ID: 900363677

View in Genome Browser
Species Human (GRCh38)
Location 1:2301785-2301807
Sequence TTGCTGCCTCCTCTTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 235}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900363671_900363677 -9 Left 900363671 1:2301771-2301793 CCCACCGCCCGACTTTGCTGCCT 0: 1
1: 3
2: 0
3: 11
4: 99
Right 900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 235
900363670_900363677 -8 Left 900363670 1:2301770-2301792 CCCCACCGCCCGACTTTGCTGCC 0: 1
1: 0
2: 2
3: 10
4: 132
Right 900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 235
900363664_900363677 25 Left 900363664 1:2301737-2301759 CCAAGGCTTCCTGGCTGAGGGCA 0: 1
1: 0
2: 3
3: 38
4: 350
Right 900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 235
900363668_900363677 16 Left 900363668 1:2301746-2301768 CCTGGCTGAGGGCAAGGGCGGAG 0: 1
1: 0
2: 3
3: 29
4: 339
Right 900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 235
900363661_900363677 28 Left 900363661 1:2301734-2301756 CCACCAAGGCTTCCTGGCTGAGG 0: 1
1: 1
2: 1
3: 37
4: 395
Right 900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 235
900363672_900363677 -10 Left 900363672 1:2301772-2301794 CCACCGCCCGACTTTGCTGCCTC 0: 1
1: 0
2: 1
3: 8
4: 150
Right 900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 235
900363669_900363677 -7 Left 900363669 1:2301769-2301791 CCCCCACCGCCCGACTTTGCTGC 0: 1
1: 0
2: 1
3: 10
4: 161
Right 900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG 0: 1
1: 0
2: 2
3: 43
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900363677 Original CRISPR TTGCTGCCTCCTCTTGAGGT TGG Intronic
900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG + Intronic
900852575 1:5155689-5155711 TTGCTGCATCCTCCAGAGGAAGG + Intergenic
902223183 1:14979736-14979758 ATCCTGCCTCCTCTTGAACTTGG + Intronic
902722926 1:18316105-18316127 GTGATGCCTCTGCTTGAGGTTGG - Intronic
904009028 1:27379569-27379591 CTGCTGCCTCCTCTCGAGGCAGG - Exonic
904579401 1:31529787-31529809 TTTCTGACTCCTCTGAAGGTGGG - Intergenic
905122732 1:35694305-35694327 TTGCTGTGTTCTCTTGTGGTAGG - Intergenic
906614932 1:47227510-47227532 CTGCAGCCTCCTCTGGAGCTTGG + Intronic
906814703 1:48866975-48866997 GTGCTGCCTCCTCTTGACTATGG - Intronic
907418518 1:54330779-54330801 TTGCTGCCTGGTTTTGACGTGGG - Intronic
909591256 1:77351747-77351769 TTGCAGCCTCCCCTGAAGGTAGG - Intronic
911182446 1:94873222-94873244 GTGCTGCATCCCCTTGAGGAGGG + Intronic
911643365 1:100312719-100312741 TTTCTCTCTCCTCTTGAGCTGGG + Intergenic
914690328 1:150020159-150020181 TAGCTGCCTACTTTTAAGGTAGG + Intergenic
915916147 1:159942080-159942102 TTGTTGCCTCCTCTTCAGAGGGG - Intronic
915923847 1:160001040-160001062 TTTCTGCCTCCTTTGAAGGTAGG - Intergenic
