ID: 900360020

View in Genome Browser
Species Human (GRCh38)
Location 1:2283927-2283949
Sequence CCTTCCTGCAGGAGGCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 446}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900360000_900360020 27 Left 900360000 1:2283877-2283899 CCGAGGCAGCAAAGCTGACCCGC 0: 1
1: 0
2: 0
3: 6
4: 131
Right 900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG 0: 1
1: 0
2: 4
3: 41
4: 446
900360008_900360020 9 Left 900360008 1:2283895-2283917 CCCGCTGGCGGGTGGGGGCCACT 0: 1
1: 0
2: 0
3: 11
4: 206
Right 900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG 0: 1
1: 0
2: 4
3: 41
4: 446
900360009_900360020 8 Left 900360009 1:2283896-2283918 CCGCTGGCGGGTGGGGGCCACTG 0: 1
1: 0
2: 1
3: 22
4: 217
Right 900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG 0: 1
1: 0
2: 4
3: 41
4: 446
900360011_900360020 -9 Left 900360011 1:2283913-2283935 CCACTGTGGCGTCCCCTTCCTGC 0: 1
1: 0
2: 2
3: 37
4: 289
Right 900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG 0: 1
1: 0
2: 4
3: 41
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900360020 Original CRISPR CCTTCCTGCAGGAGGCGGGG AGG Intronic
900211027 1:1455965-1455987 CCTGCCTGCAGGTGTCTGGGGGG + Intronic
900223934 1:1524013-1524035 CCTGCCTGCAGGTGTCTGGGGGG + Intronic
900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG + Intronic
900405802 1:2492509-2492531 GCTTCCTGCAGGAGGAGGAGGGG + Intronic
900608325 1:3533704-3533726 CCATCCTGTAGCAGGCGGAGAGG - Intronic
900879168 1:5368217-5368239 CCTTCCTGGAGGATGGGGGTGGG - Intergenic
901433324 1:9231664-9231686 GCTTCTCGCAGGAGGTGGGGAGG - Intergenic
901668407 1:10839422-10839444 CCGTCCAGCAGGAAGCGGGCTGG - Intergenic
901701555 1:11047162-11047184 CCTCCCTGCAGGGTGTGGGGTGG - Intronic
901733717 1:11298854-11298876 CCCTCCTGACGGAGGCGAGGAGG + Intergenic
902550015 1:17213787-17213809 CCTTACCACAGGAGGCGGGCAGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902940805 1:19799393-19799415 CCTTCCTGACGGGGGCGTGGAGG + Intronic
903072325 1:20732431-20732453 GCTTCCCGGAGGAGGCGGTGCGG - Exonic
903280907 1:22249305-22249327 CCTGCCTGCAGGAGGTGCTGGGG - Intergenic
903668581 1:25022442-25022464 CGGCCCTGCTGGAGGCGGGGGGG + Intergenic
903676418 1:25067375-25067397 GCTTCCTGGAGGAGGTGGAGCGG - Intergenic
903839433 1:26227783-26227805 CTTTCCTGCAGGAGCCTGGATGG + Intergenic
904482281 1:30801617-30801639 CCAGCCTGCAGGAGGTGGGATGG - Intergenic
905796184 1:40817980-40818002 TCTTCTTGCAGGAGGCGGAGGGG + Intronic
906091198 1:43181008-43181030 CCTTCCTGAAGGAGGGCAGGGGG - Intronic
906101579 1:43267338-43267360 CATTCCTGAAGGAGGGAGGGAGG + Intronic
906240353 1:44238808-44238830 CTACCCTGCAGGAGGAGGGGAGG + Intronic
906405574 1:45539340-45539362 CCTTCCTGGAGGGGGAGGGGGGG + Intergenic
907357693 1:53889822-53889844 TCTTCCCGGAGGAGGCGGAGAGG - Intronic
907393460 1:54173921-54173943 GCTGCCTGCAGGAGGAGGGAGGG + Intronic
907489367 1:54799350-54799372 CCTTCCTGGAGGAGGTGAGCAGG - Intronic
907666067 1:56434846-56434868 TCTGCCTGCAGGAGGTGGGCAGG + Intergenic
908935045 1:69365013-69365035 GCTTCCTGCTGGAGGTGGAGAGG + Intergenic
909942757 1:81630256-81630278 CTTTCCTGGAGAAGGCTGGGAGG - Intronic
911204713 1:95080604-95080626 CACTCCCACAGGAGGCGGGGAGG - Intergenic
911607428 1:99924237-99924259 CCTTTTTGCAGGAGGCAGAGAGG + Intergenic
912576069 1:110674183-110674205 GCTTCCTGCGGGAGGAGGAGCGG - Exonic
915200056 1:154220727-154220749 CCGCCGTGAAGGAGGCGGGGTGG + Intronic
917345256 1:174022425-174022447 TCCTCCCTCAGGAGGCGGGGCGG + Intergenic
919939704 1:202277843-202277865 GCTTCCTGGGGGAGGTGGGGTGG + Intronic
920108257 1:203569624-203569646 CCTTCCTGCAGAAGAACGGGTGG + Intergenic
920701487 1:208220988-208221010 CCTTCCTGCAGTCTGCGGAGAGG - Intronic
922504371 1:226118116-226118138 CTATCCTGTAGGAGGTGGGGTGG + Intergenic
922724006 1:227914264-227914286 ACTTGCTGCAGAAGGCAGGGAGG + Intergenic
922790421 1:228308027-228308049 GCTTCCTGGAGGAGGGGGCGTGG + Intronic
922795747 1:228338617-228338639 CCTGCCAGCACGAGGCTGGGAGG - Intronic
1063347598 10:5326103-5326125 CCTCACGGCAGGAGGCGGAGGGG - Intergenic
1063382819 10:5596982-5597004 CCTCTTTGCAGGAGGCGGGTGGG - Intergenic
1063444530 10:6102258-6102280 CCTTCCCACAGGTGGTGGGGAGG - Intronic
1063944775 10:11165754-11165776 CCAGCCTGCAGGAGGAAGGGCGG + Intronic
1064143065 10:12806472-12806494 CCTTCCTGCAGCAGCTGTGGAGG + Intronic
1065176330 10:23079763-23079785 GCTTCCTGAAGGAGGCAGTGGGG + Intergenic
