ID: 900370967

View in Genome Browser
Species Human (GRCh38)
Location 1:2331983-2332005
Sequence CGCAGCGGCGGGAGAGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 436}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900370967_900370976 13 Left 900370967 1:2331983-2332005 CCTGCGCCTCTCCCGCCGCTGCG 0: 1
1: 0
2: 4
3: 34
4: 436
Right 900370976 1:2332019-2332041 TGCGCCTCTCCCGAAATTACAGG 0: 1
1: 0
2: 0
3: 2
4: 20
900370967_900370978 17 Left 900370967 1:2331983-2332005 CCTGCGCCTCTCCCGCCGCTGCG 0: 1
1: 0
2: 4
3: 34
4: 436
Right 900370978 1:2332023-2332045 CCTCTCCCGAAATTACAGGCTGG 0: 1
1: 0
2: 1
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900370967 Original CRISPR CGCAGCGGCGGGAGAGGCGC AGG (reversed) Intronic
900349672 1:2228503-2228525 GGCGGCGGCGGGCGCGGCGCGGG + Intergenic
900370967 1:2331983-2332005 CGCAGCGGCGGGAGAGGCGCAGG - Intronic
901055692 1:6447832-6447854 CCCAGCTTAGGGAGAGGCGCAGG + Intronic
901443659 1:9293647-9293669 AGCAGCGGAGGGAGAGCCGGAGG + Intronic
901483072 1:9539486-9539508 CGCAGAGGCCGGTGAGGCGCCGG + Exonic
901529656 1:9844879-9844901 CTCAGCAGAGGGAGAGGCTCAGG + Intergenic
901635529 1:10668513-10668535 CCCAGAGACGGGAGAGGCGAGGG + Intronic
902042841 1:13505238-13505260 CCCAGCTGCGGGAGTGGTGCTGG - Intronic
902309162 1:15567603-15567625 CGCAGCTGCTGGAGAGGCACTGG + Intronic
902478700 1:16700805-16700827 CCCAGCTTAGGGAGAGGCGCAGG - Intergenic
902586177 1:17439744-17439766 CGCGGCGGGGCGGGAGGCGCGGG + Intergenic
902916698 1:19644135-19644157 CGCCGCGGCGGCAGGGGCCCCGG - Intronic
903072195 1:20732042-20732064 TGCGGCGGCGGGAGACGCGGGGG - Intronic
903907292 1:26696171-26696193 GGCGGCGGCGGCCGAGGCGCCGG - Exonic
904682704 1:32240351-32240373 CGAAAAGGCGGGAGAGGGGCGGG + Intergenic
904751068 1:32741774-32741796 CCGAGCGGCGGGCGGGGCGCAGG - Intergenic
905179136 1:36155976-36155998 CGTGGCCGTGGGAGAGGCGCCGG + Intronic
906044503 1:42817326-42817348 CGCGCCGGGGGGAGGGGCGCAGG + Intronic
906062649 1:42958543-42958565 CGGGGCGGCGGGGGAGGCCCTGG + Intronic
907091447 1:51729598-51729620 CGCAGCGGCGGGAGGGCGTCCGG - Intronic
907275366 1:53313968-53313990 GGCAGGGGCGGGGGAGGCCCAGG + Intronic
912305203 1:108560108-108560130 GGCAGCGGCGGCGGAGGCGGCGG + Exonic
912416218 1:109509695-109509717 CCCAGCGGAGGGAGCGGCGTGGG + Intronic
912824695 1:112894835-112894857 AGCAGCTGTGGAAGAGGCGCCGG + Intergenic
914817084 1:151071075-151071097 GGCAGCGGCGGGAGGGGGACGGG + Intronic
914845901 1:151283271-151283293 CGCAGAGGAGGGCGAGGGGCTGG - Intronic
914889831 1:151612546-151612568 TGCAGGGGCAGGAGGGGCGCGGG - Intronic
915225030 1:154405668-154405690 GGCCGCGCCGGGAGCGGCGCTGG + Exonic
915503573 1:156337855-156337877 CGCAGGGGCGGGGGAAGCGTGGG + Intronic
915549644 1:156624773-156624795 CGCGCTGGCGGGTGAGGCGCGGG + Exonic
915977563 1:160400859-160400881 CGCAGCGGCGGGTGAGTGCCGGG + Exonic
916437763 1:164792609-164792631 GGCAGCGGCGGCAGCGGCGGCGG + Exonic
