ID: 900370274

View in Genome Browser
Species Human (GRCh38)
Location 1:2329132-2329154
Sequence CCTGTGGGCCCTTGCCGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900370262_900370274 13 Left 900370262 1:2329096-2329118 CCTGAGGGGTGTTCCCTGTTTGG 0: 1
1: 0
2: 1
3: 8
4: 109
Right 900370274 1:2329132-2329154 CCTGTGGGCCCTTGCCGGTGTGG 0: 1
1: 0
2: 3
3: 30
4: 164
900370261_900370274 23 Left 900370261 1:2329086-2329108 CCTTGAAAAGCCTGAGGGGTGTT 0: 1
1: 0
2: 0
3: 16
4: 206
Right 900370274 1:2329132-2329154 CCTGTGGGCCCTTGCCGGTGTGG 0: 1
1: 0
2: 3
3: 30
4: 164
900370267_900370274 0 Left 900370267 1:2329109-2329131 CCCTGTTTGGGGGAGCCTGTTCA 0: 1
1: 0
2: 0
3: 10
4: 153
Right 900370274 1:2329132-2329154 CCTGTGGGCCCTTGCCGGTGTGG 0: 1
1: 0
2: 3
3: 30
4: 164
900370268_900370274 -1 Left 900370268 1:2329110-2329132 CCTGTTTGGGGGAGCCTGTTCAC 0: 1
1: 0
2: 0
3: 5
4: 126
Right 900370274 1:2329132-2329154 CCTGTGGGCCCTTGCCGGTGTGG 0: 1
1: 0
2: 3
3: 30
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900370274 Original CRISPR CCTGTGGGCCCTTGCCGGTG TGG Intronic
900370274 1:2329132-2329154 CCTGTGGGCCCTTGCCGGTGTGG + Intronic
902391039 1:16106667-16106689 TCCGTGGACCCTTGCCAGTGGGG - Intergenic
902513013 1:16976379-16976401 CATGTGGGCTCTTGGCAGTGTGG - Intronic
902620279 1:17646787-17646809 CCTCTGGGCCCGTCCCGGCGAGG + Intronic
903063155 1:20684199-20684221 CCTGTGGGCCCTTGGGGCTGAGG + Intronic
903071612 1:20729605-20729627 TCTGTGGGCGCCTGTCGGTGTGG - Intronic
903577477 1:24347694-24347716 CCTGAGGGGCCCTGCCGGTGGGG + Intronic
904674141 1:32187898-32187920 CTTGTGGGGCCTTCCTGGTGGGG - Intronic
906774606 1:48518118-48518140 TCTGTGGACCCTTGCCAGTGGGG - Intergenic
907455317 1:54571918-54571940 CCTGCGGGCCCTTCCTGCTGGGG - Intronic
911136531 1:94446353-94446375 TCTGTGGACCCTTGCCAGCGGGG + Intronic
915179859 1:154048737-154048759 TCTGTGGACCCTTGCCAGCGGGG + Intronic
917593449 1:176501798-176501820 CCTGTGGTCCATTGCCCCTGGGG + Intronic
917799595 1:178558872-178558894 TCTGTGGACCCTTGCCAGTGGGG - Intergenic
924765276 1:247026220-247026242 TCTGTGGACCCTTGCCAGCGGGG + Intergenic
1066200239 10:33137348-33137370 GCTGTGGGCCCCTGGGGGTGAGG + Intergenic
1066802836 10:39209265-39209287 TCTGTGGACCCTTGCCAGTGGGG - Intergenic
1067133466 10:43587085-43587107 TCTGTGGACCCTTGCCAGCGGGG + Intergenic
1067386001 10:45818112-45818134 CCAGGGGGCCATTGCCAGTGTGG + Intergenic
1067582189 10:47452774-47452796 CCTCTCCGCCCTGGCCGGTGGGG - Intergenic