1067223672 10:44361823-44361845 CTTTCCTGGAGGAGAAGGGGAGG + Intergenic
1067225816 10:44375069-44375091 CCATCACGCAGGAGGCGGGAGGG + Intronic
1067286795 10:44912871-44912893 CCATCCTGTAGCAGGAGGGGTGG - Intronic
1069618399 10:69820800-69820822 CCTTCCTCCAGCAGGTGGAGCGG + Intronic
1070774087 10:79099766-79099788 CCTTCCTGCCAGAGGAGCGGGGG + Intronic
1070790578 10:79186965-79186987 GCTTCCTGGAGGAGGAGAGGTGG - Intronic
1072249908 10:93573157-93573179 CTTTCCTCCAGGAGGGAGGGAGG - Intronic
1072692919 10:97583558-97583580 CCTGCCTGGAGGGGGCGGGACGG - Exonic
1072781266 10:98253404-98253426 CTTGCCTGCAGGAGGCAGTGAGG - Intronic
1073533707 10:104255313-104255335 GCCTGCTGCAGGCGGCGGGGTGG + Intronic
1074509445 10:114099439-114099461 CCTTCCTTCCCGAGGCAGGGAGG - Intergenic
1074543482 10:114385077-114385099 GCTTCCAGGAGGAGGCAGGGGGG + Intronic
1074592089 10:114822364-114822386 CCCTCCTCCAGGAGCCGGGGCGG + Intronic
1074656188 10:115590629-115590651 TCTTCCTGGAGGAGGCAGGTGGG - Intronic
1074761381 10:116669799-116669821 CCTGCCTGGAGGAGGTGGGCAGG + Intronic
1075699832 10:124462047-124462069 GCTGCCGGCAGGGGGCGGGGCGG + Intronic
1076362455 10:129898846-129898868 CCTTGCTGCGGGAGGCGCAGCGG - Intronic
1076463282 10:130660851-130660873 GCTTCCTGCAGGAGGCCTGTGGG + Intergenic
1076683178 10:132185755-132185777 CCGGGCGGCAGGAGGCGGGGGGG + Intergenic
1076880072 10:133235738-133235760 CCGGGCTGCAGGAGGCGGGGAGG + Intergenic
1076891314 10:133285209-133285231 CTTTCCTGCAAGAGACGTGGCGG + Exonic
1076915137 10:133419654-133419676 CATCCCTGGAGGAGGCAGGGAGG + Intronic
1077102521 11:828470-828492 CCTCCCTGCAGCAGGTGGGAAGG - Intronic
1077102900 11:830078-830100 CCTGCCTGGAGGAGGCGGCCCGG + Exonic
1077182417 11:1222702-1222724 CCTTCCAGCAGGAGCCGCAGTGG + Intergenic
1077321920 11:1946612-1946634 CCCTCTTGGAGGAGGCGTGGTGG + Intergenic
1077380746 11:2236125-2236147 CCGTGCTGCTGGGGGCGGGGAGG - Intergenic
1077423425 11:2463446-2463468 CCTTGGTGCAGGTGGCGGGCGGG + Intronic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1078297509 11:10088679-10088701 CCTTTCTGCAGGGGATGGGGAGG - Intronic
1078508644 11:11969403-11969425 CCTCCCAGCAGGAGGCAGGTAGG + Intronic
1078549929 11:12272972-12272994 CCTTCCTGCTGGAGTTGGTGGGG - Intergenic
1080098030 11:28430357-28430379 CCATCCGGGAGGAGGTGGGGGGG + Intergenic
1081989235 11:47328759-47328781 CCTTCGGACAGGAGGAGGGGAGG + Intronic
1082814856 11:57501091-57501113 CCGTGCTGCAGGGGGAGGGGAGG - Intronic
1083308242 11:61771822-61771844 CTGTCCTGCAGGAGGCCTGGAGG - Exonic
1083733370 11:64665675-64665697 CCTTCCTGCATGGGGAGGAGCGG + Intronic
1083918275 11:65764575-65764597 CCTTCCTGAAGAATGGGGGGTGG - Intergenic
1084273970 11:68042643-68042665 CCTTCCTGCAGGAGGAGGTGCGG + Exonic
1084400692 11:68941249-68941271 TCTTCCTGCAGGGGCGGGGGCGG + Intergenic
1084400840 11:68942063-68942085 GCTCCATGCAGGAGGCTGGGGGG - Intergenic
1084550924 11:69841125-69841147 CCCTGCTGCAGGAGGAAGGGAGG + Intergenic
1084582165 11:70030823-70030845 CCTTCCAGCTGGTGGAGGGGTGG - Intergenic
1084684697 11:70686761-70686783 CCTTCCTCCAGGAAGCAGGGAGG - Intronic
1085332532 11:75666091-75666113 CCTTCCTGCAAGAGGGTGTGGGG - Intronic
1085354445 11:75822905-75822927 CCTTCCTGGAGGATGGGGAGTGG + Intronic
1085445513 11:76598297-76598319 TCTTCATGCAGGAGTCAGGGAGG - Intergenic
1085517608 11:77120695-77120717 TCCACCTGCAGGAGGCGGGAGGG - Exonic
1085561280 11:77474252-77474274 CTCACCTGCGGGAGGCGGGGCGG - Intronic
1089586663 11:119513799-119513821 CCCTCCTGGGGGAGGAGGGGTGG + Intergenic
1090421844 11:126580646-126580668 CCCTCCTGCAGGAGGGGGCCTGG + Intronic
1091235270 11:134017950-134017972 CCTTCCCCCAGGAGGCAGGATGG - Intergenic
1202804936 11_KI270721v1_random:1925-1947 CCCTCTTGGAGGAGGCGTGGTGG + Intergenic
1091451500 12:575176-575198 CCTTCCTGCAGGCGGCTCGAAGG - Intronic
1092113552 12:5981980-5982002 CCTTCCTGCAGGCTGAGGGTAGG + Exonic
1092261586 12:6955919-6955941 CCTGCCTGCTGGTGGTGGGGAGG - Intronic
1092383696 12:8019141-8019163 CCTCCCTGCCGCAGGCGGTGAGG - Intergenic
1096478086 12:51920915-51920937 TCTGCCTGCAGGGGGCTGGGGGG + Exonic
1096517584 12:52165637-52165659 GCTTCCTGGAGGAGGGGAGGAGG - Intergenic
1099884429 12:88509577-88509599 TCTTCCTGCAGGAGACAGGGAGG + Intronic
1099927887 12:89040254-89040276 CCTTCCTCCAGGCGGCCAGGTGG - Intergenic
1101252868 12:102952402-102952424 CATTCTTGGAGGAGGTGGGGAGG + Intronic
