ID: 900364724

View in Genome Browser
Species Human (GRCh38)
Location 1:2306435-2306457
Sequence GTGTCCTAGCAGGTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 276}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900364712_900364724 27 Left 900364712 1:2306385-2306407 CCCGACGGGCACAGGGTGGGTGG 0: 1
1: 0
2: 1
3: 28
4: 191
Right 900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 276
900364711_900364724 28 Left 900364711 1:2306384-2306406 CCCCGACGGGCACAGGGTGGGTG 0: 1
1: 0
2: 1
3: 9
4: 132
Right 900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 276
900364714_900364724 26 Left 900364714 1:2306386-2306408 CCGACGGGCACAGGGTGGGTGGT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 276
900364718_900364724 -5 Left 900364718 1:2306417-2306439 CCTGCGTCTCGTGAGCCTGTGTC 0: 1
1: 0
2: 0
3: 13
4: 139
Right 900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 276
900364717_900364724 -4 Left 900364717 1:2306416-2306438 CCCTGCGTCTCGTGAGCCTGTGT 0: 1
1: 0
2: 1
3: 6
4: 81
Right 900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 276
900364710_900364724 29 Left 900364710 1:2306383-2306405 CCCCCGACGGGCACAGGGTGGGT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 276
900364708_900364724 30 Left 900364708 1:2306382-2306404 CCCCCCGACGGGCACAGGGTGGG 0: 1
1: 0
2: 2
3: 7
4: 106
Right 900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900364724 Original CRISPR GTGTCCTAGCAGGTGGAGGA GGG Intronic
900098798 1:952261-952283 CGGTCCTTGCAGGTGGGGGAAGG - Intronic
900315133 1:2052512-2052534 GTGCCCTAGAAGGGGGAGGAAGG - Intronic
900358235 1:2274995-2275017 GTGTGTCAGCAGGTGGAGGCTGG + Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
900782816 1:4628958-4628980 GTGTCCCAGGAGGCTGAGGATGG + Intergenic
901028092 1:6289877-6289899 CTGTCTTAGCAGGTGGAAGGGGG - Intronic
901636086 1:10670832-10670854 GGGTCCTGGCTGGTGGGGGAGGG - Intronic
904484148 1:30813920-30813942 GGGTCCTACCAGGATGAGGATGG + Intergenic
905262515 1:36729763-36729785 GTGTCCAAGCAGTGGGATGAGGG + Intergenic
906508103 1:46394737-46394759 GTGTCAAGGCAGGTGGTGGAAGG + Intronic
909532292 1:76694450-76694472 GTGACCTAGAAGTTGGAGGTTGG + Intergenic
911088103 1:93996316-93996338 GTGTCCTACCCGGGGGAGGCTGG + Intronic
912280728 1:108309662-108309684 GTGTCCTTGCAGGGGGATGATGG + Intergenic
912287498 1:108384695-108384717 GTGTCCTTGCAGGGGGATGATGG - Intronic
913117884 1:115713451-115713473 GCCTCCTGGCAGGTGGAGGTGGG + Intronic
915286884 1:154858881-154858903 GGGTCCTATAAGGAGGAGGATGG + Intronic
915596853 1:156901072-156901094 GGGTCCTGGCAGGAAGAGGAAGG - Intronic
916362750 1:163989622-163989644 CTGTCCTAGCAGGCAAAGGAAGG + Intergenic
920903146 1:210132363-210132385 ATGTCCAAGCAGGGTGAGGAGGG - Intronic
921279224 1:213549259-213549281 GAGTCTTAGGTGGTGGAGGAAGG + Intergenic
922969683 1:229725603-229725625 TTGTCTTAGCAGGTGAGGGAGGG - Intergenic
