797-33633819 GCCGGGCCAGGCTGGGGGCGGGG + Intronic
1006594394 6:35182336-35182358 GGACAGCGAGGCTGGGGGTGGGG - Intergenic
1007423757 6:41734572-41734594 GGAGGGGGAAACTCGGGGGGCGG + Intronic
1007574070 6:42913604-42913626 GGAGGCCGAGGGGCGGGGGGTGG - Intergenic
1007625427 6:43243723-43243745 GGCGGGCCGGGGTCGGGGCGGGG + Intronic
1009008089 6:57810937-57810959 GGAGGCCGAGCCGGGGGGCGGGG - Intergenic
1011410239 6:87059750-87059772 GGAGGGGGAGGCGGGGGGAGGGG + Intergenic
1011551864 6:88537551-88537573 GGAGGGAGAGCCTGGGGGCAAGG + Intergenic
1013369314 6:109455782-109455804 GGAGGGCGGGGGCGGGGGCGGGG + Exonic
1013472354 6:110476633-110476655 GGGCGGGGAGGTTCGGGGCGGGG - Exonic
1014272555 6:119349881-119349903 GGAGGGGGATGCGCGGGGCGGGG + Intergenic
1015786539 6:136924387-136924409 GGAGGCCCAGCCTCGGGGAGAGG + Exonic
1016455034 6:144221815-144221837 GGAGGTCGAGGCTCGCAGTGAGG + Intergenic
1016722152 6:147312461-147312483 GAAGGGCGGGGCTGGGGGCAGGG - Intronic
1017154473 6:151310503-151310525 GGAGGTCGAGGCTGGGGTCCAGG + Intronic
1017324509 6:153130731-153130753 GGAGGGCCGGGCCAGGGGCGCGG - Intronic
1017888518 6:158620625-158620647 GGACTGCGAGGCTCGGGCGGGGG - Intronic
1018020901 6:159761840-159761862 TGAGGCCGGGGCGCGGGGCGCGG - Exonic
1018020912 6:159761871-159761893 GGGGCGCGGGGCGCGGGGCGCGG - Exonic
1018020915 6:159761878-159761900 GGCGCGCGGGGCGCGGGGCGCGG - Exonic
1018457617 6:163965901-163965923 GAAGGGGGAGGCTCAGGGAGAGG - Intergenic
1019197549 6:170291145-170291167 GGAAGGGGGGGCTGGGGGCGGGG - Intergenic
1019381788 7:727692-727714 GGGGGGCGGGGCTTGGGGCGTGG - Intronic
1019404688 7:877296-877318 GGAGAGCGAGGCGGGGGGCAAGG - Intronic
1019412211 7:911552-911574 GGAGGGCCAGGAAGGGGGCGGGG + Intronic
1019412226 7:911582-911604 GGAGGGCCAGGAAGGGGGCGGGG + Intronic
1019412241 7:911612-911634 GGAGGGCCAGGAAGGGGGCGGGG + Intronic
1019412256 7:911642-911664 GGAGGGCCAGGAAGGGGGCGGGG + Intronic
1019412271 7:911672-911694 GGAGGGCCAGGAAGGGGGCGGGG + Intronic
1019412286 7:911702-911724 GGAGGGCCAGGAAGGGGGCGGGG + Intronic
1019412301 7:911732-911754 GGAGGGCCAGGAAGGGGGCGGGG + Intronic
1019412316 7:911762-911784 GGAGGGCCAGGAAGGGGGCGGGG + Intronic
1019412331 7:911792-911814 GGAGGGCCAGGAAGGGGGCGGGG + Intronic
1019412878 7:914273-914295 GGAAGGGGAAGCTCGGGGCTTGG - Intronic
1019454023 7:1115344-1115366 TGAGGGCGAGCCTGGGGGCTGGG - Intronic
1019547691 7:1586369-1586391 GGAGGGCGAGGCCAAGGGAGTGG - Intergenic
1019675546 7:2309873-2309895 AGAGGGGAAGGCTCGGGGCAGGG + Intronic
1020132889 7:5569654-5569676 AGAGGATGTGGCTCGGGGCGGGG + Intergenic
1022094385 7:27130026-27130048 GGAGGGAGAGGCTCAGGGGAAGG - Intronic
1022098582 7:27156078-27156100 GGAGCGCGGAGCGCGGGGCGCGG - Intronic
1022207970 7:28180818-28180840 GGAGGGCGGGGGCGGGGGCGGGG + Intergenic
1022973492 7:35537306-35537328 GCAGGGCGGGGCGGGGGGCGGGG + Intergenic
1023850283 7:44146302-44146324 CGTGGGCGGGGCCCGGGGCGGGG - Intronic
1024061012 7:45698792-45698814 GGAGGGTGAGGCATGGGGAGAGG - Intronic