916658889 1:166902602-166902624 ATGCTGGTTCCTCTTGTGGTCGG - Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
918413692 1:184286292-184286314 TTGTTTCCTCCTCTTGGGTTGGG + Intergenic
922609879 1:226918601-226918623 TTACTGCCTCCTCCTGTGCTTGG + Intronic
924491660 1:244544146-244544168 TGGCTGCATCCTCTTCAGGAAGG + Intronic
1067076772 10:43191992-43192014 TTGATTCTTCATCTTGAGGTGGG + Intergenic
1068345787 10:55776171-55776193 TTGCTGCCACCACTTGAAGAAGG + Intergenic
1074927831 10:118091815-118091837 TTCCTGCCTCCTTTTTAGGCAGG - Intergenic
1075318740 10:121472480-121472502 TTGCTGCCTCTTCTGGAAGGAGG - Intergenic
1075795177 10:125115095-125115117 CTGCTGCCTCCTCTTGAGGCTGG + Intronic
1078858315 11:15224692-15224714 TCTATGCCTCCTCCTGAGGTGGG + Intronic
1079333265 11:19550693-19550715 TTGCCCACTCCCCTTGAGGTAGG + Intronic
1080107480 11:28525938-28525960 TAGCTGCCTCCCCTTGGGGCAGG - Intergenic
1081466914 11:43328723-43328745 TTTCTGCCTCTTCTGGAGGGAGG - Exonic
1084941109 11:72613828-72613850 TTCCTGCCTCCTGTTCCGGTGGG + Intronic
1091858383 12:3757020-3757042 TTGCTGCCTCCTCTGGGGTGGGG + Intronic
1092712442 12:11353294-11353316 TTGCTGCCTCCTTGTGCGGGTGG + Exonic
1092716180 12:11393014-11393036 TTGCTGCCTCCTTGTGGGGGTGG + Exonic
1092716232 12:11393200-11393222 TTGCTGCCTCCTTGTGGGGGTGG + Exonic
1095396488 12:41768115-41768137 TTGCTTTGTCCTCTTGAGCTGGG - Intergenic
1098153326 12:67571245-67571267 TAGCTTCCTCCTCTTGAGTCTGG + Intergenic
1098230403 12:68367228-68367250 TTGCTGCTGCCTTTGGAGGTTGG - Intergenic
1099111839 12:78571843-78571865 TTGCTGCCTCCTTGTCAGTTGGG - Intergenic
1102666478 12:114578277-114578299 TTGCTTTCTCTGCTTGAGGTGGG + Intergenic
1103029983 12:117605330-117605352 ATCCTCCCTCCTGTTGAGGTTGG - Intronic
1103155853 12:118684377-118684399 TTGCTGTCTCTGCTTGAGCTGGG - Intergenic
1103854271 12:123954849-123954871 GTGCTCCCTCCTCCTGGGGTGGG - Intronic
1105846951 13:24301634-24301656 TTCCTGCCACCTCGGGAGGTAGG + Intronic
1105954823 13:25271166-25271188 TCTCTGCCTCCTTTTCAGGTAGG + Intronic
1106110927 13:26776222-26776244 TTGCTGCATCATCCTGTGGTGGG - Intergenic
1106130244 13:26933708-26933730 TTGCTGTGTCCTCATGGGGTGGG - Intergenic
1106190651 13:27449978-27450000 TTGCTGCCTGCTGTTGCGGGAGG - Intronic
1108379156 13:49840240-49840262 TTTCAGCCTCCTCTATAGGTGGG - Intergenic
1109591103 13:64483781-64483803 TTGCTCCCTCCTCTTGAATCTGG + Intergenic
1111074546 13:83216508-83216530 TTGCTCCCTCCCCTTGATTTGGG + Intergenic
1112887944 13:104196754-104196776 TTGCTGCCTCCGTGTGATGTAGG - Intergenic
1113039716 13:106091460-106091482 TTTATTCCTCCTCTTGAGCTTGG - Intergenic
1114492245 14:23110440-23110462 TTTCAGCCACCTCATGAGGTAGG + Intergenic