1101259264 12:103012571-103012593 CCTCCCTGCCAGAGCCGGGGAGG + Intergenic
1102042255 12:109808464-109808486 GCTTCCTGGAGGAGGTAGGGAGG + Exonic
1102184574 12:110937591-110937613 CCTTCCTGCTGGGGGCCGGTGGG + Intergenic
1102884173 12:116508923-116508945 AATTCCTGCAGGGGGTGGGGAGG - Intergenic
1103589854 12:121983979-121984001 ACTTCCTGAAGGAGGGGGAGCGG - Intronic
1103727266 12:123004340-123004362 CCTTCCTGGGCGAGGTGGGGAGG - Intronic
1103792140 12:123479325-123479347 AATTGCTGCAGGAGGAGGGGTGG + Intronic
1104761066 12:131297822-131297844 CCTTTCTGCAGGGGCCAGGGTGG - Intergenic
1104771200 12:131366018-131366040 CCATCCAGAAGGAGGCGGTGGGG - Intergenic
1104818711 12:131662970-131662992 CCTTTCTGCAGGGGCCAGGGTGG + Intergenic
1104850024 12:131868385-131868407 CCTTCCTGCAGGAGCCAGCCTGG - Intergenic
1104953064 12:132451104-132451126 CCTCCCTGCAGAAGCCGGGCGGG - Intergenic
1105465863 13:20639448-20639470 CCTGCCTGAAGGAGGAGGGAAGG + Intronic
1106483685 13:30155141-30155163 CCTGCCTGCAGGGGGAGGCGGGG - Intergenic
1107430007 13:40332106-40332128 CCTTCCTGGAAGAGGAGAGGTGG - Intergenic
1108363786 13:49691126-49691148 ACTTCCTGCAGCAGGGGGAGGGG + Intronic
1108732681 13:53251292-53251314 ATTTCCTGCAGGAGGTGGGAAGG - Intergenic
1110848581 13:80218308-80218330 TCTGCCTGCAGGAGGGGTGGAGG - Intergenic
1112330883 13:98476243-98476265 CCACTCTGCAGGGGGCGGGGGGG - Intronic
1112693162 13:101917700-101917722 CCTTCCTGCAGCAGAAGGGAGGG - Intronic
1113113395 13:106848644-106848666 CCTTTCTGCAGAGGGTGGGGGGG - Intergenic
1113901471 13:113800626-113800648 CCTTCCTGCAGGAGGGGTCAGGG - Intronic
1114100162 14:19372904-19372926 TCTCCCTGCAGGCGGCGCGGTGG + Intergenic
1114259680 14:21027158-21027180 TCTGCCTGCAGCAGGCTGGGTGG - Intronic
1114530501 14:23392648-23392670 CCTTCCTGCAGGAGAAGGGTGGG + Exonic
1118318108 14:64737795-64737817 GCTGCCTGCAGGAGGACGGGAGG + Intronic
1119572520 14:75688213-75688235 CCTTCCTGGAGGCTGAGGGGTGG - Intronic
1119731915 14:76956535-76956557 CCTCCCTGCAGGAAGCCGGCTGG + Intergenic
1121013767 14:90536168-90536190 GCTTCCTGGAGGAGGTGGGTGGG - Exonic
1121089906 14:91174032-91174054 CCTCCCTGGAGGTTGCGGGGAGG - Intronic
1121453333 14:94023229-94023251 CCTTCCCGCAGCTGGTGGGGTGG + Intergenic
1122324796 14:100875661-100875683 CCCTCCTGCAGGAAGGGAGGGGG - Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1122939211 14:104973746-104973768 CCTTCCTGCAGGGGTGGCGGTGG - Intronic
1123755483 15:23394667-23394689 TCTTCCTGCAGGAGGAAGGGTGG + Intergenic
1124593837 15:31077574-31077596 CCTTCCTGCAGGTGGGAGGGAGG + Intronic
1124964336 15:34422116-34422138 CACTGCTACAGGAGGCGGGGTGG - Intronic
1124980955 15:34568344-34568366 CACTGCTACAGGAGGCGGGGTGG - Intronic
1125517770 15:40332261-40332283 CCATCCTACAGCAGGAGGGGTGG + Intronic
1128109676 15:65068338-65068360 GCTTCCTGGAGGAGGAGGCGGGG - Intronic
1129428488 15:75481470-75481492 CCGTCCGGGAGGAGGTGGGGGGG + Intronic
1129727339 15:77908311-77908333 CGTTCATGCAGCAGGCGGTGAGG - Intergenic
1130895645 15:88168632-88168654 ACTCCCTGCAGGAGGCAGTGGGG - Intronic
1133773644 16:8882255-8882277 ACTTCCTGCAGGAGGAGGGCAGG - Intergenic
1133841674 16:9415788-9415810 CCTGTCTGCAGGTGGCGTGGGGG + Intergenic
1134913624 16:18050978-18051000 CCAGCATGCAGGAGGCTGGGCGG - Intergenic
1136247708 16:28985055-28985077 GCTTCCTGCCGCAGGCGGGCGGG + Intronic
1136278751 16:29194720-29194742 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1136655547 16:31707030-31707052 CCTTCCAGCAGGAGCCAGGTGGG - Intergenic
1137036460 16:35573799-35573821 CCAGCCTCCAGGAGGAGGGGTGG - Intergenic
1137426664 16:48385747-48385769 CCCTCCGGCCGGAGCCGGGGGGG - Intronic
1137665180 16:50245737-50245759 CGCTCCTGCAGGGGGAGGGGAGG + Intergenic
1138762154 16:59557832-59557854 CCTTTCTGTAGGAGGGGGTGGGG + Intergenic
1139949753 16:70663186-70663208 TCTCCCTCCAGGAGGCGGGGCGG - Exonic
1139960937 16:70716915-70716937 CCTTCCTGCAGGAAAGTGGGAGG - Intronic
1140455989 16:75105898-75105920 CCTTCCTGCAAGAGGCGGGAGGG - Intronic
1141054743 16:80804537-80804559 GCTTCCTGCAGGCGGCGCCGGGG - Intergenic
1141064480 16:80902769-80902791 TCTCCCTCCAGGAGGCTGGGTGG - Intergenic
1141127064 16:81408431-81408453 CCAGCCTGCAGGAGTCAGGGTGG - Intergenic
1142008936 16:87704091-87704113 CCTTCCTCCAGAAGGAGCGGGGG - Intronic
1142083142 16:88160801-88160823 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1142137214 16:88456916-88456938 CCTTCCGGAAGGAGCCGGGGAGG + Intronic
