ID: 900364497

View in Genome Browser
Species Human (GRCh38)
Location 1:2305565-2305587
Sequence ATTTTAATGGGGAGAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 374}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900364497 Original CRISPR ATTTTAATGGGGAGAGTGGG GGG Intronic
900364497 1:2305565-2305587 ATTTTAATGGGGAGAGTGGGGGG + Intronic
900685924 1:3947637-3947659 ATTTTTTTGGGGGGAGTGGATGG - Intergenic
901610342 1:10493221-10493243 TGTTTACTGGGGTGAGTGGGTGG + Intronic
901613840 1:10521278-10521300 ATTTTATTAGGGAAAATGGGAGG - Intronic
901905607 1:12406922-12406944 ATTTTAATGGTCAGAGTGAGAGG + Intronic
902320634 1:15662332-15662354 ATTTTAATAGGGCGAGCAGGAGG + Exonic
902655603 1:17865933-17865955 GTTGTAACGGGGAGAGTGGGCGG - Intergenic
904707257 1:32400917-32400939 ATTCTAATGGGGTGGGTAGGGGG - Intergenic
904912301 1:33944488-33944510 ATTTTAATGGGGAAGGGTGGAGG - Intronic
905802524 1:40854318-40854340 ATTTTAGTGGGGGGCGGGGGCGG - Intergenic
906820198 1:48921154-48921176 ACTGTAATGGGGAGAGGGGGAGG + Intronic
907320306 1:53597770-53597792 ACTTTAATAGGGAGGGTGTGGGG + Intronic
907933592 1:59022126-59022148 ATTTTAATTGGGAAAGGGGCTGG + Intergenic
908645241 1:66271381-66271403 ACTTTCAAGGGGAGGGTGGGTGG - Intronic
909395797 1:75169477-75169499 GTGTGAATGAGGAGAGTGGGCGG + Intergenic
911858488 1:102913852-102913874 ATTTTTTTGCGGAGAGTGAGAGG - Intronic
912567835 1:110601180-110601202 AGTTTAATGGGGAGAGAGTTTGG + Intronic
912770533 1:112460290-112460312 ATTTTGTTGGGAAGAGGGGGTGG + Exonic
915527750 1:156486504-156486526 ATAGTAAAGGGGAGAGAGGGAGG - Intronic
916457052 1:164981804-164981826 AGTTTTTTGGGGGGAGTGGGGGG - Intergenic
917184915 1:172342602-172342624 ATTTGAGGGTGGAGAGTGGGAGG + Intronic
918338973 1:183551690-183551712 ATTTTTATGGGGAGTGGGGTTGG + Intronic
918513447 1:185336569-185336591 ATTTGATTGGGAAGAGAGGGAGG + Intergenic
919239651 1:194896266-194896288 ACTTGAGTGGGGAGAATGGGAGG - Intergenic
919997062 1:202761950-202761972 ATTGTATTGGGGAGAGGGGGTGG + Intronic
922017750 1:221669081-221669103 ATTTGAATGGGGAGGGAGGTAGG - Intergenic
922137902 1:222850587-222850609 ACTTGATGGGGGAGAGTGGGAGG - Intergenic
922207150 1:223458046-223458068 ACTTGAGTGTGGAGAGTGGGAGG - Intergenic
922303268 1:224322034-224322056 ATTTCAATGGAGTGAGTGGCGGG + Intronic
922977687 1:229798933-229798955 ACTAGAAAGGGGAGAGTGGGAGG + Intergenic
924612209 1:245583025-245583047 ATTTTCAGGGGGTGAGTAGGGGG - Intronic
924715370 1:246567844-246567866 TTTTTTAAGGGGAGAGGGGGAGG - Intronic
1063228138 10:4035177-4035199 ATTTAAAAGGGAAAAGTGGGAGG - Intergenic
1064915916 10:20458087-20458109 ATATTGATGGGGAGAGGGAGGGG - Intergenic
1067277545 10:44848658-44848680 ATCTTGATGGAGAGAGTGAGAGG - Intergenic
1069410584 10:68149219-68149241 ATTTTTCGGGGGGGAGTGGGAGG - Intronic
1070262797 10:74873690-74873712 ATTTTAGGGGAGAGAGAGGGAGG + Intronic
1071274796 10:84043635-84043657 ATCTTAATAGGGAAAGTGTGGGG - Intergenic
1073436768 10:103521730-103521752 AGTTTCATTGGGAGAGTAGGTGG + Intronic
1074029621 10:109673247-109673269 CTCAGAATGGGGAGAGTGGGAGG + Intergenic
1074379765 10:112969745-112969767 AGGTTAATGGAGACAGTGGGAGG - Intronic
1075730891 10:124636197-124636219 ATTTTAATATGGAGATGGGGTGG - Intronic
1075795581 10:125117206-125117228 ATTGTAACGGGGGCAGTGGGGGG + Intronic
1077675252 11:4189233-4189255 ATTTTTATAGGGGTAGTGGGAGG + Intergenic
1078254568 11:9646987-9647009 ATTTTGATGGAGAGAGTGGAGGG + Intergenic
1079272594 11:19002782-19002804 ACTTGAGTGGGGAGAGTGGGAGG - Intergenic
1079928924 11:26532989-26533011 AATTTAATGGGGAAAGAGGCAGG + Intronic
1081060380 11:38467608-38467630 ACTTGAGTGTGGAGAGTGGGAGG + Intergenic
1082688086 11:56264392-56264414 ATTTCACTGGGGATAGTGGGTGG - Intergenic