1114850716 14:26379509-26379531 TTCCAACCTCCTCTTGAAGTGGG + Intergenic
1115167815 14:30469389-30469411 TTGCTCTCTCTTCTTGAGCTGGG + Intergenic
1116396604 14:44454522-44454544 TTTCTGCCCCTTTTTGAGGTTGG - Intergenic
1118716501 14:68563830-68563852 TTTTTACCTCCTCTTGAAGTTGG + Intronic
1118736008 14:68702460-68702482 GTCCTGCTTGCTCTTGAGGTTGG + Intronic
1119126233 14:72129852-72129874 GTGGTGCCTCATCATGAGGTGGG - Intronic
1120225095 14:81782001-81782023 TTGCTCTCTACTCATGAGGTCGG - Intergenic
1120328137 14:83054717-83054739 TTGCTACCTCCTTTTGGAGTTGG - Intergenic
1120414431 14:84201411-84201433 TTTCTACCTCCTCTTGAGTGTGG - Intergenic
1121027148 14:90625011-90625033 TTGCTGCCTCCTGTCCAGATCGG + Intronic
1202839060 14_GL000009v2_random:103487-103509 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1202894850 14_GL000194v1_random:1185-1207 GTGATGCCCCCTCTTGAGGAGGG + Intergenic
1202908427 14_GL000194v1_random:93578-93600 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1202884817 14_KI270722v1_random:95746-95768 TTGTTGCCTTCTCCTGAGTTTGG + Intergenic
1124356518 15:28999212-28999234 TTTCTATCTGCTCTTGAGGTGGG + Intronic
1124413812 15:29458217-29458239 TTGCTGTCTCTACTTGAGTTGGG - Intronic
1126336515 15:47591149-47591171 TTGCTGCATCCTCATGAGGTGGG + Intronic
1126412897 15:48390061-48390083 TTGCTGACTCATCTTGAAATTGG + Intergenic
1128239960 15:66095144-66095166 ATGCTGCAGCCTCCTGAGGTGGG + Intronic
1128551829 15:68602669-68602691 TTATTGCCCCCCCTTGAGGTAGG + Intronic
1129188627 15:73925186-73925208 TAGTTGCCTCCTCTCTAGGTGGG + Intergenic
1129219172 15:74121540-74121562 TTCCTGCCTCATCTTGGGGTTGG - Intronic
1130550040 15:84884537-84884559 TTGCTGCCTCATCTGGTGGTGGG - Intergenic
1131036085 15:89222845-89222867 TTGCAGCCTGCTCTGGAGGAAGG - Intergenic
1132120976 15:99175107-99175129 CTGCTGCCTCCACTTGAGAGGGG + Exonic
1132194609 15:99903489-99903511 TTGCTGTCTCTTCTGGAGCTGGG + Intergenic
1133660002 16:7907112-7907134 TTACTGTCTCCACTTGAGCTGGG + Intergenic
1134359745 16:13520177-13520199 CTGCTGTTTCCTCTTGATGTGGG - Intergenic
1135387594 16:22057310-22057332 ATGCTGCATCCTCCTGAGGGAGG + Intronic
1135511740 16:23090678-23090700 TCGCTGCCTGCTCTTGATGTGGG + Exonic
1136567629 16:31079703-31079725 TTGCTGCCTCCTTCTGGGATGGG - Exonic
1136603937 16:31318880-31318902 TTGCTGCCTCCCATTAAGTTTGG + Intronic
1138276277 16:55737229-55737251 TTCCTGCCTCCTCCAGAGCTTGG - Intergenic
1138282205 16:55780579-55780601 TTCCTGCCTCCTCCAGAGCTTGG - Intergenic
1138286739 16:55816055-55816077 TTCCTGCCTCCTCCAGAGCTTGG + Intronic
1138418044 16:56882514-56882536 TGGGTGCCTCCTCCTGAGGTGGG - Intronic
1141289546 16:82704977-82704999 TTGCTGCTGCCTCATGAGGAAGG + Intronic
1141328870 16:83089573-83089595 TTGGTGCCTGCTCTGGAGGTGGG + Intronic