1142211550 16:88810979-88811001 GCTTCCTGCAGGAGGTGAGAAGG + Intronic
1142260272 16:89039572-89039594 CCTTGCTGAAGGAGGCGGCCAGG - Intergenic
1142709625 17:1716017-1716039 CCTTCCGGGAGGAGAAGGGGCGG - Intergenic
1142957076 17:3529563-3529585 CCTTCCTGGAGGAGGCTAGAGGG - Intronic
1143010846 17:3865484-3865506 GCTTCCTGTAGGAGGCTGGCGGG - Exonic
1143014838 17:3886209-3886231 GCTCCCTGGAGGAGGCGGGTGGG - Intronic
1143084529 17:4405875-4405897 CATGCCTGCAGGCAGCGGGGTGG + Intergenic
1143724614 17:8836674-8836696 CCTTCCTACAGAAGGTGTGGAGG + Intronic
1144527147 17:15999883-15999905 GCTTCCTGCGGGCCGCGGGGCGG + Exonic
1145206036 17:20985052-20985074 CCGTCCGGGAGGAGGTGGGGGGG + Intergenic
1145224576 17:21117189-21117211 CCCTCCTCCAGCAGGCGGTGGGG - Intergenic
1147559563 17:41500522-41500544 CCTCTCTGCAGGAAGCAGGGAGG + Intergenic
1147609782 17:41794636-41794658 CCTTCCTGGAGGAGGAGGCTGGG - Intergenic
1147904517 17:43814135-43814157 CCTCCCTGGAGCAGGTGGGGAGG - Intronic
1148208190 17:45792633-45792655 GCTTCCTGGAGGAGGAGGTGGGG - Intronic
1148339864 17:46866979-46867001 CCTGCCTGTAGGAGGCCTGGGGG - Intronic
1148476037 17:47929296-47929318 CCTTCCTCCAGGGGTTGGGGAGG - Intergenic
1148564833 17:48626675-48626697 CCTTCCTGCAGCGGGAGGGGGGG - Intronic
1148682787 17:49484265-49484287 CCTGCCTGCAGGGGGCTGTGAGG + Intergenic
1148749811 17:49939023-49939045 TCTGCCTGCTGGAGCCGGGGAGG - Intergenic
1148795428 17:50194622-50194644 CCACCCTGCAGGAGGAGAGGAGG + Exonic
1148872165 17:50664829-50664851 CCTTCCTGCAGAAGCCAGGGAGG + Intronic
1149162558 17:53711545-53711567 CCTTGCTGAAGGGGGTGGGGAGG + Intergenic
1149624394 17:58069846-58069868 CCTTCCTGCTAGAGGCTGAGTGG + Intergenic
1150221435 17:63497721-63497743 TCCTCCTTCAGGAGCCGGGGAGG + Intronic
1151155868 17:72122745-72122767 CCTTCGTGGAGGAGGCGGAGCGG + Exonic
1151351073 17:73532530-73532552 ACTTCCTCCAGGAGCCAGGGCGG + Intronic
1151947317 17:77326773-77326795 CCTACCTGGAGGTTGCGGGGTGG - Intronic
1152170555 17:78744214-78744236 CCTTGCTGCAGGAGATGGAGAGG + Intronic
1152703847 17:81833048-81833070 CCCTCCTGCAGGTGCCGGGCGGG + Intronic
1153952582 18:10069653-10069675 CATTGCTGTAGGAGGCAGGGTGG + Intergenic
1154313540 18:13285539-13285561 GCTTCCTGCAGGAGGCTTCGTGG + Intronic
1154360743 18:13658283-13658305 CATTCCTGAAGGAGGTGGGTCGG - Intergenic
1155182691 18:23361697-23361719 CCATCCTGCAGGAGACGGAAGGG + Intronic
1156451666 18:37269959-37269981 TCTGCCTCCAGGAAGCGGGGCGG + Intronic
1157194054 18:45606054-45606076 CCATCCAGCTGGAGGCGGGGAGG + Intronic
1157934450 18:51857892-51857914 CCTCCTGGCAGGAGGTGGGGAGG - Intergenic
1159021447 18:63146323-63146345 CCTTCTGCCAGGAGGCGGGCTGG - Intronic
1160233491 18:77067208-77067230 CCTCCCAGAAGGGGGCGGGGGGG - Intronic
1160418524 18:78728301-78728323 CCTTCCTGCAGAGTGTGGGGCGG - Intergenic
1160739582 19:679805-679827 CCTTCCCCCAGGAGGCGTCGGGG - Intronic
1160920963 19:1520382-1520404 CCTTCCGGCAGGCGCCAGGGTGG - Intergenic
1160927424 19:1553625-1553647 GCTTCCAGGAGGAGGCGAGGAGG - Intergenic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1161346568 19:3771403-3771425 GCTTCCTGGAGGAGGGGGTGTGG - Intronic
1161395708 19:4043848-4043870 CCTTCCTGGAGGTGGGGGGGGGG - Intergenic
1161565713 19:5000939-5000961 CTTTCCTGCAGGGGGTGGGCAGG - Intronic
1162421753 19:10569353-10569375 CCTTCCCTCAGGAGGCGCCGAGG - Intergenic
1162458932 19:10802980-10803002 CCTTCCTGCCTGAGGCAGGCCGG + Intronic
1162710884 19:12593876-12593898 CCTCTCTGCAGGAGTTGGGGTGG - Intronic
1162901810 19:13799709-13799731 CCTTCCTACAGGTGGAGGAGCGG + Exonic
1163313008 19:16525319-16525341 TCGTCCTGCATGAAGCGGGGCGG + Exonic
1163365891 19:16876005-16876027 GACTCCCGCAGGAGGCGGGGTGG + Intronic
1163416964 19:17192747-17192769 TCTTCCTGAAGGAGACGGAGCGG + Exonic
1163585693 19:18162268-18162290 CCTCCCTGCAGGATGCTGAGTGG + Exonic
1165109867 19:33496036-33496058 CCTTCCTTCAGGAGGGGCTGAGG - Intronic
1166101194 19:40572327-40572349 CCTTCCTGCAGGACCCAGGATGG + Exonic
1167101970 19:47409236-47409258 CCTTCCCTCAGGAGACGGGCTGG - Exonic
1167429885 19:49448089-49448111 GCTTCCTGCAGAGGGCTGGGGGG - Intronic
1167429971 19:49448565-49448587 GCTTCCTGGAGGAGGGGGTGTGG - Intronic
1167617449 19:50543215-50543237 CCTTCATGCAGGTGGCAGCGCGG + Intronic
925133915 2:1513214-1513236 CCTGCCTGCATGAGGAAGGGTGG + Intronic
925225243 2:2178542-2178564 CCTTCCTGCAGAAGGAAGGAGGG - Intronic
925924864 2:8662749-8662771 TCCTCCTCCAGGAGGCAGGGAGG - Intergenic