1063686829 10:8244943-8244965 GTGTCCTAGAAAGTTGAGGAAGG + Intergenic
1064271569 10:13870690-13870712 GTGTCCTAGCAGGAGGGGAGGGG - Intronic
1065236222 10:23655190-23655212 GTGTCCTAGAAAGAGTAGGATGG + Intergenic
1066477713 10:35764198-35764220 GACTCCTAGAGGGTGGAGGAAGG + Intergenic
1067063385 10:43089663-43089685 GTGTCCTTGCATGTGGGGGCGGG - Intronic
1069438806 10:68409197-68409219 GTCTACTTGAAGGTGGAGGATGG - Intergenic
1069599601 10:69694968-69694990 GAGTCCCAGCAGCTGGAGGATGG - Intergenic
1069617322 10:69814314-69814336 GTTTCCCAGGAGGAGGAGGAGGG + Intronic
1069890541 10:71649529-71649551 GTGTCCTAGCAGGGGTGGAAGGG + Intronic
1070742774 10:78913572-78913594 GGGGCCTGGCAGGCGGAGGAGGG - Intergenic
1071073568 10:81725216-81725238 GTGTCCTATCAGAGGGTGGAGGG - Intergenic
1074278134 10:112024200-112024222 GTGGCCAAGAAGATGGAGGAAGG - Intergenic
1074914397 10:117941540-117941562 CTGGCCTTGAAGGTGGAGGAAGG - Intergenic
1075030476 10:119021332-119021354 GGGTCCTGGAAGGTGGAGGAGGG + Intergenic
1076314868 10:129532949-129532971 GTGTCCGAGCAGCTGCAGGAAGG - Intronic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1077398677 11:2341181-2341203 CAGTCGTAGGAGGTGGAGGAGGG - Intergenic
1078157287 11:8809855-8809877 CTTTCCTAAGAGGTGGAGGAGGG - Intronic
1078572760 11:12473744-12473766 GTGTCCGAGCTGCAGGAGGAGGG + Exonic
1079240602 11:18719889-18719911 GTGCCCTAGGAGAAGGAGGAAGG + Exonic
1080030116 11:27651429-27651451 GGGTGCTCGCAGGTGGAGCAAGG - Intergenic
1082082854 11:48025655-48025677 GAGTCCTTGGAGGTGCAGGAAGG - Intronic
1083540418 11:63508270-63508292 GTGTCCTAGGAGCTGGGGAAAGG + Intronic
1083738005 11:64692729-64692751 GTGTCAGGACAGGTGGAGGAGGG + Intronic
1084687510 11:70705397-70705419 TTGTCCTAGCAAGTATAGGAGGG + Intronic
1085395371 11:76204565-76204587 GTGTCCTAGCAGAGGGAGCATGG - Intronic
1089299868 11:117492176-117492198 CTGTCATAGGAGGTAGAGGAGGG - Intronic
1089601066 11:119615574-119615596 GTCTCCTAGCAGGCAGAGGAAGG - Intergenic
1090395304 11:126414655-126414677 GTGTCCTTTCAGGTGGGGGAAGG + Intronic
1092181212 12:6448236-6448258 GTGCCCTGACAGGTGGAAGAGGG - Intronic
1096428049 12:51520871-51520893 GAGGCCCAGCAGGTGGATGAGGG + Intergenic
1098864469 12:75746104-75746126 GTGGCCCAGCAGGAGGAAGAAGG + Intergenic
1099640773 12:85280594-85280616 GGGACCTGGAAGGTGGAGGAAGG + Intronic
1099880234 12:88459059-88459081 GAGCCCTAGCAGGCTGAGGAGGG + Intergenic
1102297677 12:111749436-111749458 CAGTCCTAGCAGGTGAAGCAAGG + Intronic
1102787097 12:115613862-115613884 CTGGCCTTGAAGGTGGAGGACGG + Intergenic
1102940406 12:116936546-116936568 CTGGCCTTGAAGGTGGAGGAAGG + Intronic
1103780845 12:123397961-123397983 GTGACCTAGCAGGCCGAGCACGG - Intronic
1103949453 12:124543083-124543105 TTGCCCTAGCTGGTGGAGGAGGG - Intronic
1104832253 12:131761379-131761401 ATCTCCTAGGCGGTGGAGGACGG - Intronic