1143510149 17:7390820-7390842 TGGCTGCCTCCTCCTCAGCTGGG - Intronic
1144920902 17:18763629-18763651 TTGATGCTTCCGCTTCAGGTAGG - Intronic
1146485641 17:33240411-33240433 TGGCTGCCTTTTGTTGAGGTTGG + Intronic
1147438442 17:40432047-40432069 GTGATGCCTCCTCATGTGGTGGG + Intergenic
1148566351 17:48635215-48635237 TTGGTGCCTTTTCTTGGGGTTGG - Intergenic
1150536011 17:66041872-66041894 TTACTCCCTGCTCTTGAGGGTGG - Intronic
1151704147 17:75757916-75757938 TACCTGCCTCCTCTAGAGGTGGG - Intronic
1152779485 17:82219915-82219937 CCCCTGCCTCCTCTTGAGCTGGG - Intergenic
1155220191 18:23678171-23678193 GTGCTGTCTCTTCTTGAGCTGGG - Intergenic
1155324142 18:24649253-24649275 TTGCTGCATCCTCTGGAGGGAGG + Intergenic
1157777331 18:50405996-50406018 TTACAGCCACCTGTTGAGGTAGG - Intergenic
1159650208 18:70969499-70969521 TTGCTGTCTCTGCTTGAGCTGGG - Intergenic
1159651994 18:70988500-70988522 TTGCTGCATCCTCTGGAGGGAGG + Intergenic
1160339336 18:78074301-78074323 TTGCTGGCTTTTCTTAAGGTTGG + Intergenic
1160571051 18:79818006-79818028 GTGCTGCCTCCTCGCCAGGTGGG + Intergenic
1161146748 19:2683473-2683495 TTCTTACCTGCTCTTGAGGTAGG + Intronic
1161453104 19:4357568-4357590 GTGATGCCTCCTCCCGAGGTAGG + Exonic
1161586618 19:5109192-5109214 TTCCCCCTTCCTCTTGAGGTTGG + Intronic
1162345080 19:10114116-10114138 CTGCTGCGGCCTCTTCAGGTGGG - Exonic
1164916295 19:32054877-32054899 CTGCTGCATCCTCTGGAGGGAGG + Intergenic
1165105462 19:33467217-33467239 TAGGAGCCTCCTCTTGAGGGAGG + Intronic
1167563030 19:50237913-50237935 TTGCCTCCTCCTCTTGAATTGGG - Intronic
1168471423 19:56643482-56643504 TTCCAGCCTCCTCGTGAGGAGGG + Intronic
1202633976 1_KI270706v1_random:27069-27091 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1202651904 1_KI270707v1_random:12944-12966 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1202660227 1_KI270708v1_random:62774-62796 TTGTTGCCTTCTCCTGAGTTTGG + Intergenic
927827030 2:26316265-26316287 TTGCTGCCACCTGGTGAGGAAGG - Exonic
928256555 2:29728019-29728041 TTGCTACCTTCTCCTGTGGTGGG - Intronic
928431568 2:31223078-31223100 TTTCTGGCTGCTCTGGAGGTTGG - Intronic
929808358 2:45168753-45168775 TTGCTGCCTCCTCTCGGGCTTGG + Intergenic
929889556 2:45907773-45907795 CTGCTGCCTCCTTCTGAAGTGGG + Intronic
930308772 2:49711656-49711678 TTTCAGCCTCCTTTGGAGGTAGG + Intergenic
932166796 2:69515156-69515178 TTGCTTCATCCTGTTCAGGTAGG - Intronic
932538968 2:72630870-72630892 TTGCTACTTCCTCCTGAGATTGG - Intronic
933423624 2:82083482-82083504 TTGCTTTCTCTTCTTGAGCTGGG + Intergenic
933793687 2:85903674-85903696 TTGGTGTCCCCTCCTGAGGTTGG + Intergenic
934612459 2:95751395-95751417 CTGCAGCCTCCTCTTGGGGAAGG + Intergenic
934841693 2:97628049-97628071 CTGCAGCCTCCTCTTGGGGAAGG - Intergenic