1026522781 7:71131643-71131665 GGAGGGCGGGGCGCGGCCCGAGG - Intergenic
1027210462 7:76142798-76142820 GGAGGGAGATGCTGGGGGCGAGG - Intergenic
1028985235 7:97004114-97004136 GGAGGGCCAGACTGGGGGCCAGG - Intergenic
1029191934 7:98778128-98778150 GGAGGGGGAGGTGCTGGGCGTGG - Intergenic
1029218522 7:98969793-98969815 GGAGGACGAGTCTGGGGGTGAGG + Intronic
1029497313 7:100902906-100902928 GCAGGGCCAGGGTCGGGGCTGGG + Intergenic
1029535335 7:101154540-101154562 GGAGGGGGAAGCGAGGGGCGTGG + Intronic
1030033533 7:105389129-105389151 GGAGGCGGAGGCCCGGGCCGCGG - Intronic
1030227555 7:107169436-107169458 GGAGGGCGAAGTTCCGGGCCAGG + Intronic
1031689219 7:124766345-124766367 GGGGGGCGAGGGGCGGGGCGGGG + Intergenic
1032013558 7:128361627-128361649 GGGGAGCGAGGCTCGGAGCCAGG - Exonic
1032179710 7:129664153-129664175 GGAGGGAGAGGGTAGGGGAGAGG + Intronic
1032194197 7:129780253-129780275 GGCGGGCGGGGCCCGGGGCGGGG - Intergenic
1032221405 7:129997234-129997256 GGAGGCCGAGGCTGGGGTCCAGG + Intergenic
1032279921 7:130492026-130492048 GGCGGGCTAGGGGCGGGGCGCGG + Intronic
1032298849 7:130668535-130668557 GGCCGGCGGGGCTGGGGGCGTGG - Intronic
1032359894 7:131245516-131245538 GGAGGCCGAGGCCGGGGGCGGGG - Intronic
1032545495 7:132738244-132738266 GGAGGGCGAGGCAGGGGTGGTGG + Intergenic
1032611850 7:133423744-133423766 GGAGGGAGAGGCGCGGGTAGGGG + Intronic
1033099722 7:138460180-138460202 GGAGGGCGGGGGCGGGGGCGGGG + Intergenic
1033644158 7:143288193-143288215 GGAGGGGAAGGAGCGGGGCGGGG - Exonic
1034465736 7:151227380-151227402 GATGCGCGAGGCTCGGGGAGGGG + Intergenic
1034508909 7:151519190-151519212 GGCGTGGGAGGCGCGGGGCGGGG - Intronic
1035021568 7:155803836-155803858 GGTGCGCAAGGCGCGGGGCGGGG + Intronic
1035700978 8:1639147-1639169 GGAGGTCGAGGCTGGAGGTGCGG + Intronic
1035717183 8:1763611-1763633 GGGGGGCGGGGCGCGGCGCGGGG - Intronic
1036379633 8:8228409-8228431 GGAGGGCGGGGCCTGGGGTGGGG - Intergenic
1036614724 8:10379479-10379501 GGAGGGCCTGGCATGGGGCGAGG - Intronic
1036755258 8:11467100-11467122 GGTGGGTGAGGCCCTGGGCGTGG - Intronic
1036803202 8:11808353-11808375 GGAGCGGGAGGCCGGGGGCGGGG + Intronic
1036950338 8:13133552-13133574 GGCGGAGGAGGCGCGGGGCGGGG - Intronic
1037512963 8:19602512-19602534 GGAGCGGGAGGCTCCAGGCGCGG - Intronic
1037886601 8:22599246-22599268 GGAGGGCGAGGGGAGGGGAGAGG - Intronic
1039476447 8:37841619-37841641 GGCGGGCAGGGCCCGGGGCGGGG - Exonic
1039862363 8:41469682-41469704 ACAGGGCGAGGCTGGGGGTGGGG - Intergenic
1039948979 8:42153153-42153175 GGCGCGCGAGGGTCGGGGCGGGG + Intronic
1040593849 8:48819374-48819396 GGAGGGCTGGGCTCGGGCCCCGG + Intergenic
1040604816 8:48921342-48921364 GGCGGGCCAGGCTCGGGCAGGGG + Exonic
1040915889 8:52565741-52565763 GGACCCCGAGGCTCGGGGGGTGG - Intergenic
1041108910 8:54467339-54467361 GAAGGGCGAGGCGCCGGCCGGGG + Intergenic
1041690064 8:60679309-60679331 GCCGGGCGGCGCTCGGGGCGCGG - Intronic
1041714713 8:60922922-60922944 GGAGGTCGAGTCACAGGGCGGGG - Intergenic