1105059374 12:133134399-133134421 CTGGCCTTGCAGGTGGAGGAAGG + Intronic
1105407028 13:20141841-20141863 GAGTCCCAGGAGGTGGACGATGG - Exonic
1105759821 13:23503493-23503515 GTTTCCTTGCACCTGGAGGAGGG - Intergenic
1106868548 13:33994290-33994312 GTGTCCACTCAGCTGGAGGAAGG + Intergenic
1109230727 13:59753982-59754004 GTGTCCCAGTAGGAGGAGGCTGG - Intronic
1109349114 13:61154085-61154107 TTGTCTTAGAAGATGGAGGAAGG + Intergenic
1111558359 13:89910708-89910730 TTGTCCCTGCTGGTGGAGGATGG - Intergenic
1111675279 13:91379224-91379246 GTGTCCCAGAAGGAAGAGGAAGG - Intergenic
1112164654 13:96905397-96905419 GTGCAATGGCAGGTGGAGGATGG - Intergenic
1113846437 13:113394223-113394245 CTGTCCCTGCAGGTGCAGGAGGG + Intergenic
1114588258 14:23834846-23834868 GTGTCCTAGGGGGAGGAGAAAGG - Intergenic
1114595032 14:23904495-23904517 GTGTCCTAGGGGGAGGAGAAAGG + Intergenic
1114720546 14:24876498-24876520 GTGTCCTTGCAAGAAGAGGAAGG - Intronic
1116404360 14:44550336-44550358 ATGCCCTAGAAGGTGGAGGTAGG - Intergenic
1118367282 14:65106666-65106688 GGGTCCTAGCAGGCAGAGGGTGG - Intergenic
1119127276 14:72139052-72139074 TTGCCCTAGCAGGTAGAGCAAGG + Intronic
1119533251 14:75378534-75378556 GTGTCCTAGGACTTTGAGGAAGG + Intergenic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1120970963 14:90206610-90206632 GTGTCATGGCATGGGGAGGAGGG + Intergenic
1122079589 14:99257551-99257573 GTGTCCGAGCCGGTGGAGATCGG - Exonic
1124170356 15:27367187-27367209 GTGTCCTTGTAGGGGGAGGGAGG - Intronic
1124226814 15:27901972-27901994 GGGTCCTGGCAGGGGGCGGAGGG + Intronic
1124634723 15:31357705-31357727 GGTTCCTGGCAGGTGCAGGAAGG + Intronic
1125672171 15:41481555-41481577 GTGTCCTGGCAGGTGTGGGAGGG + Exonic
1126031240 15:44500063-44500085 GTTTGCCAGCAGGTGGAGGCAGG + Intronic
1126678917 15:51185537-51185559 CTGTCCTAGGAGGAAGAGGAAGG + Intergenic
1127103938 15:55593375-55593397 GGGGCCTACCAGGTGGTGGAGGG + Intergenic
1128026079 15:64437811-64437833 TTGTCCTGGCAGCTGTAGGAAGG + Intronic
1128782976 15:70375178-70375200 GTGTGCGGGGAGGTGGAGGAGGG - Intergenic
1129199151 15:73988533-73988555 GTGACCTGGCAGGTGGAGCCAGG + Intronic
1129689454 15:77705156-77705178 GTGTCATGGCAGGGGGAGGGGGG - Intronic
1129965268 15:79729336-79729358 GTGTCCTAGCAGGAGGCTAAAGG - Intergenic
1132622848 16:875878-875900 GGGTCCCAGCTGCTGGAGGAGGG - Intronic
1132679331 16:1133320-1133342 GTGGCCTGGAAGGTGCAGGACGG - Intergenic
1132710104 16:1262702-1262724 GTGTCCTTCCTGGGGGAGGACGG + Intergenic
1133237690 16:4395208-4395230 TGGTTCTAGCAGGTGGAGGTAGG - Intronic
1133603315 16:7361129-7361151 GAGGGCTGGCAGGTGGAGGAAGG - Intronic
1136288645 16:29258713-29258735 CTGGCCTGGAAGGTGGAGGAAGG - Intergenic
1137608440 16:49802577-49802599 GTGTCACAGGAGGAGGAGGAAGG + Intronic
1137713506 16:50583496-50583518 GTGTGGTTGCAGGGGGAGGAAGG - Intronic
1138088512 16:54155334-54155356 GGATTCTAACAGGTGGAGGAAGG + Intergenic