935622041 2:105138533-105138555 TTGCTGTCTCTTCTTGAACTGGG - Intergenic
936248983 2:110852773-110852795 ATTCTGCTTCCTGTTGAGGTTGG + Intronic
938841452 2:135168818-135168840 GTGCTGCCTCCTCCTGAGGGAGG + Exonic
940305426 2:152220905-152220927 TTGCTCTCTCTTCTTGAGCTGGG - Intergenic
940822683 2:158374566-158374588 TTGCAGCATCCTCTTCAGTTTGG - Intronic
941091603 2:161182826-161182848 TTGCTGCATACTCTGGAGGAAGG - Intronic
942438029 2:176002226-176002248 CTGCTGCCTGCTCTGGAGGCAGG - Exonic
943831702 2:192472239-192472261 GTGCTGCCTGCAGTTGAGGTAGG - Intergenic
945479046 2:210323161-210323183 ATGCTGCTTCCCCTGGAGGTGGG + Intergenic
946351920 2:219160818-219160840 ACCCTGCCTCCTCTTGCGGTGGG - Exonic
947665639 2:231903853-231903875 ATGCTGCATCCTCTAGAGGGAGG + Intergenic
947677659 2:231998243-231998265 TTGCTGCATCATCCTGTGGTGGG + Intronic
948675918 2:239596637-239596659 TTCCTCCTTCCTCATGAGGTAGG - Intergenic
949014324 2:241701378-241701400 TTGCTGCCACCTCTCGAGGCAGG - Intergenic
1172062063 20:32193443-32193465 TCTCTGCATCATCTTGAGGTGGG - Exonic
1174871089 20:54183016-54183038 TAGCTGGCTCCTCTTGTGGTTGG + Intergenic
1175973604 20:62699317-62699339 TTGCCGCGTCCTCCTGCGGTGGG - Intergenic
1176104953 20:63381588-63381610 CTCCTGCCTCCTCTTGAGTCAGG + Intergenic
1176614547 21:9017172-9017194 GTGATGCCCCCTCTTGAGGAGGG + Intergenic
1176627786 21:9108241-9108263 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1176646189 21:9352850-9352872 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1176710655 21:10146702-10146724 GTGATGCCCCCTCTTGAGGAGGG - Intergenic
1179192055 21:39131688-39131710 TTGCTTCCTCCCCTTGAGTATGG - Intergenic
1180207958 21:46274034-46274056 CTTCAGCCTCCTTTTGAGGTGGG - Intronic
1180327710 22:11446365-11446387 TTGTTGCCTTCTCCTGAGTTTGG + Intergenic
1180366726 22:11946147-11946169 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1180379356 22:12125059-12125081 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1180418127 22:12787828-12787850 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1182449855 22:30413186-30413208 TCTCTGCCTGCTCTTGAGCTCGG - Intronic
1184164005 22:42716808-42716830 TTGCTCCTTCCCCTTCAGGTGGG - Intronic
1185009525 22:48305439-48305461 TTGCTGCCTCCTCTGAGGGACGG + Intergenic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
1185417488 22:50718240-50718262 TAGATGCTGCCTCTTGAGGTTGG + Intergenic
949495662 3:4629298-4629320 TTCCTGGCTCTTCTTGAGCTAGG + Intronic
949760342 3:7463660-7463682 TTGCTGGCTTCTCTTGTAGTAGG - Intronic
950401745 3:12774304-12774326 TTGCTGCCTGTGCTTGAGCTGGG - Intergenic
950452267 3:13072104-13072126 TGGCTGAGTCCTCTTGAGCTGGG - Intronic
950517137 3:13474758-13474780 CTGCTGCCTTCTCCTGAGGAGGG - Intergenic