1083018512 11:59481791-59481813 ATGTTACTGGGGAGGGTGGAAGG + Intergenic
1083125928 11:60565469-60565491 ATGTTAATGGGGAGGGGGTGGGG + Intergenic
1083314730 11:61807450-61807472 ATTTTGATGGGGAGAATTAGGGG - Intronic
1083495253 11:63046569-63046591 ACTTGAAGGTGGAGAGTGGGAGG + Intergenic
1085167508 11:74416415-74416437 TTTTTAGGGGGGAGGGTGGGGGG + Intergenic
1086453500 11:86939772-86939794 TTTTTAAAGGGGTGGGTGGGGGG + Intronic
1087291536 11:96326090-96326112 ATTTTAATGGGGGGGGGGCGGGG - Intronic
1087870005 11:103281483-103281505 ATTGTAATAGGAAGAGTGTGTGG + Intronic
1087999840 11:104864514-104864536 ATTGTAGTGTGGAGAGTGGGAGG - Intergenic
1088381567 11:109199069-109199091 TTTTTAATGGAGAGAATGGAAGG - Intergenic
1088625504 11:111727505-111727527 ATTTTGATGGGGAGCAAGGGGGG + Exonic
1089808129 11:121109908-121109930 ATTTTACTGGGGAGAGAGGGAGG - Intronic
1090176958 11:124658703-124658725 ATTTGAATGTGAAGAGTGGTAGG + Intronic
1091678773 12:2511210-2511232 TTTTTAATTGGGAGAATGTGGGG - Intronic
1092139215 12:6171364-6171386 ATATTAATGGGGGGGGGGGGAGG + Intergenic
1093765839 12:22961493-22961515 ATTGGAATGGGGAGAGAGAGTGG + Intergenic
1093800123 12:23362833-23362855 ATTTAGATGGGGGGTGTGGGTGG + Intergenic
1094457410 12:30652594-30652616 ATTCTAATGGGGATGATGGGAGG - Intronic
1095677716 12:44938786-44938808 ATTTGAGGGTGGAGAGTGGGAGG - Intergenic
1098578625 12:72072336-72072358 ATTTTCTTGGAGAGAGAGGGAGG - Intronic
1098643007 12:72861111-72861133 AGTCTAATGGAAAGAGTGGGGGG + Intergenic
1098772422 12:74569714-74569736 ATCATTGTGGGGAGAGTGGGTGG - Intergenic
1099689169 12:85928206-85928228 ACCTGAATGGGGAGGGTGGGAGG - Intergenic
1100251546 12:92829995-92830017 ATTTTTAGGGAGAGTGTGGGGGG + Intronic
1101719912 12:107342247-107342269 ATTTTTTTGGGGGGAGGGGGTGG + Intronic
1104345289 12:127991210-127991232 AGTTTAAGGGGCAGAGGGGGAGG + Intergenic
1104554453 12:129787117-129787139 ATTATAATGAGGAGGGTGAGTGG - Intronic
1105718763 13:23093358-23093380 AGTTTAAAGGTAAGAGTGGGAGG - Intergenic
1105977117 13:25482006-25482028 TCTTTAATGGGAAGGGTGGGTGG - Intronic
1106885989 13:34184549-34184571 ATTGTCATGGGAACAGTGGGAGG - Intergenic
1106963554 13:35031794-35031816 ATTTGAAGGTGGAGGGTGGGAGG - Intronic
1107871786 13:44753300-44753322 AATTTAAGGGGCACAGTGGGAGG + Intergenic
1110762481 13:79245733-79245755 ATTTGAAGGGAGAGAGTAGGTGG + Intergenic
1110867629 13:80414517-80414539 ACTTGAATGAGGAGATTGGGAGG + Intergenic
1111979403 13:95001465-95001487 ATCTAAATGGGGAGAGATGGGGG - Intergenic
1112320007 13:98397060-98397082 ATTTTAATGGGAAGAATTTGGGG + Intronic
1113409366 13:110071148-110071170 AATTTGATGGGTAGAGTGAGGGG - Intergenic
1115204440 14:30886892-30886914 ATTTTTTTGGGGAGAGACGGGGG + Intronic
1116130621 14:40852365-40852387 ATTGGAAAGTGGAGAGTGGGAGG - Intergenic
1117514080 14:56482944-56482966 TTTTAAAAGGGGAGAGAGGGAGG - Intergenic
1118548209 14:66918589-66918611 GAATTAATGGGGAGAGAGGGAGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119276492 14:73361608-73361630 ACTTGAGTGGGGAGGGTGGGAGG - Intronic
1120560518 14:85986796-85986818 AGTTGAAGGTGGAGAGTGGGAGG - Intergenic
1122262948 14:100533494-100533516 ATTTTATTGGGAAGAATGGCAGG + Intergenic
1123922243 15:25078537-25078559 ATTTCAATGGGGAGAGCTGCAGG - Intergenic
1123922780 15:25082269-25082291 ATTTGAATGGGGAGAGTTTTGGG - Intergenic
1124809676 15:32922918-32922940 ATTTTAATGGGGAAAATGGCAGG + Intronic
1125475591 15:40046205-40046227 ATTTTGATGGGGAGGGAGGGAGG - Intergenic
1125929741 15:43591860-43591882 ATTTTCATGGGGATAGTAAGGGG - Intergenic
1125942908 15:43691692-43691714 ATTTTCATGGGGATAGTAAGGGG - Intergenic
1127069149 15:55271188-55271210 ATTTTATTGTGGAGATTGTGGGG - Intronic
1127589902 15:60412486-60412508 TTTTTAATGGGGGGGGTGGGTGG - Intergenic