926169045 2:10539557-10539579 CCTTCCTGGAGGTGGGGGGTGGG - Intergenic
926358738 2:12065402-12065424 CCTCCCTGGAGAAGGCAGGGAGG + Intergenic
926710136 2:15872699-15872721 CCATCCTGGTGGAGGCGGGCTGG + Intergenic
928364421 2:30690373-30690395 CCTTCCTGCAGGCAGAGGTGAGG + Intergenic
928454525 2:31407119-31407141 CCTTCCTAAAGGAGAAGGGGAGG + Intronic
929712037 2:44275486-44275508 CCTTCCTGCAGTAAGGGAGGTGG - Exonic
929822701 2:45286175-45286197 CCGACCTGCAGCAGGCTGGGAGG + Intergenic
929960286 2:46491015-46491037 CCTTGGTGGAGGAGGTGGGGAGG + Intronic
932174124 2:69584121-69584143 CTTTCTTGAAGGAGGCGGGTGGG - Intronic
932480466 2:72036109-72036131 GCTTCCTGCAGGGGGTGGGTTGG + Intergenic
932780234 2:74554701-74554723 CCCTGCGGCGGGAGGCGGGGCGG - Exonic
933632323 2:84672147-84672169 TCTTCCTGCAGGGGCCTGGGTGG + Intronic
933735156 2:85488285-85488307 CTGTCCGGGAGGAGGCGGGGGGG + Intergenic
934975873 2:98801883-98801905 TGTTCCTGCTGGAGGAGGGGTGG + Intronic
937438914 2:121900693-121900715 GCTTCCTGGAGGAGGAGGTGAGG + Intergenic
937906476 2:127055179-127055201 CCTTCATGGTGGAGGCCGGGTGG - Intronic
938153749 2:128909937-128909959 CCTCACTGAAGGAGGCTGGGGGG - Intergenic
938555038 2:132416589-132416611 CCGAGCTGCGGGAGGCGGGGTGG - Exonic
938595543 2:132784006-132784028 CCTGCCTGGAGGGGGCGGAGGGG + Exonic
939203057 2:139063066-139063088 CCTTCCTGGAGGTGGGGGGGGGG + Intergenic
941858511 2:170254417-170254439 CTTTCCTGCGGGACTCGGGGGGG + Intronic
942018169 2:171838801-171838823 TGATCCTGCAGGAGGCAGGGTGG + Intronic
943347532 2:186757131-186757153 CCTTCCTGGAGTATGAGGGGTGG + Intronic
944615059 2:201451646-201451668 CCTTCGAGCTTGAGGCGGGGCGG - Intronic
945201869 2:207289869-207289891 GCTTTCTGCAAGAGGTGGGGTGG + Intergenic
945319635 2:208406752-208406774 CCTTCCCGCCGCAGGCGGCGCGG + Intronic
946396600 2:219446471-219446493 CCTCCCTGCAGGTGGCTGGCTGG + Intronic
947062247 2:226180189-226180211 CCTTTCAGAAGGAGGCTGGGGGG - Intergenic
947528469 2:230893825-230893847 CCTTACAGCAGGAGGGTGGGAGG + Intergenic
947799743 2:232921325-232921347 CCTGCCTGCTGCAGGCTGGGAGG + Intronic
947862383 2:233369892-233369914 CCTTCCTGCAGGGGAAAGGGAGG - Intronic
948048510 2:234961854-234961876 AGTTCCTGGAGGAGGTGGGGTGG + Intronic
948137248 2:235645681-235645703 CCTTCCTGCAGAGGGAGGTGGGG + Intronic
948194361 2:236084210-236084232 CCTTCCTGAAGGGCGGGGGGGGG + Intronic
948356461 2:237381671-237381693 CTTTCCTCCAGCAGGTGGGGAGG - Intronic
948875159 2:240822597-240822619 ACTGCCTGCAGGGAGCGGGGCGG + Intergenic
948989152 2:241543045-241543067 GCTGCCTCCAGGAGGCTGGGCGG - Intergenic
949074108 2:242044384-242044406 CCTTCCTGCAGGATGCAGCACGG + Intergenic
1168757294 20:326187-326209 CGTTCGTGCGGGAGGCGGAGCGG + Exonic
1168766073 20:382024-382046 CCTGGCTGCGGGGGGCGGGGCGG + Intronic
1168782935 20:510034-510056 CCATACTGCAGGAGGTGGAGGGG + Intronic
1168944291 20:1738736-1738758 CCTCCCTGCAGAGGGTGGGGGGG + Intergenic
1169788975 20:9389472-9389494 CTTTTCTGCATGAGGTGGGGAGG + Intronic
1169906662 20:10611525-10611547 CCTTCCAGCAGGGGGAGGTGAGG + Intronic
1171110832 20:22480699-22480721 TCTTCCAACAGGAGGTGGGGTGG + Intergenic
1171449549 20:25226009-25226031 CCTTCCTGCAAGAGTCTGGGAGG + Exonic
1172573612 20:35989515-35989537 GCTTCCTGGAGGAGGTGAGGTGG + Intronic
1173201760 20:40959953-40959975 CCTCCCTGCAGGAGGAGGGGAGG + Intergenic
1173223187 20:41145994-41146016 CCATCCTGGGGGAGGCAGGGAGG + Intronic
1174548699 20:51345483-51345505 CCTGCCTGCTGGAGGCGTGGTGG + Intergenic
1175480733 20:59308916-59308938 CCGTCCTGCAGGGGACAGGGTGG - Intronic
1175482961 20:59324427-59324449 CCTTCCTGAAAGAGGCAGCGGGG - Exonic
1175547687 20:59789184-59789206 TCTTCCTGCAGGGTGCAGGGAGG + Intronic
1176019343 20:62954575-62954597 CCATCCTGCTGGGGGCGCGGGGG - Intronic
1176187631 20:63789843-63789865 CCTTCCTGCCGACGTCGGGGTGG - Exonic
1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG + Intergenic
1177178072 21:17719636-17719658 CCGTCCTGAAGGAGGTGGGGGGG - Intergenic
1179029191 21:37705068-37705090 CCTGACTGCAGGAGGCAGGCAGG - Intronic
1179416006 21:41199316-41199338 CCCTCCAGAAGGAGGCAGGGAGG - Intronic
1179584782 21:42367615-42367637 CCTCCCTGCAGCAGACGGGAGGG + Intergenic
1179595261 21:42438856-42438878 ACGTCCTGCAGGAGGTGGGCAGG + Intronic
1179749739 21:43460999-43461021 GCTTCCTCCAGGAGGCTGGGTGG - Intergenic
1180798372 22:18619200-18619222 GCTTCCTGCATGAGGCAAGGAGG + Intergenic
1181223346 22:21376065-21376087 GCTTCCTGCATGAGGCAAGGAGG - Intergenic