953019488 3:39104560-39104582 TTGCTGCCTCCTCATGGGAAAGG + Intronic
954754980 3:52834253-52834275 TTGCTGCCTGCTCTGTGGGTGGG - Intronic
957093997 3:75760516-75760538 TTGTTGCCTCCTCCTGAGTTTGG - Intronic
962998148 3:140651603-140651625 TAGCTGCCTCCTCATGGGGCAGG + Intergenic
965208686 3:165755870-165755892 TTGGTGCCTCTTATTGAAGTGGG + Intergenic
965214593 3:165846004-165846026 TTGCTCTCTCTTCTTGAGCTGGG + Intergenic
965547362 3:169930265-169930287 TTGCTACCACTTCTTGGGGTAGG - Intronic
966891778 3:184412446-184412468 TTCCTCTCTCCTCTTGAGCTGGG - Intronic
967226806 3:187299684-187299706 TTGCTGTCTCTTCTGGAGCTGGG + Intergenic
967867302 3:194200908-194200930 TCACTTCCACCTCTTGAGGTGGG + Intergenic
1202740695 3_GL000221v1_random:52206-52228 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
968970594 4:3791566-3791588 TTGCTGATTCCTCTGGGGGTTGG + Intergenic
970161434 4:13193252-13193274 TTGCTTCCTCTTCTTGAGCTGGG + Intergenic
970640284 4:18057145-18057167 TTGCTGCCTCCTCCTCTGGAAGG + Intergenic
971094412 4:23383979-23384001 TTCCTGCTGCCTCTTGAGTTTGG - Intergenic
971252789 4:24987088-24987110 TAACTGCCTCACCTTGAGGTTGG + Intergenic
973032852 4:45365623-45365645 TTGCTGCATCCTCTTGGGGGAGG + Intergenic
973363662 4:49189461-49189483 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
973397418 4:49607280-49607302 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
973832937 4:54780061-54780083 TTTCTGCCTCTTCTGGAGATAGG - Intergenic
974272263 4:59665838-59665860 TTACAGCCTCCCCTTCAGGTAGG + Intergenic
974756926 4:66221615-66221637 TTGCTGCCTCCTTTAGGGGTAGG + Intergenic
976248053 4:83023241-83023263 TTGCTGCCGCCTTGTGAAGTAGG + Intergenic
976367568 4:84247219-84247241 TCTCTGCATCATCTTGAGGTGGG + Intergenic
976727736 4:88231154-88231176 TTCCTGCCTGCTCTTGGGGCAGG + Intronic
979511344 4:121557276-121557298 TTGCTGCCTCCATGTGAGGAAGG + Intergenic
979887307 4:126045345-126045367 TTGCTCCCTCTCCTTGAGCTAGG + Intergenic
981651030 4:147059295-147059317 ATGCTGCCTCCTATGGAGGGAGG - Intergenic
983258682 4:165431601-165431623 TTGCTGCTTCCTGATGAGTTTGG + Intronic
1202760976 4_GL000008v2_random:110542-110564 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
988318959 5:29668578-29668600 TTGCAGCCTCCTCATGAGTAAGG + Intergenic
989836976 5:46005823-46005845 CTGCTGCCTCATATTAAGGTTGG - Intergenic
997553034 5:134770324-134770346 TTTCTGCCTCCTCAGTAGGTAGG + Intronic
997820650 5:137062841-137062863 TTGCTTCATACTCTTGAGGCTGG + Intronic
998044442 5:138975163-138975185 TGGCTCCCTCCTCTGAAGGTTGG + Intronic
999551997 5:152699352-152699374 TTGCTCCCACCCCTTGAGGATGG + Intergenic
999626067 5:153521542-153521564 TTGCTGCCTTCCCTTGAGTCTGG + Intronic