1129438705 15:75563080-75563102 ACTTGAGTGTGGAGAGTGGGAGG - Intronic
1130978152 15:88792908-88792930 ATTTTTATCAGGAGAGTGAGAGG + Intergenic
1132071670 15:98783104-98783126 TTTTTAATGGGGGCAGGGGGAGG - Intronic
1133041957 16:3065596-3065618 GGTTTTATGGGGAAAGTGGGGGG - Exonic
1133109602 16:3539464-3539486 ATTTGAAAAGGGAGAGAGGGAGG + Intronic
1133431770 16:5743251-5743273 AATTTAATTGGGGGACTGGGTGG + Intergenic
1134118097 16:11564573-11564595 TTTTTAATGGGGAGATTGCAGGG + Intronic
1134631260 16:15757730-15757752 ATGTGCATGGGGAGAGTGTGGGG + Intronic
1134763221 16:16732647-16732669 ACTTGAGTGGGGAGGGTGGGAGG - Intergenic
1134982831 16:18626502-18626524 ACTTGAGTGGGGAGGGTGGGAGG + Intergenic
1135089814 16:19504478-19504500 AATTTTATGGGGAGAGGTGGGGG + Intronic
1135975818 16:27108508-27108530 ATTTTAATGGGCAGCCAGGGTGG - Intergenic
1137033946 16:35552882-35552904 ATTGGAAGGCGGAGAGTGGGGGG - Intergenic
1137300733 16:47144870-47144892 ATTTTAATGGTGTGAGGGTGAGG - Intergenic
1137917824 16:52452194-52452216 ATTATAAGGGGTAGAATGGGAGG + Intronic
1138345505 16:56317743-56317765 ATTTGAAAGAAGAGAGTGGGAGG + Intronic
1138695175 16:58806390-58806412 AATTTAAGGTGGAGGGTGGGAGG + Intergenic
1139118837 16:63990534-63990556 AATTTAATGGATAGAGTTGGTGG + Intergenic
1139797616 16:69496239-69496261 TTTTTAAAGGGGAAAGTGTGTGG - Intergenic
1140455698 16:75104375-75104397 ATGGTAATGGGTAGAGTGGTAGG - Intronic
1141278998 16:82613813-82613835 AACTTAATGGGGACAGTGGAGGG + Intergenic
1141339563 16:83190290-83190312 ATTGTCATGGGGCAAGTGGGAGG + Intronic
1141740383 16:85887820-85887842 AGTATTGTGGGGAGAGTGGGAGG - Intergenic
1142133189 16:88440198-88440220 TTTTTAATGGGGGTATTGGGTGG + Exonic
1142755532 17:2014393-2014415 CCTTGAATGGGGAGAGTGGGGGG - Intronic
1143327735 17:6110425-6110447 ATTCTAATAGGGGAAGTGGGTGG - Intronic
1144268978 17:13600336-13600358 ATGTTGAAGGAGAGAGTGGGAGG - Intronic
1145294365 17:21576145-21576167 ATTCTGATGGGGAGGGCGGGAGG - Intergenic
1145369467 17:22297035-22297057 ATTCTGATGGGGAGGGCGGGAGG + Intergenic
1146602660 17:34232114-34232136 ATTTGAAGGTGGAGAGTGAGAGG + Intergenic
1146799489 17:35807245-35807267 ACTTGAGTGGGGAGGGTGGGAGG + Intronic
1146825414 17:36018422-36018444 AATATAATGGGGAGAGTGTAGGG + Intergenic
1147763282 17:42815218-42815240 AGTGTAAAGGGGAGAGTGGCCGG - Intronic
1147792357 17:43021599-43021621 GTTTTAATGGGGGGGGGGGGGGG + Intronic
1147914863 17:43880139-43880161 GTGCCAATGGGGAGAGTGGGGGG - Intronic
1149541960 17:57474140-57474162 ATTTTTAAGAGGAGAGAGGGAGG - Intronic
1150850488 17:68699310-68699332 TTTTTGCTGGGGGGAGTGGGCGG + Intergenic
1150998722 17:70349453-70349475 ATTTCAAAGGTCAGAGTGGGAGG - Intergenic
1151903599 17:77033795-77033817 AATTTAATGGAGAGAGTGTTGGG - Intergenic
1152435421 17:80273436-80273458 ATTTTCCTGGGCAGAGTGAGCGG - Intronic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155165297 18:23227253-23227275 AATTTTCTGGGGAAAGTGGGTGG - Intronic
1155243833 18:23888527-23888549 ATTTTCATGGGGGCTGTGGGGGG + Intronic
1156104767 18:33646866-33646888 ATTTTAAGGGGGAGCGGGGGGGG + Intronic
1156542747 18:37931281-37931303 ATTTTCATTTGGAGAGTTGGAGG - Intergenic
1156572576 18:38275014-38275036 ATTTGAAGGTGGAGGGTGGGAGG + Intergenic
1157880023 18:51312770-51312792 AGTTCAAGGGGGAGAGTGTGGGG - Intergenic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1159328905 18:66962568-66962590 ACTAGATTGGGGAGAGTGGGAGG + Intergenic
1159562051 18:70006561-70006583 ATTCTAATGGGAAAAGAGGGGGG - Intronic
1160104801 18:75963528-75963550 ATTTTTCTGGGGAGAGGAGGGGG - Intergenic
1160992619 19:1865989-1866011 TTTTTAATGTGGAGAGTTGGGGG - Intergenic
1161293308 19:3506996-3507018 ATTTTACTGGGGCGAGGGGCTGG - Intronic