1181255394 22:21559561-21559583 GCTTCCTGCATGAGGCAAGGAGG + Intronic
1181419140 22:22785784-22785806 CCTGCCTGCAAGAGGCGCTGGGG - Intronic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1181477188 22:23176000-23176022 CCTGCCTGCGTGAGGCTGGGTGG - Intergenic
1181483088 22:23213338-23213360 CCTCCGTGCAGGAGTCGGGCTGG + Intronic
1181848571 22:25733192-25733214 GCTTCCTGCAGAAGGCAGGAGGG + Intergenic
1182295094 22:29307639-29307661 CCTTCCCGCAGGACATGGGGTGG + Intronic
1183120012 22:35723046-35723068 CCCTCCTGGAGGAAGCGGGAGGG - Intronic
1183321211 22:37166269-37166291 CCTCTCGGCAGGAGGTGGGGGGG - Intronic
1183348451 22:37320622-37320644 GCTTCCTGCAGGAGGAGAGCTGG - Intergenic
1185367704 22:50444509-50444531 TCGGCCTGCAGGAGCCGGGGTGG + Intronic
950197091 3:11016958-11016980 CCTTCCTCCAGGAGCAAGGGCGG + Intronic
950661149 3:14467779-14467801 GCTTCCTGGAGGAGGCAGCGAGG - Intronic
950727158 3:14923848-14923870 TGTTCCTGCAGGAGGGAGGGAGG + Intronic
951534499 3:23728910-23728932 CCTCCTTGCAGGAGGAGGTGTGG + Intergenic
954541811 3:51398114-51398136 CCTTCGTGCCAGAGGTGGGGAGG - Intronic
954781266 3:53063091-53063113 CCACCCTGGTGGAGGCGGGGCGG + Intronic
956953199 3:74306494-74306516 CCTTCCTGCTTGAGGAGGTGGGG - Intronic
959419375 3:106111935-106111957 CCATCCGGGAGGAGGTGGGGGGG - Intergenic
959419395 3:106111982-106112004 CCATCCGGGAGGAGGTGGGGGGG - Intergenic
960943135 3:122947476-122947498 CCATCCTGCAGGAGTGGGTGGGG - Intronic
961521055 3:127467550-127467572 CCTGCCTGCAGCAGGCGAGCGGG - Intergenic
961820212 3:129572028-129572050 GCTTCCTGGAGGAGGTGGGATGG - Intronic
962259529 3:133894327-133894349 CCTTCCTACAGGTGGCAGAGGGG + Intronic
963938299 3:151076520-151076542 GCAACCTGAAGGAGGCGGGGAGG - Intergenic
964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG + Intronic
966415850 3:179688692-179688714 CCTTCCTGCATGATGCCGGAAGG - Intronic
966809473 3:183830509-183830531 GCTTCCTGGAGGATGTGGGGTGG + Intronic
966928259 3:184659445-184659467 CCTTCCTGCAGCCGCCTGGGGGG + Intronic
967469849 3:189848962-189848984 CCTTCCTGGAGGCTGGGGGGTGG - Intronic
967784154 3:193471859-193471881 CATTCCTGCAGGGGGCTGGGTGG + Intronic
968229103 3:196994175-196994197 GCTTCCTGCTGGAGTCTGGGGGG + Intronic
968462737 4:733390-733412 CCTCACTGCAGGAGGAGAGGAGG + Intronic
968521787 4:1037512-1037534 GCTGCCTGCAGGAGGCTGGTCGG - Intergenic
968521807 4:1037592-1037614 GCTGCCTGCAGGAGGCTGGTCGG - Intergenic
968609609 4:1551082-1551104 CCTTCCCCCTGGAGACGGGGTGG - Intergenic
968642495 4:1721590-1721612 CCTTCCTGGCGGCGGCGGCGCGG + Exonic
968662064 4:1802774-1802796 GCTGCCTGGAGGAGGCGTGGAGG - Intronic
968734441 4:2288145-2288167 GCTTCCTGGAGGAGGCGGCCTGG + Intronic
968765880 4:2468906-2468928 CCTTCCGGCAAGAGACGGCGCGG - Intronic
969556719 4:7916598-7916620 CACTCCTGCAGGAGGGGGAGGGG - Intronic
970407671 4:15778847-15778869 CGTGCCCGCGGGAGGCGGGGGGG + Intronic
970541800 4:17087639-17087661 GGTTCCTCCAGGATGCGGGGAGG + Intergenic
971160730 4:24130973-24130995 ATTTCCTGCAGGAAGCGGGTGGG - Intergenic
972330179 4:38057115-38057137 TCTTCCTGCAGGAGATTGGGTGG - Intronic
972686667 4:41359701-41359723 CCTTCCTGCAGGTGGTTAGGGGG - Intronic
973026370 4:45277314-45277336 CCTTACTGTAGGAGGGTGGGAGG - Intergenic
973703392 4:53558254-53558276 CCCTCCTGCAGGATGCGGACTGG + Intronic
975176906 4:71299766-71299788 CCTTCCTGCATGAGAGTGGGAGG + Intronic
981231120 4:142356852-142356874 CCTTCCTGCAGGATGAGGGCTGG - Intronic
982575935 4:157110063-157110085 CCTCCCTGAAGGTTGCGGGGTGG + Intronic
984823775 4:183906472-183906494 CCGGCCGGGAGGAGGCGGGGAGG - Exonic
985251801 4:188031910-188031932 CCTTTCCGCAGGAAGCGAGGAGG - Intergenic
985393363 4:189514918-189514940 CCCTGCTGCAGGAGGGGGGGGGG - Intergenic
985523598 5:390823-390845 CCTGGATGCAGGAGGCCGGGAGG + Intronic
985629739 5:1008391-1008413 CCTTCCAGCCGGGGCCGGGGGGG + Intergenic
985669750 5:1201236-1201258 CCCACCTGCAGGACGCCGGGTGG - Intergenic
985963344 5:3320433-3320455 CCAGCCTTCAGGAGGCAGGGTGG + Intergenic
986464945 5:8011785-8011807 GCTTCTTGCAGGAGGGAGGGAGG - Intergenic
989421214 5:41241195-41241217 CCTTGCTGCTGGAGGCGGGGTGG + Intronic
991975392 5:72179544-72179566 CTTTCCTGCGGCAGGCGGGCGGG - Intronic
991977766 5:72199741-72199763 CTTTCCTCCTGGAGGCGGTGGGG - Exonic
991999125 5:72418047-72418069 CCCTCCTGCAGGAGCAGGGATGG + Intergenic
992094069 5:73344106-73344128 CCTCCCTGCAGGAGGCTGCTTGG - Intergenic