1069791174 10:71022117-71022139 CCTGTGGGCCCCTAGAGGTGAGG - Intergenic
1072543896 10:96419412-96419434 CCTGTGACCCCTTGCCTTTGAGG - Intronic
1072699900 10:97633204-97633226 CCTGAGGGCGGTTGCCTGTGGGG - Intronic
1072722153 10:97787703-97787725 CCTGTGGGCTCTTCCCGTGGGGG + Intergenic
1073084255 10:100878365-100878387 CCTGTGTGTCCTTGTGGGTGTGG - Intergenic
1073684469 10:105736826-105736848 GCTGTGTTCCGTTGCCGGTGAGG - Intergenic
1074980209 10:118613595-118613617 TCTGTGGACCCTTGCCAGCGGGG - Intergenic
1076757301 10:132579225-132579247 CCTGTGGGCCGGTGACGGAGGGG + Intronic
1077092763 11:787166-787188 CCTGTGGCCACTGGCCAGTGAGG + Exonic
1077350417 11:2090641-2090663 TCTGTGCGCACTTGCCTGTGGGG - Intergenic
1083856548 11:65395999-65396021 TCTGTGTGCCCTCGCAGGTGGGG + Intronic
1085320422 11:75570638-75570660 CCTGTGTGGCCTTGCCAGGGAGG + Intronic
1088226449 11:107625550-107625572 CATGTAGCCCCTTGCCTGTGGGG - Intronic
1092751496 12:11723751-11723773 CATGTGGGCCCCTGCAGTTGGGG - Intronic
1093527096 12:20115483-20115505 CCTGCGGGCCCTGGGCAGTGAGG - Intergenic
1095912914 12:47447284-47447306 TCTGTGGACCCTTGCCAGCGGGG - Intergenic
1096412501 12:51387620-51387642 CCTGTAGGCCCTTCCAGGTGGGG + Intronic
1096539483 12:52297023-52297045 CCTGTGGGCCCTTGCAGGAGTGG - Intronic
1097664195 12:62461487-62461509 CCTGCCGGCCCTGGCCAGTGAGG - Intergenic
1102349972 12:112184846-112184868 CCTGTGGGTCCTTCCTGGTGAGG + Exonic
1104961872 12:132491913-132491935 CCTGTGGGCCCAGGACGGGGTGG + Intronic
1105710871 13:23007686-23007708 TCTGTGGACCCTTGCCAGCGGGG + Intergenic
1106031652 13:26010446-26010468 CATGTGGGGCCTGGCTGGTGAGG + Intronic
1112971336 13:105266784-105266806 CCTGTGTGTCCTTGCCCCTGGGG - Intergenic
1113804640 13:113106164-113106186 CCCATGGGCCCCTGCCTGTGAGG + Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1117082432 14:52165843-52165865 TCTGTGAACCCTTGCCAGTGGGG + Intergenic
1117409814 14:55440519-55440541 CCTCTGCGCCCTGGCCGGAGCGG - Exonic
1122577291 14:102750527-102750549 CCTGTGTGCCGAGGCCGGTGCGG + Intergenic
1122652967 14:103236133-103236155 TCTGTGGACCCTTGCCAGCGGGG + Intergenic
1202835697 14_GL000009v2_random:76187-76209 CCAGTGAGGCCTTGCCAGTGAGG + Intergenic
1124620332 15:31270388-31270410 CCTGGGGGCCCTGGTCAGTGGGG - Intergenic
1125937537 15:43649387-43649409 CCTGTGGGCCCCTGCTGTGGCGG + Intronic
1125950437 15:43746807-43746829 CCTGTGGGCCCCTGCTGCGGCGG + Intronic
1127961831 15:63895890-63895912 CCTGTGGGGCCTTGTGGGTCTGG - Intergenic