1163083114 19:14957682-14957704 ATTCTAATGGGGAAAGCAGGAGG + Intronic
1163578897 19:18126460-18126482 CTTTCAATGGGGACAGTGGCAGG - Intronic
1164969028 19:32514708-32514730 AGGTTAATGGGGAGGGAGGGAGG + Intergenic
1165117916 19:33540126-33540148 ATTTTAAAGGGAAAAGGGGGTGG - Intergenic
1166195267 19:41201722-41201744 ATTCTAGAGGGAAGAGTGGGTGG + Intronic
1167191605 19:47993950-47993972 ATGTTAAAGGGGAGAATGGGTGG - Intergenic
1167574562 19:50311961-50311983 ATTTTGGTGGGGAGTGAGGGTGG + Intronic
1168044926 19:53787776-53787798 ATTTTGATTGGGTGAGGGGGCGG + Intergenic
1168127144 19:54290906-54290928 ATTTTGATAGAGAGAGTGGGAGG + Intergenic
1168173215 19:54604603-54604625 ATTTTGATAGAGAAAGTGGGAGG - Intronic
925466235 2:4109099-4109121 ATTTGACAGGGGAGAGGGGGAGG - Intergenic
925479680 2:4256259-4256281 ATTTTTTTGGGGGGCGTGGGGGG - Intergenic
926783015 2:16492760-16492782 ATTTGAAGGAGGAGGGTGGGAGG + Intergenic
927078915 2:19608683-19608705 ATTTTCATGGGGTGAATTGGAGG - Intergenic
927607359 2:24498727-24498749 ATTTTAATGGAGGGAGGTGGTGG + Intronic
927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG + Intronic
928069571 2:28201080-28201102 TTTTTAATGGGGAGAGCAAGGGG + Intronic
928372427 2:30750301-30750323 ACTTGAGTGGGGAGGGTGGGAGG + Intronic
928503866 2:31928200-31928222 AACTTAATGGGGAGTGTGAGAGG - Intronic
930623553 2:53669571-53669593 ATTTTAATCAGGAGACTGAGAGG - Intronic
931917266 2:66969696-66969718 GTTTTGAATGGGAGAGTGGGTGG + Intergenic
932077844 2:68681725-68681747 ATTTCAATGGGAAAAGTGGATGG + Intronic
932455024 2:71844001-71844023 AGTTTAATGGGCAGAGTTGCAGG - Intergenic
933602897 2:84351085-84351107 ATTGTAAGGTGGAGGGTGGGAGG + Intergenic
935086604 2:99852128-99852150 ATCTTAATAGAGAGATTGGGGGG + Intronic
935106503 2:100049788-100049810 AATCCAATGGGCAGAGTGGGAGG + Intronic
937552875 2:123116148-123116170 ATTTGAGGGTGGAGAGTGGGAGG - Intergenic
938340631 2:130533759-130533781 ATTTCAACGGGTAGAGTGGGCGG - Intergenic
938349199 2:130586960-130586982 ATTTCAACGGGTAGAGTGGGCGG + Intergenic
939051859 2:137316817-137316839 ATTTTGATGGGGAGAGGATGGGG + Intronic
939064361 2:137464771-137464793 ATTTTACTGAGGATAGTGTGTGG + Intronic
939935421 2:148286506-148286528 ATTTTAATGCAGAGAGTGTTGGG - Intronic
939996440 2:148925082-148925104 ATTTTGATTGGGAGAGGGAGTGG + Intronic
940385833 2:153070304-153070326 GTGCTCATGGGGAGAGTGGGTGG + Intergenic
942455176 2:176133095-176133117 ATTTTACAGGGGAAAGTGGGGGG + Intergenic
942805015 2:179920282-179920304 ATTTGAGTGTGGAGGGTGGGAGG - Intergenic
943269486 2:185780711-185780733 ATATTTCTGTGGAGAGTGGGAGG + Intronic
943387144 2:187216067-187216089 ATGTTTGTGGGCAGAGTGGGAGG + Intergenic
943509936 2:188812332-188812354 ATTAAAATAGGGAGAGAGGGAGG - Intergenic
944211945 2:197215461-197215483 ATTTGAAGTGGGAGAGTGTGAGG + Intronic
944258591 2:197651373-197651395 ATTTCAATGGCCAGAGCGGGTGG + Intronic
944468985 2:200032956-200032978 ATGTTAATGGGGAGTGGGGTAGG + Intergenic
944783949 2:203048470-203048492 TTTTTGATGGGGAGGGAGGGAGG + Intronic
945743898 2:213697200-213697222 ATTTGAAAGGGAAGAGTGGGTGG + Intronic
946874024 2:224110428-224110450 TTCTTCATGGGCAGAGTGGGAGG + Intergenic
947090208 2:226501484-226501506 ACTTGAGTGGGGAGGGTGGGAGG - Intergenic
947929652 2:233953016-233953038 ATTTTGAAGGAGAGGGTGGGTGG - Intronic
948671196 2:239569988-239570010 ATTTGATTCGGGGGAGTGGGAGG - Intergenic
1169621595 20:7512991-7513013 ATTATAATGGGAAGAGGAGGAGG + Intergenic
1169874553 20:10282653-10282675 ATTCTACTGGGGACAGTGGATGG - Intronic
1171175788 20:23050080-23050102 CTTTGAATGGGGAGTGGGGGAGG + Intergenic
1171281561 20:23903700-23903722 ACTTGAAAGGGGAGGGTGGGAGG + Intergenic
1172761217 20:37323802-37323824 ACTTGAAGGGGGAGGGTGGGAGG + Intergenic