999809704 5:155115797-155115819 TTGCTGCCCACTCTTTGGGTTGG + Intergenic
1000596819 5:163224213-163224235 GAGATGCCTCCTCTTGAAGTAGG - Intergenic
1002360990 5:178670694-178670716 ATGCTGCCTCCTCTTCATGTGGG + Intergenic
1007308373 6:40924966-40924988 ACGCTGGCTCCTCCTGAGGTTGG - Intergenic
1008614967 6:53217922-53217944 TGGCTGCCTCCTCTTCACTTGGG - Intergenic
1009968338 6:70601267-70601289 TTGCTGCCTCTTCTGGAGCTGGG + Intergenic
1010193293 6:73214892-73214914 TTGCTGCCTCACCTGGAGGGAGG - Intronic
1013278813 6:108614849-108614871 TTCTTGCCTTCTCTTGAGTTAGG + Intronic
1017024132 6:150166704-150166726 CTGCTTCCTCCTCCTGAGGCAGG - Intronic
1017159636 6:151352588-151352610 ATACTGCCTCCTCTTGACCTAGG - Exonic
1017173023 6:151475721-151475743 TTGCTGCATCTTCTGGAGGAGGG + Intergenic
1017228907 6:152051473-152051495 TTGACGCCTCCTCTTGACCTGGG + Intronic
1019285888 7:222678-222700 GTGCTGCCTCCCCTTGTGCTGGG - Intronic
1019524072 7:1472903-1472925 GTGCTTCGTCCCCTTGAGGTGGG + Intronic
1019566651 7:1684545-1684567 GTGCTGCCTTCTTTTGAGCTAGG + Intergenic
1019622525 7:1999585-1999607 TTCCTGTCTCCTCCTGAAGTGGG - Intronic
1019733374 7:2639114-2639136 TTGTTGCTTCCTCTGGAGGAGGG + Intronic
1023833180 7:44052203-44052225 TTGCTCCGTGCTCTTGAGGGTGG + Intronic
1026033903 7:66817358-66817380 TTGGTGCCTGCTCTGGCGGTGGG + Intergenic
1026236810 7:68534493-68534515 CTGCTGCTCACTCTTGAGGTTGG - Intergenic
1026519563 7:71104757-71104779 TTGTTGCCTTCCCTAGAGGTGGG + Intergenic
1029610137 7:101622383-101622405 TTGCTCCCTTCTCATGAGGCTGG - Intronic
1033564293 7:142563645-142563667 ATGCAGCCTCCTCTTAAAGTTGG + Intergenic
1033849207 7:145474065-145474087 TTGATGTGTCCTCTTGATGTAGG + Intergenic
1034922911 7:155098633-155098655 TTGCTGTCTCTTCTGGAGGGAGG + Intergenic
1036586782 8:10131760-10131782 TCGCTGCCTCTTCCTGAGCTGGG + Intronic
1036619443 8:10415021-10415043 CTGCTGCTTCCTCTTGATTTGGG - Intronic
1038751254 8:30298045-30298067 ATGCTGCATCCTCTGGAGGGAGG - Intergenic
1039956856 8:42214432-42214454 TTGCAGCCTCCTATGGAGGATGG + Intergenic
1042083175 8:65078122-65078144 TTCCTGTCTCTGCTTGAGGTAGG + Intergenic
1043164136 8:76882329-76882351 TTGCTCTATCTTCTTGAGGTGGG + Intergenic
1045406863 8:101875310-101875332 CTGTTGCCTCCTGTTGAGGAGGG - Intronic
1045714120 8:105021604-105021626 TTGCTGCATCCTCTGGAGAAAGG - Intronic
1049648002 8:143745139-143745161 TTCCAGCCTCCTCTTCAGTTTGG + Intergenic
1050975244 9:11929035-11929057 TAGCTGCCTCCTCATGGGGCAGG - Intergenic
1051336827 9:16073204-16073226 TTGCTGCCTCCTCCCCAGGATGG + Intergenic
1052084710 9:24250128-24250150 TTCCTGCCACCTCGTGAAGTAGG - Intergenic
1053459651 9:38258419-38258441 ATGCTGCATCCTCTGGAGGGGGG + Intergenic
1053647641 9:40132398-40132420 GTGATGCCCCCTCTTGAGGAGGG - Intergenic