1128304047 15:66586565-66586587 CCTGAGGGCCCTTGGTGGGGCGG + Intronic
1129880662 15:79004234-79004256 CCTGGGGGCCGTCTCCGGTGGGG + Intronic
1132216815 15:100068870-100068892 CCTTTGTTCCCTTGCTGGTGAGG - Intronic
1132605580 16:792465-792487 CCTGTGGCCCCTTGCGGTTCAGG - Exonic
1132644657 16:993323-993345 CCTGAGCGCCATTGCCGGGGAGG - Intergenic
1133181079 16:4055163-4055185 CCTGGGGGCCCTTCCCGGTGTGG - Intronic
1133223179 16:4327916-4327938 CCCCTGGGCCCTTGCGTGTGGGG + Intronic
1136300075 16:29328570-29328592 CCTGTGGCACCTTGGCGATGTGG - Intergenic
1139037697 16:62967482-62967504 CCTGTAAGCCATTGCAGGTGTGG + Intergenic
1140833333 16:78771040-78771062 CCTGAGGGCCTTTGCACGTGCGG - Intronic
1141673993 16:85507985-85508007 CCTGTGGCCCCCTGCCGAGGTGG + Intergenic
1142354356 16:89595315-89595337 CATGTGGGCCATGGCAGGTGTGG + Intronic
1142631470 17:1229080-1229102 CTGGTGGCCCCTTGCCGGTTCGG - Intergenic
1142873436 17:2836184-2836206 CCTGTGTTTCCTTGCCGGTTGGG + Intronic
1144829880 17:18125315-18125337 CTTGTGGGCCCTAGCCCCTGTGG + Intronic
1146850614 17:36218634-36218656 CCAGTGGGCCCCTGGAGGTGAGG + Intronic
1147165903 17:38593219-38593241 CCTGTGGGCCTTTGCCTCTGTGG - Intronic
1148133195 17:45274588-45274610 CCTCTGGGCCCTTGCAGGTGCGG - Exonic
1148195011 17:45706991-45707013 CCTCTGGGCCTTTGCCAGTGCGG - Intergenic
1151292836 17:73162934-73162956 CCTGAGGGTCTTTGCTGGTGTGG - Intergenic
1151529425 17:74695131-74695153 CCTCAGGGCCCCTGCCGGGGAGG + Exonic
1152963326 18:94094-94116 CCTGAGGGTCTTTGCTGGTGTGG - Intergenic
1161302811 19:3551230-3551252 CCTGGGAGCCCTGGCTGGTGCGG - Intronic
1161983402 19:7642022-7642044 CCTCTGGGCCCCTGGCGGGGAGG - Exonic
1162029750 19:7912275-7912297 CCTGTGGGCCCGAGGGGGTGGGG - Exonic
1162930809 19:13956584-13956606 CCTGGGGCCCCTTGTCTGTGTGG - Intronic
1163442624 19:17329369-17329391 CCCGTGGGTCCTCGCCGGGGTGG - Intronic
1163852156 19:19670217-19670239 CCTGCTGGCCCTTGGGGGTGGGG + Intronic
1164024908 19:21343144-21343166 TCTGTGGAACCTTGCCAGTGGGG - Intergenic
1164306349 19:24007123-24007145 TCTGTGGACCCTTGACAGTGGGG - Intergenic
1164531845 19:29054885-29054907 CCTGAAGACCCTTGCAGGTGGGG - Intergenic
1165866042 19:38939683-38939705 TCTGTGGACCCTTGCCAGTGGGG - Intronic
1166888907 19:45977935-45977957 CCTGAGTGCTCTTGCAGGTGTGG + Intergenic
925532812 2:4883605-4883627 CCTCTGGGCCAGGGCCGGTGAGG + Intergenic
926289380 2:11516637-11516659 GCTGTGGGCCCATGCGGTTGAGG + Intergenic
927118154 2:19925156-19925178 TCTGTGGACCCTTGCCAGTGGGG + Intronic