1139353460 16:66352639-66352661 GGGTCCTAGAATGTGGAAGAGGG - Intergenic
1139787273 16:69404014-69404036 GAACCCTAGCAGGTGAAGGATGG - Intronic
1141152551 16:81574272-81574294 GTGGCCAAGCAGTTGGAGGAGGG - Intronic
1142094360 16:88231619-88231641 CTGGCCTGGAAGGTGGAGGAAGG - Intergenic
1142591833 17:1009687-1009709 GTGTTCCAGCAGGAAGAGGAAGG + Exonic
1142718928 17:1763426-1763448 TCGTCCTAGCAGGCGGGGGAGGG - Intronic
1143016782 17:3895054-3895076 GTGTCCTAGGAGCTGCTGGAAGG + Intergenic
1144331005 17:14224240-14224262 GCGCCCTAGCAGGGTGAGGAGGG - Intergenic
1148581621 17:48747716-48747738 GTGACCGAGCAGCCGGAGGAAGG - Intergenic
1148874301 17:50677592-50677614 GGGTCCTTGGAGGTGGGGGAAGG + Intronic
1149232918 17:54555567-54555589 GTGTCCAAGGTGGTGGATGAAGG + Intergenic
1151358362 17:73573485-73573507 GGGTCCTAGCAGCTGGGTGAAGG - Intronic
1151815084 17:76467833-76467855 GTGTCTTGGAAGGTGGAGGGAGG + Intronic
1152228773 17:79104506-79104528 ATGTCCTAGCAGGGTGAGGAGGG - Intronic
1152535387 17:80947808-80947830 ATGTCCTTTCAGGTGCAGGACGG - Intronic
1152584278 17:81182114-81182136 GCGGCCTAGCAGGGGAAGGAGGG - Intergenic
1153027718 18:686705-686727 GGGCACTGGCAGGTGGAGGAGGG + Intronic
1153082421 18:1243261-1243283 CTGTCTTTGAAGGTGGAGGAAGG + Intergenic
1153592793 18:6691824-6691846 GTGTACTTGCTGGTGGGGGATGG - Intergenic
1155512776 18:26594184-26594206 CTTCCCTAGCAGGAGGAGGAAGG - Intronic
1156254349 18:35380711-35380733 GTTTCCAAGCAAGTGGTGGATGG + Intergenic
1156487292 18:37474503-37474525 GTGCCCTAGGATGAGGAGGAAGG + Intronic
1157625202 18:49045166-49045188 GGGTCCTGGGAGGAGGAGGACGG + Intronic
1160018494 18:75162522-75162544 GTGTCCTGGCAGTTAGAGGTGGG + Intergenic
1161553820 19:4929210-4929232 GTGTCCCTGCAGATGGAGGACGG + Exonic
1162017522 19:7853484-7853506 CTGGCCTAACAGGTGAAGGACGG - Intronic
1162757806 19:12870815-12870837 TTTTCCCAGCATGTGGAGGAAGG + Exonic
1163205559 19:15800037-15800059 GTGTGCGAGCAGGTGGGGGAAGG - Intergenic
1163596936 19:18225893-18225915 GCGTCCTGGCAGTGGGAGGAGGG - Intronic
1164581518 19:29438300-29438322 GTGTCCCAGGATCTGGAGGATGG - Intergenic
1166907819 19:46125578-46125600 CTGTGCCAGCAAGTGGAGGATGG - Intergenic
1168271849 19:55254449-55254471 CTGTCCAAGCAGGGGAAGGAAGG - Intronic
925900717 2:8507554-8507576 CTGTTCTTGCAGGTTGAGGAGGG - Intergenic
927213999 2:20655980-20656002 GTGTCCCAGTGGGTGGAGGAGGG + Intergenic
927452951 2:23224378-23224400 GTGTCCCAGCAGGAAAAGGATGG - Intergenic
928393845 2:30929368-30929390 GTGTCCCTTCAGGTTGAGGAGGG - Intronic
930924279 2:56797593-56797615 GTGTTCTAGGAGGTGGCAGAGGG - Intergenic
932007730 2:67944348-67944370 GTCTACTTGAAGGTGGAGGATGG + Intergenic
932020246 2:68077432-68077454 GTGTCCCAGCAGGAGGATGAGGG + Intronic
932775138 2:74524023-74524045 GTGTCCCAGTAGATGGGGGAAGG + Exonic
933873655 2:86596177-86596199 GTGTCCTAGAACTTGGGGGATGG - Intronic