992744891 5:79809887-79809909 GCTTCCAGCAGGAGCCAGGGTGG - Intergenic
993646874 5:90473838-90473860 CCATCCTGCAGGATGAGGGTGGG + Exonic
994094320 5:95835141-95835163 ACTTCCTGGAGGCGGCGGCGAGG - Intergenic
994164623 5:96595902-96595924 GCTTCCTGGAGGAGGTGGCGTGG + Intronic
995552438 5:113294591-113294613 CATTGCTGCAGGAGGCTCGGTGG + Intronic
996143319 5:119941972-119941994 CCATCCTTCAGGATGAGGGGTGG + Intergenic
997215163 5:132103936-132103958 CCTTTCTGCAGTGGGTGGGGGGG - Intergenic
997615025 5:135240314-135240336 GCTTCCTGGAGGAGGCTGGGTGG + Intronic
998406762 5:141878527-141878549 CCTCCCGGCCGGAGGGGGGGCGG - Intronic
999288552 5:150408520-150408542 CCATCCTGCAGGGGGTGGGCAGG + Intronic
999421513 5:151448328-151448350 GTTTCCCGCAGGAGGCGGTGTGG - Intronic
999763668 5:154722245-154722267 CCTCCCTGCAGGAGGAGGTAGGG - Intronic
1001037926 5:168311232-168311254 CCTTCCTGCTGGAAGTAGGGAGG - Intronic
1001129213 5:169049643-169049665 ACTCCCTGCAGGATGCCGGGCGG + Intronic
1002571145 5:180140019-180140041 CCTTTCTGAAGGAGGCCAGGAGG + Intronic
1002682393 5:180976973-180976995 ACTTCCTGCTGGGGGGGGGGTGG + Intergenic
1005805256 6:29468477-29468499 CCCTCCTGCAGGATACAGGGAGG - Intergenic
1006386780 6:33735396-33735418 CCTTCCTGCACCAGGTCGGGGGG - Exonic
1006502959 6:34469673-34469695 CCTTCCTGCAGGTGGCTCTGTGG + Intronic
1006517228 6:34551810-34551832 GCTGGCTGGAGGAGGCGGGGAGG - Intronic
1007274221 6:40661602-40661624 CCTTCCTGCAGTGGGAGGGAGGG + Intergenic
1007308191 6:40923528-40923550 CTGGCCTACAGGAGGCGGGGCGG - Intergenic
1007700841 6:43765700-43765722 GCTTCCTGCAGGAGGTGGCTTGG - Intergenic
1009675207 6:66811108-66811130 CCTTCCTGCAGGATCAGGAGAGG + Intergenic
1010142153 6:72623248-72623270 CCGCGCTGCAGGGGGCGGGGAGG + Intronic
1010206063 6:73323474-73323496 CTTTCCTGCAGGAGGGTGGGAGG - Intergenic
1011076365 6:83443718-83443740 CATTCCTGGAGGAGGTGGCGTGG + Intergenic
1013422347 6:109978362-109978384 GCTGCCTGCAGGAGGCGGCCGGG - Exonic
1013466979 6:110426490-110426512 CCTCCCTCCAGGAGGAGGGAGGG - Intronic
1014831248 6:126105283-126105305 CCTCCCAGCAAGAGACGGGGTGG + Intergenic
1017907895 6:158769362-158769384 CCCTCCTGGAAGAGGCGCGGAGG - Exonic
1017913309 6:158813540-158813562 CCCTCGTGGAGGAGGAGGGGTGG + Intronic
1018212830 6:161498623-161498645 CCTTCCTTCAGGAAGCAGGATGG - Intronic
1018967241 6:168498592-168498614 CCTTCCTGCTGCAGGCTGAGTGG + Intronic
1019277837 7:185155-185177 AGTTCCTGCCGGAGTCGGGGAGG - Intergenic
1019483598 7:1277347-1277369 CCTTCCTACTGGGGGGGGGGAGG - Intergenic
1019542221 7:1556499-1556521 CCGGGCTGCAGGAGGAGGGGTGG + Intronic
1019636269 7:2077671-2077693 CCGTTCTGCAGGAGGCGCGCGGG + Intronic
1020023946 7:4885343-4885365 CCTTCCTGGGGTAGGCGAGGAGG - Intergenic
1020087720 7:5320526-5320548 AGTTGCTGCAGGAGGCGGTGAGG - Exonic
1020106594 7:5424973-5424995 CCTCCCTGGAGGGGGCGCGGCGG - Intronic
1020248542 7:6449254-6449276 CCACCCTGCAGCTGGCGGGGTGG + Intronic
1022247596 7:28575571-28575593 CCTTCCTGCTGGAGACAGCGGGG + Intronic
1022324667 7:29320344-29320366 CCCCCCTGCAGGGGGCGAGGGGG - Intronic
1022363479 7:29685452-29685474 CCTTCCTGCTGGAGACAGCGAGG - Intergenic
1022427809 7:30285073-30285095 CCTTCCTGCTGGAGCCAGCGAGG + Exonic
1022467889 7:30663634-30663656 CCTTCCCAAAGGAGGCAGGGAGG + Intronic
1022697895 7:32728286-32728308 CCTTCCTGCTGGAGCCAGCGAGG + Intergenic
1022860299 7:34360294-34360316 CCCTCCTGCAGGAGGAGAGCCGG + Intergenic
1023682669 7:42703448-42703470 CCTTCCTGGAAGAGGCAAGGAGG + Intergenic
1023844475 7:44113117-44113139 CCTTCATGGAGCAGGTGGGGTGG + Exonic
1023972182 7:44999909-44999931 CTCTCCTGAAGGACGCGGGGCGG + Intronic
1025898201 7:65723215-65723237 CCCTCCTGCAAGAGGCTGAGTGG - Intergenic
1026380216 7:69792010-69792032 CATTCCTGCAGGATGGTGGGTGG + Intronic
1026823786 7:73568441-73568463 CCTGCCTGCAGGATGGGGGGTGG - Intergenic
1026882923 7:73919068-73919090 GCTTCCTGGAGGAGGCGGAGTGG + Intergenic
1026930371 7:74220199-74220221 CCTTCCTGCAGGGAGGGGGAAGG - Exonic
1027151009 7:75733640-75733662 GCTTCCTGGAGGAGGCTGGCAGG + Intronic
1027249471 7:76389993-76390015 GCTTCCTGGAGGAGGAAGGGAGG + Exonic
1031986348 7:128166935-128166957 CCTCCCTGGAGGAGGTGCGGGGG + Intergenic
1033496887 7:141907846-141907868 ACTTCTTGCAGGAGGCTGTGTGG + Intronic
1033756556 7:144401553-144401575 CCTGGCTGCAGGACCCGGGGAGG - Exonic
1034135513 7:148764466-148764488 CCTTCCTGCAGGGGCTGAGGGGG - Intronic
1034557601 7:151859984-151860006 CCCACCTGCAGGTGGCGGAGAGG - Intronic