930183380 2:48386542-48386564 TCTGTGGACCCTTGCCAGTGGGG + Intergenic
931719475 2:65056683-65056705 CCTTTGTGCCCTTGCCGGCGGGG - Intronic
933929442 2:87133904-87133926 CTTGTGGGCCTTTTCAGGTGGGG + Intergenic
934000772 2:87709696-87709718 CTTGTGGGCCTTTTCAGGTGGGG + Intergenic
934562070 2:95318532-95318554 CTTGTGGGCCCAGGCCTGTGGGG + Intronic
934709103 2:96503615-96503637 CCTGTGGGCCCTTGCCAGGCTGG - Intronic
934752168 2:96800269-96800291 CCTGCGGGGCCTTGTCTGTGGGG - Intronic
935025783 2:99275773-99275795 TCTGTGGACCCTTGCCAGTGGGG - Intronic
935915686 2:107947244-107947266 TCTGTGGACACTTGCCAGTGGGG - Intergenic
936240877 2:110787656-110787678 CCCATGGGTCCTTGCAGGTGTGG + Intronic
936363497 2:111829481-111829503 CTTGTGGGCCTTTCCAGGTGGGG - Intronic
936799763 2:116252802-116252824 TCTGTGGACCCTTGCCAGCGGGG + Intergenic
937785503 2:125890098-125890120 CCAGTGGGCCCCTGGAGGTGAGG - Intergenic
938085967 2:128402228-128402250 CCCTTGGGCCTTTGCGGGTGGGG + Intergenic
940335816 2:152526180-152526202 CCTGTGGGCCATTCCAGGTAAGG + Intronic
941916605 2:170817526-170817548 CCGGTGGGCCCTTCTCTGTGGGG + Intronic
943062375 2:183052471-183052493 TCTGTGGACCCTTGCCAGCGGGG - Intergenic
946181234 2:217950441-217950463 CCTGTGGGCCCTGGTCACTGGGG + Intronic
946206663 2:218113841-218113863 TCTGTGGACCCTTGCCAGTGGGG + Intergenic
946596334 2:221309781-221309803 TCTGTGGGACCCTGCAGGTGTGG + Intergenic
1169403705 20:5305364-5305386 TCTGTGGACCCTTGCCAGCGGGG + Intronic
1171456821 20:25276937-25276959 CCTGTAGGCCCTTCCCGGGCAGG - Intronic
1172130348 20:32650827-32650849 CCTCTGGGACCTTGGCGGTGGGG - Intergenic
1175269254 20:57722305-57722327 GCTGTTGGCTCTTGCAGGTGGGG + Intergenic
1177393770 21:20507974-20507996 CCAGTGGGCCCTGCCTGGTGAGG + Intergenic
1179555575 21:42173360-42173382 CATTTGGGCCCTGGCCGGTGTGG + Intergenic
1181470438 22:23135914-23135936 CCTGTGGGCACTTGGCTGAGGGG - Intronic
1182415929 22:30221462-30221484 GCCGTGGGCCGTGGCCGGTGTGG - Intergenic
1184036564 22:41920814-41920836 CCCCAGGGCCCTGGCCGGTGGGG - Intergenic
1184492833 22:44820198-44820220 CCTGTGGGCCCTTTCCCGAGAGG + Intronic
1185094811 22:48800445-48800467 CCTTTGGGGTCTTGCCTGTGGGG - Intronic
950451400 3:13067673-13067695 TCTGTGTGCCCTTGTGGGTGGGG - Intronic
953930422 3:47003157-47003179 CCCTTGGCCCCTTGCAGGTGAGG + Exonic
954118091 3:48478312-48478334 CCTGTAGGCCCAGGCAGGTGTGG - Intronic
955035277 3:55261698-55261720 CCAGTGGGCCCCTGGAGGTGAGG + Intergenic
956487804 3:69740225-69740247 CCTCTGGGCTCCTGCAGGTGAGG + Intronic