934697574 2:96411074-96411096 GTGTCTTCGCATGTGGAGGAGGG - Intergenic
934900812 2:98158619-98158641 GTGTCCTGGCAGCAAGAGGATGG + Intronic
935209052 2:100922788-100922810 GTGTCCCAGCCGGAGGCGGATGG + Intronic
935718236 2:105957669-105957691 GTGTGCTTGCAGTTGAAGGAAGG - Intergenic
938146357 2:128838026-128838048 GTTTCCTAGGAGGTGGGGGAGGG - Intergenic
938201569 2:129376888-129376910 CTGTCCATGCAGGTGGATGATGG - Intergenic
942217830 2:173739494-173739516 AAGACCTAGCAGGTGGATGAGGG + Intergenic
942237684 2:173928052-173928074 GTAACCTGGGAGGTGGAGGATGG - Intronic
943926602 2:193791534-193791556 GTTTCCCAGCTGGTAGAGGAAGG + Intergenic
944264063 2:197705419-197705441 GCGTCCTAGCAGGCGGAGGACGG - Exonic
946994163 2:225371929-225371951 TAGTCCTTGCAGGTTGAGGAAGG + Intergenic
948371921 2:237495068-237495090 ATGGCCTTGGAGGTGGAGGAGGG - Intronic
948883598 2:240872379-240872401 GTGAACATGCAGGTGGAGGAGGG + Intronic
948944429 2:241212297-241212319 GTGCTCAGGCAGGTGGAGGACGG + Intronic
1171030259 20:21670266-21670288 GCGTCATGGCATGTGGAGGAGGG + Intergenic
1172193855 20:33078546-33078568 GTGTCCCAGCAGGTTTTGGAGGG + Intergenic
1172525947 20:35600762-35600784 GTGTCCATGCAGGTGTTGGAAGG - Intergenic
1174399825 20:50270009-50270031 GTGTTCTAGCAGGAGGAGGGAGG - Intergenic
1175034290 20:55985122-55985144 GTGCCCAAGCAGGGTGAGGAAGG + Intergenic
1175124559 20:56741608-56741630 GGGTGGTAGCAGGTGGGGGAGGG - Intergenic
1175366654 20:58460787-58460809 ATGTCATAGCCAGTGGAGGAAGG + Exonic
1175767854 20:61603526-61603548 GTGCCCTACCAGGTGTGGGAGGG + Intronic
1176678415 21:9803029-9803051 GTGTCCTATGTGGTGGAGGGTGG - Intergenic
1180128574 21:45809450-45809472 GTGTGCGAGCAAGAGGAGGAAGG + Intronic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1181881964 22:25988386-25988408 CTTCCCTAGCAGATGGAGGATGG + Intronic
1181959941 22:26615882-26615904 GTGTCCCAGAAGGAGGAGGGAGG + Intronic
1182283807 22:29232416-29232438 GGATCCCAGCAGGTGGAGGTGGG + Intronic
1183329273 22:37210791-37210813 GTGTTCTAGCGGGTGGGAGATGG - Intronic
1183440156 22:37818410-37818432 GTGCCCTAGCCGGTGGTGGTGGG - Intergenic
1184510076 22:44928264-44928286 GTGGCCTGGCAGTTCGAGGACGG - Intronic
950158679 3:10742859-10742881 ATGGCCAAGCAGGTGGAGCAAGG - Intergenic
950686259 3:14620648-14620670 GTGTCCTAGCAACTGGAAAAGGG - Intergenic
952532904 3:34280118-34280140 GGTTCCTAGAAAGTGGAGGAAGG + Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
956823287 3:72973195-72973217 GTGTTCTACCAGCTGGGGGAGGG + Intronic
960673765 3:120175700-120175722 CTGGCTTAGAAGGTGGAGGAGGG + Intronic
962160273 3:132991856-132991878 GGGACATAGAAGGTGGAGGAGGG - Intergenic
962380768 3:134896846-134896868 GTGTCCAAGCGAGTGGAGGTTGG + Intronic
962746644 3:138401992-138402014 CTGTCCTGGCCGCTGGAGGAGGG - Intronic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
965159031 3:165106984-165107006 GTCTCCTAGAAGGGGGAGGGAGG + Intergenic