1043573557 8:81631181-81631203 TCAGGGCGCAGCTCGGGGCGGGG - Intergenic
1043578569 8:81686391-81686413 GCAGGGCGCAGCTCGGGGCGGGG - Intronic
1043873841 8:85463831-85463853 GGCGGGCGAGTCTCCGGGGGCGG - Exonic
1043954294 8:86342935-86342957 GGACGGCGCGGCGCGGGGCTGGG + Intronic
1044335993 8:90985262-90985284 GGGGGGCGAGGGGCGGGGGGCGG + Intergenic
1044719669 8:95133660-95133682 GGGGCGCGAGGGGCGGGGCGAGG + Intergenic
1045215632 8:100145851-100145873 GGACAGCGCGGCGCGGGGCGGGG - Intergenic
1047259235 8:123241178-123241200 GGAGGGCGAGGCCTGGGGCCCGG + Intronic
1048553910 8:135457377-135457399 GGCGGGCGCGGGGCGGGGCGGGG + Intergenic
1048980328 8:139700012-139700034 GGAGGGCGAGGCTTGGGGCCGGG + Intronic
1049238595 8:141525241-141525263 GGACGGCAAGGCTGGGGCCGGGG + Intergenic
1049361327 8:142213732-142213754 GGAGGGTGAGGCTGTGGGCCTGG + Intronic
1049435837 8:142585845-142585867 GGAGGACGAGGTTGAGGGCGGGG - Intergenic
1049747380 8:144268762-144268784 GGAGGGCGAGGCACAAGGCAGGG + Intronic
1049759985 8:144327558-144327580 GGAGGGCGAGGGCGAGGGCGAGG + Intergenic
1049763780 8:144343513-144343535 GGAGGGTGTGGCCCTGGGCGAGG - Intergenic
1049879362 8:145051907-145051929 GAAGAGCGAGGGTCAGGGCGCGG - Intergenic
1050874026 9:10613110-10613132 GGCGGGCGGGGGCCGGGGCGGGG + Intergenic
1051896929 9:21996652-21996674 GGAGGGGAATGCTGGGGGCGTGG - Intronic
1053435199 9:38069383-38069405 GGGGGGCGGGGCTTGGGCCGCGG - Intergenic
1056154143 9:83817824-83817846 GGCGTGAGAGCCTCGGGGCGGGG + Intronic
1056356358 9:85805273-85805295 GGCGTGAGAGCCTCGGGGCGGGG - Intergenic
1056711331 9:88994236-88994258 GGAGACCGAGGCTGGGGGAGGGG - Exonic
1056711398 9:88994637-88994659 GGAGGCAGATGCTCGGGGCCGGG + Exonic
1056747006 9:89311472-89311494 GGAGGGCGAGGGCCGGGGTTTGG + Intronic
1056998680 9:91487829-91487851 GGAGGGCAGGGCTCAGGGTGGGG - Intergenic
1057041692 9:91853000-91853022 GGAGCGCGAGGTTGTGGGCGGGG + Intronic
1057470097 9:95349569-95349591 GGAGGATGCGGCGCGGGGCGGGG - Intergenic
1057596131 9:96417676-96417698 GGAGGCCGAGGCGGCGGGCGGGG + Exonic
1057773087 9:97984211-97984233 GGCGGGCGCGGCCCGGCGCGCGG + Intronic
1058357018 9:104094543-104094565 GGGAGGCGGGGCGCGGGGCGCGG + Intronic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1059230672 9:112718297-112718319 GTGGGGCGTGGCCCGGGGCGGGG + Intergenic
1060312515 9:122475188-122475210 AGAGGGCGAGGCCAGGGGCAGGG + Intergenic
1060479759 9:124011397-124011419 GGAGGGCGGGGGTGGGGGGGAGG - Intronic
1060758366 9:126228463-126228485 GGAGCCCGAGGCTGGGGGCTGGG + Intergenic
1060947592 9:127579268-127579290 GGAGGGCCAGGCTGGGGTGGAGG - Intergenic
1060977196 9:127771587-127771609 TGAGGGCGTGTCTAGGGGCGTGG - Intronic
1061033661 9:128101694-128101716 GGAGGGGGCGGGGCGGGGCGGGG + Intronic
1061039106 9:128129310-128129332 GGAGGGTCTGGCCCGGGGCGGGG + Intergenic
1061248420 9:129413382-129413404 GGCGGGCGGGGGCCGGGGCGGGG - Intergenic
1061293519 9:129665560-129665582 GGCGGGCGAGGCGCGCGGGGAGG + Intergenic