1034638449 7:152585539-152585561 CCTTCCGGGAGGAGGTGGGGGGG - Intergenic
1034850003 7:154484614-154484636 ACATGCTGCAGGGGGCGGGGAGG - Intronic
1034958302 7:155349668-155349690 GCTTCCTGCGGGAGGGGGGCGGG - Intergenic
1035106270 7:156444011-156444033 CCTTACAGCAGGGGGCGGGGAGG + Intergenic
1035270796 7:157718893-157718915 GCCACCTGCAGGAGGCGGAGAGG - Intronic
1036477107 8:9103328-9103350 GCTTCCTGGAGGAGGTGAGGTGG - Intronic
1036629098 8:10497761-10497783 TCTGCCTGCAGGAGGAGGAGAGG - Intergenic
1040550287 8:48432191-48432213 GCTTCCTGGAGGAGGAGGGCAGG + Intergenic
1040552266 8:48446627-48446649 CCTTGTTGCTGGAGCCGGGGAGG + Intergenic
1041107844 8:54459097-54459119 CCTTCGTGGAGGAGGCAGAGCGG + Exonic
1041220705 8:55648454-55648476 CCTTGCTGCCGGTGGCAGGGCGG + Intergenic
1041471271 8:58212031-58212053 CCTCTCTGCAGGGGGCGGTGGGG - Intergenic
1042929373 8:73998028-73998050 CCTTCCTGCAGGATGGGAGGTGG + Intronic
1044660689 8:94590936-94590958 CCGTCCGGGAGGAGGTGGGGGGG + Intergenic
1045582661 8:103498813-103498835 CCCTCCCGGAGGGGGCGGGGCGG - Intergenic
1047847893 8:128826069-128826091 CCGTCCGGTAGGAGGTGGGGGGG - Intergenic
1047889556 8:129292797-129292819 CCTTCAGGCAGGAGGTGGTGTGG - Intergenic
1049107886 8:140624987-140625009 CCTTCCTGGAGGAGGCTGCTGGG - Intronic
1049199708 8:141334091-141334113 ACTTCCTGGAGGAGGAGGGCTGG + Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049562109 8:143317085-143317107 GCTTCCTGGAGGAGGCGCCGAGG - Intronic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1049814207 8:144590660-144590682 CCAGCCTGCAGAAGGCTGGGGGG + Intronic
1053122477 9:35557316-35557338 CCTTCCTCCAGGACGCGAAGGGG + Intronic
1053489605 9:38488805-38488827 CCTTCCCGCAGGAGGTGGGCTGG - Intergenic
1054496155 9:65824997-65825019 GCTGCCTGCCGGGGGCGGGGGGG - Intergenic
1055369436 9:75581306-75581328 CCTTCCTGCTGGGGGAGGAGGGG - Intergenic
1056002376 9:82230832-82230854 CTTTGCTGCAGGAGGCAGTGAGG - Intergenic
1056289699 9:85130259-85130281 CCTTCCTCCAGGAGGCTGTTGGG - Intergenic
1057669948 9:97078113-97078135 CCTTCCCGCAGGAGGTGGGCTGG - Intergenic
1058861374 9:109120144-109120166 TCTTCCTGGAGGGGGGGGGGGGG + Intergenic
1059408664 9:114118319-114118341 CCTTCCTGCATAAGGCTTGGCGG + Intergenic
1059427338 9:114229397-114229419 CCTTCCTCCAGGAGCCAGGGAGG + Intronic
1059427461 9:114230210-114230232 CCTTCCAGCAGGAGCCAGGCAGG - Intronic
1059433078 9:114261351-114261373 CTTCCCTCCAGCAGGCGGGGCGG + Intronic
1059438182 9:114288859-114288881 CCATCCTGCAGAGGGCTGGGAGG - Intronic
1060819370 9:126652428-126652450 CCTTCCTGCAGGTGGGGGTGCGG + Intronic
1061061547 9:128253149-128253171 CGTTCATGCAGCAGGCGGTGAGG - Intronic
1061084374 9:128390584-128390606 GCTTCCTGCAGGAGGTGGGAAGG - Exonic
1061152827 9:128838448-128838470 CCTTCCAGCAGCAGGCCTGGGGG + Intronic
1061328965 9:129880397-129880419 CCTTCCTGGAGGATGTGGGAGGG + Exonic
1061486569 9:130923452-130923474 TCTTCCAGCAGGGGGTGGGGCGG - Intronic
1061865097 9:133488026-133488048 CCTTCCTGTAGCAGGCAGGATGG - Intergenic
1061951441 9:133938497-133938519 CCTGCATGCAGGAGCCGGGCTGG - Intronic
1061972571 9:134052944-134052966 CCATCCTGCAGGAGCCAGTGAGG + Intronic
1062101906 9:134732914-134732936 CCTGCCTGCCGGCGGCGGGGCGG - Intronic
1062164630 9:135101345-135101367 CCTTCCTGCAGTAAGCCTGGAGG + Intronic
1062212041 9:135370418-135370440 GCTTCCTACAGGGGGTGGGGCGG + Intergenic
1062471958 9:136710020-136710042 CCCTCCTGCAGGAGGAGGACAGG + Intergenic
1062525688 9:136977242-136977264 CCTGCCAGCAGGAGGAGGGTGGG + Intergenic
1062722951 9:138053828-138053850 ACAGCCTGCAGGAGGAGGGGTGG - Exonic
1185703431 X:2248731-2248753 CCTTCCTTCTGGGGGTGGGGTGG - Intronic
1186785111 X:12949895-12949917 CTTTCCTGCAGGAAGGGGGTAGG - Intergenic
1187279440 X:17846686-17846708 CCTGGCTGCAGGGGGAGGGGAGG + Intronic
1189141666 X:38613589-38613611 CCTTCCTGCAGGAGACTTGAAGG - Intronic
1189160724 X:38805622-38805644 CGTACGTGCAGGAGGCGCGGTGG + Exonic
1189336844 X:40175595-40175617 CCAACCTGCAGGAGGGAGGGGGG + Intronic
1197529574 X:127606331-127606353 CCTTCCTTCAAGAGGTGGTGTGG + Intergenic
1197923174 X:131617824-131617846 CAATCCTGCAAGAGGCTGGGTGG + Intergenic
1198084366 X:133268453-133268475 CCTGGCTGCAGGAGGAGGGCTGG - Intergenic
1199996186 X:153028220-153028242 CCTTGCTGCAGGAGTCTGGGTGG + Intergenic
1200120847 X:153789862-153789884 GCTTCCTGGAGGAGGTGCGGGGG - Intronic
1201179732 Y:11333055-11333077 CCCTTCTGGAGGAGCCGGGGCGG - Intergenic