966669517 3:182511245-182511267 GTGTCCTATCAGGTGGTAGAAGG + Intergenic
967890395 3:194360519-194360541 GAGTCCTACCAGGTGGTCGAAGG + Exonic
969167479 4:5329501-5329523 GTGCTCTAGCAGGTGAAGGTGGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969521009 4:7677826-7677848 GCTGCCTAGCAGGTGGAGGAGGG - Intronic
969562815 4:7960254-7960276 GTGTCCTAGATGGTGGAGCCCGG - Intergenic
969714355 4:8861176-8861198 GCTTCCCAGCAGGTAGAGGAGGG - Intronic
970583549 4:17494481-17494503 GTGTCATTGCATGTGGAGGAGGG - Intronic
970844775 4:20523438-20523460 GTGTCCTTGCCAGTGGAGGCTGG + Intronic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
974351456 4:60752656-60752678 GAGTCCTTGAAGGTGTAGGAAGG + Intergenic
975724258 4:77276678-77276700 GGGTCATAGTAGCTGGAGGATGG + Intronic
976783302 4:88786254-88786276 GAGGGCTAGCAGGTGGAGGTGGG - Intronic
976787637 4:88839823-88839845 TTGTCCTGGGGGGTGGAGGATGG + Intronic
977787744 4:101058461-101058483 TTGTCCTACCAGGTGCAGGGAGG - Intronic
980503059 4:133682058-133682080 TTCTCCTGGCAGATGGAGGATGG - Intergenic
985397139 4:189555940-189555962 GTGTCCTATGTGGTGGAGGGTGG + Intergenic
986085207 5:4437965-4437987 GAATCCGAGCAGTTGGAGGAAGG - Intergenic
986170408 5:5310233-5310255 GGGTCCTACGAGCTGGAGGATGG - Intronic
987375004 5:17225732-17225754 TTGTCGTGGCAGGTGGTGGATGG + Intronic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
988192926 5:27963301-27963323 GGGTGCTAGCAGGTGCGGGAGGG + Intergenic
988226027 5:28412223-28412245 GGTTGCTAGAAGGTGGAGGATGG + Intergenic
988559089 5:32264131-32264153 TTGTCCTAGCAGGTAGTGGCAGG - Intronic
990327492 5:54692584-54692606 CTGGCCTAGGATGTGGAGGATGG + Intergenic
991489343 5:67166883-67166905 GTTTCCTAGCTGGGGGAGGCTGG - Exonic
992682013 5:79162993-79163015 TTGTCCTAGGAGGTTGAGGCAGG - Intronic
994653274 5:102556712-102556734 GACTACTAGAAGGTGGAGGAGGG + Intergenic
996526346 5:124484148-124484170 GTGTACTACTAGATGGAGGAGGG - Intergenic
996594350 5:125184478-125184500 GTGTCCTCGCAGGTGGGGGGTGG - Intergenic
1001722010 5:173864621-173864643 GTGGCCCAGCAAGTGGAGGCAGG - Intergenic
1001955324 5:175844783-175844805 GTGCCTTTGCAGGGGGAGGAAGG + Intronic
1002604780 5:180376154-180376176 GTGCACATGCAGGTGGAGGATGG - Intergenic
1002840532 6:901459-901481 GTGTGCTAGGAGCTGGAGAAAGG - Intergenic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004879977 6:19997796-19997818 GGTTACTAGCAGCTGGAGGAAGG + Intergenic
1005962305 6:30703027-30703049 GTGCCCTAGAAAGTGGTGGAAGG - Intronic
1006155550 6:32011155-32011177 GTCTCCTACCAGCTGGCGGACGG - Intergenic
1006161882 6:32044009-32044031 GTCTCCTACCAGCTGGCGGACGG - Exonic
1006745231 6:36336977-36336999 GGGTGGTAACAGGTGGAGGAAGG - Intergenic
1007090462 6:39181248-39181270 TTGTGGTAGGAGGTGGAGGAAGG - Intergenic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1007632019 6:43277826-43277848 ATCTCCTCGCAGGTGGAGCAGGG + Intronic