1061379384 9:130244895-130244917 GGAGGGTGAGGATGGGGCCGAGG - Intergenic
1061453536 9:130681724-130681746 GGAGGGCGAGTCGCGCTGCGGGG - Exonic
1062327265 9:136018244-136018266 GGTGGCTGAGCCTCGGGGCGTGG + Intronic
1062339845 9:136089187-136089209 GCAGGGGGAGGCTCTGGGTGGGG - Intronic
1062405362 9:136393690-136393712 GAGGGGTGTGGCTCGGGGCGCGG - Intronic
1062408635 9:136410334-136410356 GAATGGCGAGGCTCCGGGCTCGG + Exonic
1062468447 9:136691787-136691809 TGAGGCCGAGGCTGGGGGCTGGG - Intergenic
1062580668 9:137227945-137227967 GGAGGGGGAGGGTGGGGGAGGGG + Intronic
1062626014 9:137441745-137441767 GAAGGTCCAGGCCCGGGGCGGGG + Intronic
1062629887 9:137458885-137458907 GAAGAGGGAGGCGCGGGGCGCGG + Intronic
1062646758 9:137551773-137551795 GGAGCGCGCGGGGCGGGGCGGGG - Exonic
1062656052 9:137605179-137605201 GGGGGGCAGGGCTGGGGGCGGGG - Intergenic
1062696200 9:137877615-137877637 GGGGTGGGAGGCGCGGGGCGAGG + Intergenic
1203759693 EBV:5744-5766 GGAGGGCTGGGCCCGGGGCTAGG - Intergenic
1203470346 Un_GL000220v1:113157-113179 GGAGGGAGGGGCACGGGCCGGGG - Intergenic
1203478167 Un_GL000220v1:157129-157151 GGAGGGAGGGGCACGGGCCGGGG - Intergenic
1185778771 X:2828729-2828751 GGCGGGCGAGGGGCGGGGCGCGG + Intergenic
1185778905 X:2829121-2829143 AGAGGCCGAGGCTGGGGGCTGGG + Intronic
1186669969 X:11758227-11758249 GGAGGGCGAGGCTCCGGGGCGGG - Exonic
1187048858 X:15675969-15675991 GGAGTGGGAGGCTGGCGGCGGGG + Intergenic
1189289644 X:39876090-39876112 GGAGTGGGAGGCTGGGGGTGGGG - Intergenic
1190542976 X:51496879-51496901 GGAGGGCGAGGGGCGGGGGCGGG + Intergenic
1190912902 X:54788656-54788678 GGGTGGGGAGGATCGGGGCGGGG + Intronic
1190984467 X:55488620-55488642 CGAGGGCGGGGCTTGCGGCGCGG + Exonic
1192166697 X:68831178-68831200 GCAGGGCGGGGCTGGGGGGGAGG - Intronic
1195275439 X:103276303-103276325 GGAGGGCTTGGTGCGGGGCGGGG - Intronic
1196754531 X:119146684-119146706 AGAGGGTGAGGCTGGGGGCCTGG + Intronic
1197870399 X:131058283-131058305 GCAGGGTGCGGCTCAGGGCGTGG + Exonic
1198767213 X:140091760-140091782 GGAGGGCGAGGCCGAGGTCGCGG + Intergenic
1199600792 X:149540157-149540179 TGCGGGCGGGGCTCGGGGTGGGG - Intergenic
1199600905 X:149540554-149540576 GGAGGGCGGAGCTGGGGGAGGGG - Intronic
1199649483 X:149938875-149938897 GGAGGGCGGAGCTGGGGGAGGGG + Intergenic
1199724758 X:150568915-150568937 GGCGGGCGAAGGTCGGGACGGGG + Intronic
1200084883 X:153599185-153599207 GGGCGGCGAGGGGCGGGGCGGGG - Exonic
1200084893 X:153599205-153599227 GGGCGGCGAGGGGCGGGGCGGGG - Intronic
1200084903 X:153599225-153599247 GGGCGGCGAGGGGCGGGGCGGGG - Intronic
1200100152 X:153686138-153686160 GGAGGCCGAGGCAGAGGGCGAGG - Intronic
1201291031 Y:12421055-12421077 GGAGGGAGAGGTGCAGGGCGTGG - Intergenic
1202272701 Y:23086129-23086151 GGAGGGGGAGGCACGGCGGGGGG - Intergenic
1202293325 Y:23334553-23334575 GGAGGGGGAGGCACGGCGGGGGG + Intergenic
1202425698 Y:24719873-24719895 GGAGGGGGAGGCACGGCGGGGGG - Intergenic
1202445091 Y:24950212-24950234 GGAGGGGGAGGCACGGCGGGGGG + Intergenic