1173656579 20:44703995-44704017 TTTTCAATGGGAAGAGTGAGAGG - Intergenic
1173732890 20:45340763-45340785 AATTTAGTGGGGAGAGGGGATGG + Intronic
1174711414 20:52709590-52709612 ACTTGAAGGTGGAGAGTGGGAGG + Intergenic
1176070616 20:63224467-63224489 GTATTAATGGGGAGGGCGGGAGG - Intergenic
1176229420 20:64024398-64024420 TTTACAATGGGGAGAGTGTGGGG - Intronic
1178977679 21:37233440-37233462 ATACTAAAGGGGAGAGTTGGAGG + Exonic
1179152528 21:38821256-38821278 ATTTTAATGCCAAGAGTTGGTGG + Intronic
1179315645 21:40241992-40242014 ACTTGAGTGGGGAGGGTGGGAGG + Intronic
1181449073 22:23005118-23005140 ATATAAATGGGAAGAGTGGGCGG + Intergenic
1182025923 22:27119181-27119203 TTTTGAAGGTGGAGAGTGGGAGG + Intergenic
1182523094 22:30895952-30895974 ACTTTAAAGGGGAGGATGGGGGG + Intronic
1182849238 22:33457772-33457794 AGTTTATTGGGCAGAGTGGGAGG + Intronic
949871858 3:8595912-8595934 ATTTTAATGGGGACAGATGGTGG + Intergenic
950291030 3:11784619-11784641 TTTTCTATGAGGAGAGTGGGTGG + Intergenic
950974641 3:17227693-17227715 ACTTGAATGTGGAGGGTGGGAGG + Intronic
952053435 3:29414321-29414343 ATGTTAATGGAGAAAGTGGGTGG - Intronic
952619814 3:35324211-35324233 ACTTGAGTGGGGAGGGTGGGAGG + Intergenic
953419372 3:42742606-42742628 ATTGTAAAAGGGAGAGGGGGAGG - Intronic
953432923 3:42854473-42854495 ATTTTGAAAGGGAGTGTGGGGGG + Intronic
954632820 3:52056359-52056381 TTTTTCATGGGGAGCGCGGGCGG + Exonic
954982749 3:54761096-54761118 AATTTAAGGAGGAGGGTGGGAGG - Intronic
955505745 3:59631615-59631637 GTGTTGATGGGGAGAGTGAGTGG - Intergenic
955524077 3:59803170-59803192 CTTTTAATTGAGTGAGTGGGAGG - Intronic
955762473 3:62302432-62302454 ATTTTTTTGGGGGGGGTGGGAGG - Intergenic
956140951 3:66146833-66146855 ACTATAGTGGGGAGAGTGGGAGG - Intronic
956267036 3:67408305-67408327 AATTAAAAGGGCAGAGTGGGAGG - Intronic
956538688 3:70309066-70309088 TTTTTAAGGGGGAGTGAGGGAGG + Intergenic
957561578 3:81828701-81828723 ATTTTTATGGGGAGAGGGAGAGG + Intergenic
959128680 3:102323265-102323287 ATTTTTATGTGGAGTGTGGCTGG + Intronic
959458638 3:106595390-106595412 ATTTGTATGTGGGGAGTGGGGGG + Intergenic
960766617 3:121137072-121137094 ATTTTAGGGTGGAGGGTGGGAGG + Intronic
962018419 3:131469198-131469220 AGTGTAAGGAGGAGAGTGGGAGG - Intronic
962997008 3:140639884-140639906 ACTTGAGGGGGGAGAGTGGGAGG - Intergenic
963053491 3:141162953-141162975 ATTTGATGGGGGAGGGTGGGAGG + Intergenic
963458052 3:145572526-145572548 ATTCTAATGGGGGGAGAGAGAGG + Intergenic
963600732 3:147376996-147377018 ATTTTGATCTGGGGAGTGGGAGG - Intergenic
965307203 3:167081263-167081285 ATTTTAAGTTGGAGAGTTGGGGG - Intergenic
965321377 3:167255942-167255964 AGTATAGTGGGGAGTGTGGGTGG - Intronic
965602543 3:170469330-170469352 ATTTCACTGGGGAGTGTGGGAGG - Intronic
966508935 3:180739081-180739103 ACTTGAGTGGGGAGAGTGAGAGG + Intronic
967116482 3:186344586-186344608 ACTTGAGTGGGGAGGGTGGGAGG + Intronic
967899967 3:194440033-194440055 ATTTTGAAAGGGAGAGAGGGAGG - Intronic
968680090 4:1912324-1912346 AATTATATGGGGAGAATGGGGGG - Intronic
970109870 4:12625785-12625807 ACTAGAGTGGGGAGAGTGGGAGG - Intergenic
970320439 4:14870321-14870343 CTTTTTCTGGGGAGAGTGGTGGG - Intergenic
970333885 4:15011624-15011646 ATTTTTTTGGGAAGAGGGGGTGG - Intronic
971511700 4:27434421-27434443 ATTTTAGAGGGCAGAGTGGAAGG + Intergenic
976579501 4:86719124-86719146 ACTTGAGTGGGGAGAGTGGGAGG - Intronic
977070486 4:92378616-92378638 ATGTTAATGGGTAAAGTGTGTGG - Intronic
977956736 4:103036368-103036390 ATTTTAAAGTGGAGGGTGGCAGG + Intronic
979018226 4:115461730-115461752 ATTGTAAGGTGGAGGGTGGGAGG + Intergenic
979580879 4:122358386-122358408 ATTTCAATGGGAAAAGGGGGTGG + Intronic
980755420 4:137152515-137152537 ATTTTGATGTGGAGAGTGATAGG - Intergenic
981302106 4:143199131-143199153 ACTTGAGCGGGGAGAGTGGGAGG - Intronic