1053758090 9:41331445-41331467 GTGATGCCCCCTCTTGAGGAGGG + Intergenic
1054328618 9:63730352-63730374 GTGATGCCCCCTCTTGAGGAGGG - Intergenic
1054536938 9:66243772-66243794 GTGATGCCCCCTCTTGAGGAGGG + Intergenic
1054777741 9:69138239-69138261 TAGCTTCTTCCTCTTGAGTTTGG + Intronic
1055305876 9:74928487-74928509 TTGCTGCATACTCTGGAGGAAGG - Intergenic
1056033985 9:82584443-82584465 TTCCTGCCTCCTATTGTGGTAGG - Intergenic
1056035601 9:82601448-82601470 TTGCTGCCTCATCTTGAACTAGG - Intergenic
1056131133 9:83587539-83587561 TTGCTTCCAGCTCTTGATGTGGG - Intergenic
1056232329 9:84559332-84559354 TTGCTGCCTGCCCTGGTGGTGGG + Intergenic
1057737483 9:97677848-97677870 TTGCTGCCTCCTCTTCTGGAGGG - Intronic
1058111791 9:101038671-101038693 TTGTTCCCTCTTCTTGATGTGGG - Intronic
1058578926 9:106433793-106433815 TTGCTGACTCCTCTTCACATTGG - Intergenic
1059613835 9:115927452-115927474 TTCCTGCCACCTTTTGAGGAAGG + Intergenic
1060134278 9:121136644-121136666 TTGCTGTCTCCTTTTAGGGTTGG + Intronic
1060383077 9:123195177-123195199 TAGTTGCCTTCTCTTGAGGGAGG - Intronic
1202795415 9_KI270719v1_random:115690-115712 GTGATGCCCCCTCTTGAGGAGGG - Intergenic
1203750632 Un_GL000218v1:75920-75942 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1203483360 Un_GL000224v1:28428-28450 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1203709337 Un_KI270742v1:82143-82165 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1203541746 Un_KI270743v1:95426-95448 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1185992745 X:4910547-4910569 TTGCTCTCTCTTCTTGAGCTAGG + Intergenic
1186167756 X:6844937-6844959 TTGCTTTCTCTTCTTGAGCTGGG - Intergenic
1188230439 X:27656560-27656582 GTGCTGCCTAATCTGGAGGTAGG + Intronic
1189201515 X:39200002-39200024 TTGCTGTCTCTTGTTGAGTTGGG + Intergenic
1190518081 X:51245558-51245580 TTCCTTCCTTCTCTTGAGTTTGG - Intergenic
1191058502 X:56269278-56269300 TTGCTGCCACTTCTTAAGGTGGG + Intronic
1192344367 X:70289250-70289272 TGGATTCCTCCTCATGAGGTGGG - Exonic
1192509333 X:71712663-71712685 TTGGTGCCTCATCTAGAAGTGGG - Intergenic
1192517364 X:71768890-71768912 TTGGTGCCTCATCTAGAAGTGGG + Intergenic
1198301659 X:135339467-135339489 TTGCTGCCTCTTGTTGGTGTGGG + Intronic
1198388758 X:136152355-136152377 TTGCTGCTTACTCTAAAGGTAGG + Intronic
1200153762 X:153964426-153964448 TTGCTGCCTTCTTCTGAGGTGGG + Intronic
1201164289 Y:11193597-11193619 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1202272643 Y:23085898-23085920 TAGCTGCCTCCCCGTGCGGTAGG - Intergenic
1202293383 Y:23334784-23334806 TAGCTGCCTCCCCGTGCGGTAGG + Intergenic
1202425640 Y:24719642-24719664 TAGCTGCCTCCCCGTGCGGTAGG - Intergenic
1202445149 Y:24950443-24950465 TAGCTGCCTCCCCGTGCGGTAGG + Intergenic