1008960185 6:57258610-57258632 GTGTCCTAACAGGTCAAGAATGG - Intergenic
1012508535 6:99976439-99976461 GTGTCCTAGGAGATGAAGCATGG + Intronic
1012518742 6:100094137-100094159 GAGCCCTGGCTGGTGGAGGAGGG + Intergenic
1013259463 6:108426831-108426853 GTGGAGTAGAAGGTGGAGGAGGG - Intronic
1013366896 6:109443658-109443680 GTGTCCTGGCGGCTGGAGGAGGG + Exonic
1015700311 6:136028710-136028732 GTGTCCTTACATGTGGAAGAGGG - Intronic
1016271175 6:142292441-142292463 ATGTCCTACCTGGTGGAGAAGGG - Intergenic
1016840437 6:148519690-148519712 GTGTCCAGGCTGCTGGAGGATGG - Exonic
1018638291 6:165884046-165884068 ATGTCAAAGCAGGTGGAGGAAGG + Intronic
1019154347 6:170029225-170029247 GTGTCCTTGCAGCAGGAGGCTGG + Intergenic
1019171748 6:170136790-170136812 GTTGAGTAGCAGGTGGAGGACGG - Intergenic
1019936457 7:4261398-4261420 GCGTCCTTGCAGCTGGAGGCGGG - Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020933532 7:14430133-14430155 GGGTCCTAGCAAGTGGCTGATGG + Intronic
1021618255 7:22524579-22524601 GTGTCATAGCTGTTAGAGGAGGG + Intronic
1022220643 7:28310160-28310182 GTGTCCTTGCGGATGGAGAAAGG + Intronic
1022400604 7:30032992-30033014 GTTTCCCCTCAGGTGGAGGAAGG + Intronic
1022911457 7:34902862-34902884 GGGTCCTAGTAAGTGGAAGAAGG + Intergenic
1022927848 7:35074050-35074072 GTGTCATAGCTGTTAGAGGATGG + Intergenic
1023815826 7:43949322-43949344 GTATCCTGGCAGGTGGAGCGTGG + Intronic
1023878776 7:44307062-44307084 GGGTCTGAGCAGGGGGAGGAGGG + Intronic
1023983714 7:45083442-45083464 GTGTCCCAGCAGGCTGAAGAGGG - Exonic
1023983738 7:45083562-45083584 GTGTCCCAGCAGGCTGAAGAGGG - Exonic
1023983762 7:45083682-45083704 GTGTCCCAGCAGGCTGAAGAGGG - Exonic
1023983785 7:45083802-45083824 GTGTCCCAGCAGGCTGAAGAGGG - Exonic
1023983808 7:45083922-45083944 GTGTCCCAGCAGGCTGAAGAGGG - Exonic
1023983831 7:45084042-45084064 GTGTCCCAGCAGGCTGAAGAGGG - Exonic
1023983854 7:45084162-45084184 GTGTCCCAGCAGGCTGAAGAGGG - Exonic
1023983877 7:45084282-45084304 GTGTCCCAGCAGGCTGAAGAGGG - Exonic
1024991084 7:55234886-55234908 GGGTCCAAGAAGGTGGAGAATGG + Intronic
1026738862 7:72965973-72965995 ATGTGCTGGCAGGTGGTGGACGG - Exonic
1026796591 7:73369669-73369691 CTGTGCTTGCAGGTAGAGGATGG - Intergenic
1027104872 7:75399096-75399118 ATGTGCTGGCAGGTGGTGGACGG + Exonic
1028374425 7:90131533-90131555 GTGTCATAGCTGTTAGAGGAGGG - Intergenic
1028931060 7:96413722-96413744 GTATCCCAGGAGGTGGAGAAGGG - Intergenic
1029110808 7:98212274-98212296 CTGTCCTAGGAGGTGGCGGCAGG - Exonic
1029578537 7:101420008-101420030 GTGTCCTGCCAGGTGCAGAATGG + Exonic
1029705854 7:102275229-102275251 AGGTCCTAGCAGGTAGAGGAGGG - Intronic
1031528625 7:122850676-122850698 GAGTACTAGAAGCTGGAGGATGG - Intronic
1033060058 7:138097526-138097548 CTGTCCCAGCAGGGGGAGCAGGG + Intronic
1033564158 7:142562461-142562483 GTGTCCTAAAATGTGGAAGAGGG - Intergenic
1033800579 7:144897298-144897320 GTGTCTTACCAAGTGGAGAAAGG - Intergenic