981664745 4:147211335-147211357 ATTTGAGGGTGGAGAGTGGGAGG - Intergenic
984463949 4:180073109-180073131 ATTTAAATTGGGTGGGTGGGTGG + Intergenic
985546509 5:512567-512589 CTGTTAATAGGGGGAGTGGGGGG + Intronic
986094478 5:4541092-4541114 AATTGAATGTGGAAAGTGGGTGG - Intergenic
987217590 5:15753517-15753539 ATTTTAATTGGGAGAGAAGGAGG + Intronic
987702986 5:21425964-21425986 ACTTGAGTGGGGAGGGTGGGAGG - Intergenic
987743337 5:21937886-21937908 CTTTTCATGGGGAGAGGAGGAGG + Intronic
989065260 5:37453913-37453935 AGGGTAATGGGTAGAGTGGGTGG - Intronic
989154608 5:38332432-38332454 ACTTGATGGGGGAGAGTGGGTGG - Intronic
990138160 5:52672125-52672147 ATTTTGTTGGAGAGGGTGGGAGG - Intergenic
990336964 5:54783840-54783862 ACTTGAGGGGGGAGAGTGGGAGG + Intergenic
991749574 5:69786621-69786643 CTTTTCATGGGGAGAGGAGGAGG - Intergenic
991763536 5:69948019-69948041 CTTTTCATGGGGAGAGGAGGAGG + Intergenic
991783790 5:70170110-70170132 CTTTTCATGGGGAGAGGAGGAGG - Intergenic
991801153 5:70366435-70366457 CTTTTCATGGGGAGAGGAGGAGG - Intergenic
991827446 5:70643607-70643629 CTTTTCATGGGGAGAGGAGGAGG + Intergenic
991842765 5:70823079-70823101 CTTTTCATGGGGAGAGGAGGAGG + Intergenic
991876236 5:71170485-71170507 CTTTTCATGGGGAGAGGAGGAGG - Intergenic
992590565 5:78291993-78292015 ATATGCATGGGGAGAGTGAGTGG + Intronic
993041775 5:82822846-82822868 ATTTAAAAGGGGAGAGAGGCTGG + Intergenic
993464986 5:88234071-88234093 TTTTTAAGGGGGAGAGAGGTAGG + Intronic
994344131 5:98664705-98664727 CTGGTAATGGGGAGACTGGGTGG + Intergenic
994419074 5:99509734-99509756 AGGGTAATGGGTAGAGTGGGTGG - Intergenic
994910425 5:105898457-105898479 GTTTTATTGGGGAGGATGGGAGG + Intergenic
996082377 5:119269792-119269814 ATTTTTATGGGGGGAGGTGGGGG + Intronic
996991512 5:129637961-129637983 ACTTGAATGGGGAGGGTGGGAGG + Intronic
998390725 5:141785454-141785476 ATCTGAATGGGGAGTGGGGGAGG + Intergenic
999769016 5:154761144-154761166 CCTTTGAAGGGGAGAGTGGGAGG + Intronic
999826192 5:155275769-155275791 ATTTTACTGGTGGGGGTGGGGGG + Intergenic
1001715073 5:173808716-173808738 ATGTTAATGGTGAGTGTGTGGGG - Intergenic
1004142916 6:13037310-13037332 AGGTTAATGGGGAGTTTGGGGGG - Intronic
1004147131 6:13078152-13078174 TTTTTTTTGGGGGGAGTGGGTGG + Intronic
1004215312 6:13698144-13698166 TTTTTTGTGGGGGGAGTGGGGGG - Intronic
1004385847 6:15172133-15172155 ATTGTCGTGGGGTGAGTGGGTGG - Intergenic
1005075833 6:21906382-21906404 ATTTTAAGGGGGAAATTTGGGGG - Intergenic
1005714612 6:28534913-28534935 ATTTTATTGGAGACAGTGGCAGG - Exonic
1006344446 6:33468668-33468690 ACTTGAATGTGGAGGGTGGGAGG + Intergenic
1006841165 6:37028581-37028603 ATTTAAATGGGCTGAGTTGGGGG + Exonic
1006912075 6:37570061-37570083 ATGGGAATGGGGATAGTGGGTGG - Intergenic
1007398802 6:41592038-41592060 ATCTAAATTGGGAGAGTGGGCGG + Intronic
1009832923 6:68962064-68962086 AGTTTAATGGTGACAGTAGGTGG + Intronic
1010259477 6:73798725-73798747 ATATTAATGGGGAATGTTGGAGG + Intronic
1010312022 6:74398708-74398730 AGTTTAATGGGAAGGGTAGGAGG - Intergenic
1010703013 6:79075571-79075593 ATTTTTGGGGGGAGGGTGGGGGG - Intronic
1010961387 6:82149816-82149838 TTTTTGGTGGGGAGAGTGGGAGG - Intergenic
1011938822 6:92816756-92816778 AGTTGAGTGGGGAGGGTGGGAGG + Intergenic
1012307112 6:97672386-97672408 ATTGCAATGGAGAGAGGGGGAGG - Intergenic
1012966854 6:105684491-105684513 ATTCTAGTGGGGTGAGTGGGAGG + Intergenic
1013983167 6:116157720-116157742 GTTGAAATGGTGAGAGTGGGTGG + Intronic
1015985387 6:138879382-138879404 ATTTTATTGGGGGCAGTGTGGGG + Intronic
1016278496 6:142383786-142383808 ATGTTAGTGGTGACAGTGGGTGG - Exonic
1016428930 6:143963085-143963107 ATTTTAAAGGTGACACTGGGGGG + Intronic
1016440468 6:144078196-144078218 ATTGTAATGGGAAGAGGGGTAGG - Intergenic