959198080 3:103211043-103211065 TCTGTGGACCCTTGCCAGTGGGG + Intergenic
961181027 3:124877675-124877697 CATGTGGGCACTTGCTGGTCAGG - Intronic
961417911 3:126774731-126774753 CCAGTTGGCCTTTGCTGGTGAGG + Intronic
966968236 3:185017648-185017670 TCTGTGGACCCTTGCCAGCGGGG - Intronic
967985829 3:195094738-195094760 CTTGTGGCCCCTTGTCTGTGTGG - Intronic
968440716 4:623217-623239 CCTCTGGGCCCCTGCAGGTAAGG + Intergenic
968573179 4:1353179-1353201 CAGGTGGGCCCCTGCCGGTCTGG + Exonic
968881448 4:3302352-3302374 GCTTTGGGCCCTGGCCGTTGTGG + Intronic
969530689 4:7728677-7728699 CCTGTGGTCCCTCCCCTGTGAGG - Intronic
970817899 4:20179286-20179308 CCAGTGGGCCCTGGGCAGTGAGG - Intergenic
972095214 4:35340290-35340312 CCAGTGGGCCCTTAGAGGTGAGG + Intergenic
974636012 4:64564726-64564748 TCTGTGGACCCTTACCAGTGGGG + Intergenic
975352240 4:73359268-73359290 TCTGTGGACCCTTGCCAGCGGGG + Intergenic
976462620 4:85330221-85330243 CCTCTGGGCCCTTGCCTCCGTGG - Intergenic
976557108 4:86462183-86462205 TCTGTGGACCCTTGCCAGCGGGG + Intronic
977642082 4:99368320-99368342 TCTGTGGACCCTTGCCAATGGGG + Intergenic
979893675 4:126132015-126132037 TCTGTGGACCCTTGCCAGCGGGG + Intergenic
982066107 4:151656121-151656143 CCTGTGGGCCCATGGTGGTTTGG + Intronic
984169813 4:176345868-176345890 ACTGTGGACCCTTGCCAGCGGGG + Intergenic
985683893 5:1271679-1271701 CCTGTGGCCCTTTGCAGATGTGG - Intronic
985735969 5:1583253-1583275 TCTGTGGACCCTTGCCAGCGGGG - Intergenic
988811064 5:34785964-34785986 TCTGTGGACCCTTGCCAGCGGGG - Intronic
989758801 5:44987691-44987713 TCTGTGGACCCTTGCCAGTGGGG + Intergenic
990109574 5:52306613-52306635 TCTGTGGACACTTGCCAGTGGGG + Intergenic
995592436 5:113713373-113713395 TCTGTTGACCCTTGCCAGTGGGG + Intergenic
996167617 5:120244553-120244575 GCTGAGGGCAATTGCCGGTGAGG + Intergenic
1001910956 5:175517394-175517416 CCAGTGGGCCCTTCCATGTGGGG - Intronic
1001950864 5:175815479-175815501 CCTGGGGCCCCGTGCCTGTGTGG - Intronic
1002536050 5:179876120-179876142 CATGTGGGCCCTTGCAGGGAGGG - Intronic
1002536324 5:179878224-179878246 CCTGTGGTCCCAGGCCTGTGTGG - Intronic
1003174810 6:3746615-3746637 CCAGTGGGCCCTTGCAAGTGGGG - Intronic
1003370752 6:5523566-5523588 CCTGTGGGCTCTTTCTGCTGCGG + Intronic
1009062778 6:58417563-58417585 TCTGTGGACCCTTGCCAGTAGGG - Intergenic
1009250450 6:61292110-61292132 TCTGTGGACCCTTGCCAGTGGGG - Intergenic
1009955419 6:70447470-70447492 TCTGTGGACCCTTGCCAGCGGGG - Intronic
1017000840 6:149996059-149996081 CCAGTGGCCCCTGGCTGGTGGGG - Intergenic