1035115376 7:156519078-156519100 GTGTCCAGGCAGGTGCAGCAGGG - Intergenic
1035119379 7:156553016-156553038 ATGTCCAAGCAGGTAGAAGAAGG - Intergenic
1035344796 7:158190951-158190973 GTGTCTTAGCAGGTGGTGCCTGG - Intronic
1035746327 8:1964133-1964155 GTCTCCTAGGGGGTGGTGGAAGG - Intergenic
1037657220 8:20895251-20895273 GTGGCCCTGCAGGTGGAGGCTGG - Intergenic
1038428777 8:27483291-27483313 ATGTCCTGGCAGGTGGGGCATGG - Intergenic
1038906630 8:31911573-31911595 GGGTCTTACCAGATGGAGGAGGG + Intronic
1039805916 8:40998000-40998022 GGGTCCTTCCAAGTGGAGGATGG - Intergenic
1040564419 8:48553076-48553098 GAGCCCTGGAAGGTGGAGGAAGG + Intergenic
1041021650 8:53644085-53644107 CTGTCTCAGCAGGTGAAGGAAGG - Intergenic
1041255478 8:55976681-55976703 GTGGGCTAGCAGGTGGAAGGTGG + Intronic
1042509059 8:69592226-69592248 GTGTCCTAGAAACTGGAGAATGG + Intronic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1045494848 8:102699668-102699690 GTGTCCTTGCCGAAGGAGGAAGG + Intergenic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047347464 8:124042078-124042100 GTGTTGTGGCAGGTGGAGGAGGG - Intronic
1047973325 8:130105882-130105904 GTGTCATAGAAGGAGGTGGAAGG - Intronic
1048679919 8:136829881-136829903 GGGTTTTAGCAGGAGGAGGAGGG + Intergenic
1053351393 9:37415566-37415588 GTGTTCTAGCTGGGGGAGGCTGG + Intergenic
1056520422 9:87395995-87396017 GTGCCCTGGCAGGTGAAGGCAGG + Intergenic
1056568001 9:87791840-87791862 GTATCCTGTCAGATGGAGGAGGG - Intergenic
1057442676 9:95093238-95093260 GGGCCCTGGCAGATGGAGGATGG + Intergenic
1057569516 9:96193845-96193867 GTGTCAGAGCAGGTGGAGTGGGG + Intergenic
1057771860 9:97975216-97975238 CTGGCCTCGAAGGTGGAGGAAGG - Intergenic
1058659080 9:107252465-107252487 ATGTCCTAGAAGGTAGAGGAAGG + Intergenic
1059015086 9:110506734-110506756 GTTTCCAAGCAGGGGAAGGAGGG + Intronic
1059338546 9:113584062-113584084 GAGGCCGAGGAGGTGGAGGAGGG + Exonic
1059425995 9:114221260-114221282 GAGACATTGCAGGTGGAGGAAGG + Intronic
1062525140 9:136975180-136975202 CAGTCCTAGCCGGGGGAGGAGGG + Intergenic
1203663582 Un_KI270754v1:5568-5590 GTGTCCTATGTGGTGGAGGGTGG - Intergenic
1185550651 X:980746-980768 GTGTCCATGGAGGAGGAGGAGGG + Intergenic
1185695686 X:2192734-2192756 GGATGCTAGCAGGTGGAGGCCGG + Intergenic
1187029661 X:15472644-15472666 GGTTCCTAGGAGCTGGAGGAAGG + Intronic
1188986914 X:36776119-36776141 GAGTCCTAGCAAGTGGAAAATGG - Intergenic
1190530245 X:51367844-51367866 GTGTCCTTGCTGGTGGTGGTGGG - Intergenic
1190727430 X:53198775-53198797 GTGGCCCTGGAGGTGGAGGATGG - Exonic
1195015319 X:100773821-100773843 GACTACTAGCAGGTGGAGGAGGG - Intergenic
1195458210 X:105093454-105093476 GTGTGCTAGAAGCTGGAGAAGGG + Intronic
1195990134 X:110674235-110674257 GTGTCCCAGCACCTGGAGGCAGG + Intronic
1200110822 X:153740080-153740102 TTGCCCCTGCAGGTGGAGGAAGG + Exonic
1201964352 Y:19715626-19715648 GTGGCCTTGGAGGTGGAGGATGG - Exonic