1016799303 6:148152784-148152806 CTTTTCATGGGGAGGCTGGGGGG + Intergenic
1017792624 6:157814870-157814892 ATTGTACTGGGGAGAAAGGGGGG - Intronic
1018668849 6:166163303-166163325 ATTCTCCTGGGGAGAATGGGGGG - Intronic
1019983500 7:4638908-4638930 ATAGCAATGGGGAGATTGGGAGG - Intergenic
1021206391 7:17786528-17786550 CTGTTAAGGGGGAGAGGGGGAGG - Intergenic
1021734151 7:23626653-23626675 ACTTGAGTGGGGAGGGTGGGAGG - Intronic
1021754614 7:23839771-23839793 AGTTGAAGGTGGAGAGTGGGTGG + Intergenic
1021854023 7:24835904-24835926 ACTGGAATGTGGAGAGTGGGTGG + Intronic
1022548992 7:31219058-31219080 ATTTTAATGGGTACACTTGGAGG + Intergenic
1022765114 7:33403239-33403261 ATTAGAGTGGGGAGAGAGGGAGG - Intronic
1023421893 7:39989347-39989369 TTTTTAATGGGGAGTGGGAGGGG - Intronic
1023444234 7:40215440-40215462 ATGTTCAAGAGGAGAGTGGGTGG - Intronic
1024512659 7:50215759-50215781 ATGTGAATGGGGAGTCTGGGAGG - Intergenic
1024640255 7:51322622-51322644 AATGTAATGGGGAGAGTGGAAGG - Intergenic
1026304707 7:69130596-69130618 TTTTTGAGGCGGAGAGTGGGAGG - Intergenic
1027114862 7:75471058-75471080 AGTTCAAAGGGGAGAGTGAGGGG - Intronic
1027832857 7:83202155-83202177 ATTTTAAAAGGGAGGGAGGGAGG - Intergenic
1028671657 7:93407642-93407664 GCTTTAATGGGGACAGTTGGAGG + Intergenic
1029880750 7:103807056-103807078 ATCTGAATGGGGAGACTGAGAGG + Intronic
1030156418 7:106460254-106460276 ATTTTACTGCGGGGAGGGGGCGG + Intergenic
1030416680 7:109252759-109252781 ACTTCAGTGGGGAGGGTGGGAGG + Intergenic
1030609993 7:111678975-111678997 ATTTAAAGGGGAAAAGTGGGTGG + Intergenic
1031185015 7:118466364-118466386 ATTTAAATCGTGAGAGTTGGAGG - Intergenic
1031455268 7:121971428-121971450 ATTTTTATGGGGAGTGTTGAGGG + Intronic
1031845461 7:126800395-126800417 ATTTAAATGGGAAAAATGGGGGG - Intronic
1031858923 7:126956626-126956648 ATTTTAAGGGGGAGAGGGGAGGG - Intronic
1033650844 7:143342171-143342193 GATCTGATGGGGAGAGTGGGAGG + Intronic
1035195472 7:157216501-157216523 ACTTGAAGGGGGAGGGTGGGAGG - Intronic
1035219636 7:157398361-157398383 CTTTTTTTGGGGAGAGAGGGGGG - Intronic
1036506058 8:9357386-9357408 ACTTGAGTGTGGAGAGTGGGAGG + Intergenic
1036776683 8:11617673-11617695 ACTTTAATTGGGGGTGTGGGAGG - Intergenic
1037056212 8:14445142-14445164 ATATTAATTGTGAGAGTGGCAGG + Intronic
1037423387 8:18727781-18727803 ATTTTACTTGGGAGAGTAGGTGG - Intronic
1037472322 8:19223021-19223043 ATTTTAATTGGGTAAATGGGGGG + Intergenic
1038247028 8:25867982-25868004 ATTTCAGTGGGCAGAGGGGGAGG - Intronic
1038399372 8:27271245-27271267 ATTGGAATGGTGAGATTGGGAGG + Intergenic
1038529831 8:28309560-28309582 TATTTATTGGGGAGAGTGGGAGG - Intergenic
1039706202 8:40010025-40010047 ATTTCAATGCGGTGGGTGGGGGG + Intronic
1039987159 8:42457356-42457378 AGATTGATGAGGAGAGTGGGAGG - Intronic
1040703788 8:50100929-50100951 ATTTGAAGGTGGACAGTGGGAGG - Intronic
1041342309 8:56858708-56858730 ATTTCAGAGGGGAGAGTGGCAGG - Intergenic
1042122287 8:65501226-65501248 ATTTTGGGGGGAAGAGTGGGAGG - Intergenic
1042228185 8:66531259-66531281 ATTTTAGTGGGTGGAGTAGGGGG + Intergenic
1042953019 8:74220547-74220569 ATGTTAAGGGGGTGGGTGGGAGG - Intergenic
1044740850 8:95324663-95324685 ATTGTAAAGGGGAAAGAGGGAGG - Intergenic
1044849926 8:96418159-96418181 ACTTTAATGGGGGTAGGGGGTGG + Intergenic
1045308637 8:100981313-100981335 ATTTTGTGGGGGAGGGTGGGTGG - Intergenic
1045476055 8:102553692-102553714 ATTTTAATTGGTAGAGTCTGGGG - Intronic
1045535850 8:103026949-103026971 ATCTTAATTGGGATTGTGGGAGG - Intronic
1045592905 8:103618316-103618338 ACTTGAATGGGGAGGGTGGGAGG + Intronic
1045780918 8:105862300-105862322 ATTTTGCTGGGGAGAGGAGGTGG + Intergenic
1046065619 8:109193697-109193719 ATTTTGATGTTGATAGTGGGAGG - Intergenic
1046166403 8:110442141-110442163 ACTTGAGTGGGGAGGGTGGGAGG + Intergenic