1018364157 6:163100585-163100607 GCTGTGGGCCCAGGCAGGTGTGG - Intronic
1021347555 7:19547277-19547299 GCTTTGGTCCCTTGCTGGTGAGG + Intergenic
1021442201 7:20689318-20689340 GCTGTGGTACCTTGCTGGTGGGG + Intronic
1023676648 7:42636667-42636689 TCTGTGGACCCTTGCCAGCGGGG + Intergenic
1023804590 7:43863584-43863606 TCTGTGGACCCTTGCCAGCGGGG - Intergenic
1024528792 7:50373266-50373288 TGTGTGGGCGCTTGCAGGTGGGG - Intronic
1033506506 7:142007924-142007946 TCTGTGTGCCCTTGCTGCTGGGG + Intronic
1034581077 7:152043278-152043300 CCGGTGGACCCTTGCCAGCGGGG - Intronic
1034942729 7:155242048-155242070 TCTGTGGACCCTTGCCAGCGGGG - Intergenic
1040318938 8:46280166-46280188 TCTGTGGACCCTTGCCACTGGGG + Intergenic
1040381569 8:46877983-46878005 TCTGTGGACCCTTGCCAGTGAGG + Intergenic
1040944969 8:52874462-52874484 CCTCTTGGCCTTTGCTGGTGGGG + Intergenic
1040956221 8:52982792-52982814 TCTGTGGATCCTTGCCAGTGGGG - Intergenic
1042446486 8:68890771-68890793 TCTGTGGACCCTTGCCAATGAGG + Intergenic
1044018248 8:87073330-87073352 CTTCTGTGCCCTTGCCGGAGAGG + Intronic
1045277804 8:100722548-100722570 CCTGTGGCCTCTTCCCGCTGCGG + Exonic
1047942111 8:129836389-129836411 CCTGTTGGTCCTAGCTGGTGTGG + Intergenic
1049753075 8:144294802-144294824 CCTCAAGGCCCTTGCCTGTGTGG - Intronic
1055702560 9:78961439-78961461 CCTCTGGGCTTTTGCCGGTGTGG + Intergenic
1057293340 9:93820771-93820793 CTTGGGGGCCCTTGCTGGTCTGG + Intergenic
1057442304 9:95091283-95091305 ACTGTGGCCCCTTGCCGGGTGGG - Intergenic
1061602748 9:131682474-131682496 TCTGTGGACCCTTGCCAGTGGGG + Intronic
1062441751 9:136572842-136572864 CCGGTGGGCCCTTCCCCATGAGG + Intergenic
1062634811 9:137485134-137485156 CCTGGGGACGCTTGCAGGTGTGG - Intronic
1062734764 9:138129609-138129631 CCTGAGGGTCTTTGCTGGTGTGG + Intergenic
1189047774 X:37611491-37611513 CCTGTGGTCCCCTTCTGGTGTGG + Intronic
1192206076 X:69097286-69097308 CATGTGGGCCCTTGCCTGAGGGG - Intergenic
1192317747 X:70065920-70065942 CCTGTGTGCCCTCCCCAGTGAGG - Intergenic
1192687536 X:73322989-73323011 TCTGTGGACCCTTGCCAGCGGGG - Intergenic
1193048748 X:77079303-77079325 TCTGTGGACCCTTGCCAGTGGGG + Intergenic
1194536071 X:95107123-95107145 TCTGTGGACCCTTGCCAGTGGGG - Intergenic
1201370195 Y:13254661-13254683 TCTGTGGACCCTTGCCAGTGGGG + Intronic
1201782315 Y:17737296-17737318 CCTTTGTGCCCTTGCTGGAGAGG + Intergenic
1201819238 Y:18168692-18168714 CCTTTGTGCCCTTGCTGGAGAGG - Intergenic
1202100147 Y:21299035-21299057 CTGGTGGGCCCTTGAAGGTGAGG + Intergenic