1047190841 8:122677760-122677782 ATTTTGCCGGGGAGACTGGGAGG - Intergenic
1047218743 8:122901351-122901373 ATTCTCTTGGGGAGAGTAGGAGG - Intronic
1047237870 8:123058225-123058247 ATTAAAGTGGGGAGAGAGGGAGG + Intronic
1047364959 8:124203222-124203244 CATTTCATGGGGAGGGTGGGTGG + Intergenic
1047434689 8:124826376-124826398 GTTTCAATGGGGAGAGTGCCTGG - Intergenic
1048743888 8:137591942-137591964 ATTTTAATGGGCAGAGCCTGGGG + Intergenic
1049760389 8:144329506-144329528 ATTCTGATGCGTAGAGTGGGTGG - Intergenic
1050429125 9:5543861-5543883 ATTTCAATGGGGTGGGGGGGAGG + Intronic
1051800023 9:20922267-20922289 TTTATAATGGGGAGGGTTGGAGG - Intronic
1052044113 9:23774656-23774678 ATTTTTATGGGGAGTTGGGGAGG - Intronic
1052742677 9:32408805-32408827 GTTTTAGGGGGAAGAGTGGGTGG + Intronic
1053578560 9:39378891-39378913 ATTTTATTGGGGTCAGTGGTGGG - Intergenic
1053843084 9:42206970-42206992 ATTTTACTGGGGTCAGTGGTGGG - Intergenic
1053913538 9:42928458-42928480 ATTTTAATGGGGAAAGTTAGAGG + Intergenic
1054100143 9:60937696-60937718 ATTTTATTGGGGTCAGTGGTGGG - Intergenic
1054121540 9:61213323-61213345 ATTTTATTGGGGTCAGTGGTGGG - Intergenic
1054586201 9:66969189-66969211 ATTTTATTGGGGTCAGTGGTGGG + Intergenic
1055596622 9:77871859-77871881 ATTTTCATGGGGTGAGGGAGAGG + Intronic
1057961033 9:99457664-99457686 ATTTAAACGTGGAGAGAGGGAGG + Intergenic
1058066536 9:100554630-100554652 TTTAGAATTGGGAGAGTGGGAGG + Intronic
1061605481 9:131706921-131706943 ATTTAAATGAGAAGAGTGGTAGG - Intronic
1185747101 X:2582569-2582591 ATTTTAATGGAGAATGTGGAGGG + Intergenic
1186216810 X:7309387-7309409 ATTTGAGAGGGGAGGGTGGGAGG + Intronic
1187851270 X:23593832-23593854 ATTTTGTTGGGGAGAGGAGGAGG - Intergenic
1188325839 X:28799857-28799879 ATTTTTGCGGGGAGAGTGGATGG + Intronic
1189081631 X:37979210-37979232 ATTTAAACGGGAAAAGTGGGCGG + Intronic
1189689563 X:43601781-43601803 ATTTGAGGGTGGAGAGTGGGAGG - Intergenic
1189881512 X:45498299-45498321 ATTGGAAGGTGGAGAGTGGGAGG - Intergenic
1190916676 X:54816398-54816420 ATTTGAATGAGGAGAGAGAGGGG + Intergenic
1191910118 X:66141156-66141178 ATTTGAAGGTGGAGGGTGGGAGG - Intergenic
1192573519 X:72224970-72224992 AGTATTATGGGGAGAATGGGTGG - Intronic
1192622500 X:72693440-72693462 ATTTTGCTGGGGAGAGAGGCAGG - Intronic
1193204218 X:78728923-78728945 AGTTAAAAGGGGACAGTGGGTGG - Intergenic
1193528740 X:82627337-82627359 AATTGAGTGGGGAGGGTGGGAGG - Intergenic
1193883427 X:86955443-86955465 ACTTGAAGGGGGAGAGTGGGAGG + Intergenic
1194504524 X:94715856-94715878 ATTTCAAGGTGGAGAGTGGGAGG + Intergenic
1194835991 X:98683564-98683586 ATTTGAAAGGGTAGAGTGGGAGG - Intergenic
1195375453 X:104223093-104223115 ATTTTGGTGGAGAGAGTTGGAGG + Intergenic
1195402426 X:104475688-104475710 GTCTGAATGGGGAGTGTGGGTGG - Intergenic
1195823986 X:108977294-108977316 ACTTTATGGGGGAGAGTGGGAGG - Intergenic
1196168687 X:112564025-112564047 ATTTTGGTGGGGGGATTGGGGGG - Intergenic
1196227601 X:113184949-113184971 GTTTGAGAGGGGAGAGTGGGAGG - Intergenic
1196499283 X:116360429-116360451 ATTTGAAGGGGGAGAATGGGAGG - Intergenic
1196898697 X:120362276-120362298 ATTTTAATGGGGTGGGTTGGGGG + Intronic
1197409877 X:126103629-126103651 ATTTGAAAGGGAAGAGTGGTAGG + Intergenic
1198343008 X:135732987-135733009 TTTTTATTGGGGTGGGTGGGGGG - Intergenic
1198344981 X:135750308-135750330 TTTTTATTGGGGTGGGTGGGGGG + Intergenic
1198626894 X:138586064-138586086 ATTTGAGGGTGGAGAGTGGGAGG - Intergenic
1199105405 X:143860530-143860552 ACTTGAGTGGGGAAAGTGGGAGG - Intergenic
1199288695 X:146082333-146082355 ATTTTAATGTGCAGCCTGGGTGG + Intergenic
1199711458 X:150472657-150472679 AGGGTAATGGGGAGAGAGGGAGG + Intronic
1200759712 Y:7026677-7026699 ATCTTTCTGGGGAGAGTTGGTGG - Intronic
1200819577 Y:7568645-7568667 ACTTGAAGGGGGAGGGTGGGAGG + Intergenic