916940036 1:169668045-169668067 AGCAGTGGAGGGAGAGGTGCGGG + Intronic
918480648 1:184974033-184974055 CGAGGCGGCGGGAGCGGCGAAGG + Intronic
920209037 1:204314766-204314788 CGCAGGGGCGGTAGAGATGCTGG + Intronic
920367786 1:205457126-205457148 CGCAGGGGCGGGGGAGGGGACGG + Intergenic
920912720 1:210233169-210233191 CGCAGCGGCCGGAGCGGAGTCGG + Intronic
921060445 1:211579662-211579684 CTCGGCGGCGGGGGAGGGGCCGG + Intergenic
921096251 1:211889538-211889560 AGGGGCGGAGGGAGAGGCGCGGG + Intergenic
921217740 1:212951484-212951506 CGCGGCGGCGGCAGCGGCGGCGG - Exonic
921229204 1:213051378-213051400 GGCGGCGGCGGCAGAGGCGGCGG + Exonic
922513138 1:226186439-226186461 CGCGGCGGCTGGAGCAGCGCTGG - Exonic
922804555 1:228378567-228378589 CCCAGCGGCGGGAGGGGTGTGGG - Intronic
923141061 1:231162091-231162113 GGCAGCGGCGGGAGGGAGGCGGG + Intronic
1063418128 10:5889940-5889962 AGCAGCGGCGGTCGAGGGGCGGG - Intergenic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1064208974 10:13347780-13347802 CGCGGCGGCGGCGGCGGCGCGGG + Intronic
1064619586 10:17201636-17201658 GGCTGCGGCGGCTGAGGCGCGGG - Exonic
1066001052 10:31104284-31104306 CGCAGCGGAGAGTGAGGGGCTGG - Intergenic
1066464517 10:35640831-35640853 CGCGGCGGCGGCAGGGGCGGTGG - Exonic
1067080655 10:43210594-43210616 CTCAGGGGCAGGAGAGGCACTGG + Intronic
1067474455 10:46556687-46556709 CGGGGCGGCGGGAGGGGCGGCGG + Intergenic
1069698337 10:70404246-70404268 GGCGGCGGCGGGAGCGGAGCGGG + Intergenic
1070660618 10:78303108-78303130 CGCGGCGGCGGGAAAGGCCCTGG + Intergenic
1071603882 10:86971669-86971691 CGCTGGGGCGTGAGGGGCGCGGG - Intronic
1071997518 10:91162876-91162898 CGCGGCGGCGGCGGCGGCGCTGG - Intergenic
1073049193 10:100656702-100656724 CGCAGCGGCGGGCGAAGGGGCGG + Intergenic
1074859793 10:117501629-117501651 CCCAGCAGGTGGAGAGGCGCAGG + Intergenic
1075031828 10:119029399-119029421 CGGAGCGGCGCCCGAGGCGCCGG + Intergenic
1077053098 11:576491-576513 CACGGCGGCGGCAGAGGCGGCGG + Exonic
1077068416 11:655538-655560 CGCAGCTGCGGGAGGGGCCGTGG + Intronic
1077898825 11:6474013-6474035 CGCGGCGGCGGGCGGGGCGTGGG - Intronic
1077910963 11:6571054-6571076 CACAGCGGCGGGAGGGGCACGGG - Exonic
1078891296 11:15560913-15560935 AGGTGCGGAGGGAGAGGCGCCGG + Intergenic
1079191017 11:18276463-18276485 CGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1079450526 11:20597131-20597153 TGCAGAGGCGGGTGACGCGCAGG - Intergenic
1079689403 11:23403533-23403555 CGCGGCGGCGGCGGCGGCGCGGG - Intergenic
1080107531 11:28526154-28526176 AGGTGTGGCGGGAGAGGCGCAGG - Intergenic
1080730125 11:34941916-34941938 GGCAGTGGCGGAAGAGGAGCGGG - Intronic
1082206008 11:49434623-49434645 CGCAGAGGCCGGTGAGGCGCGGG - Intergenic
1083176228 11:60951818-60951840 AACAGCTGCAGGAGAGGCGCGGG - Intronic
1083811551 11:65109408-65109430 GGCAGAGGCGGGAGAGCAGCAGG - Exonic
1083876009 11:65524924-65524946 GGGAGGGGCGGGAGAGGGGCGGG - Intergenic
1084102408 11:66958345-66958367 GGCAGCAGCGGTAGAGGCGGCGG - Exonic
1084301657 11:68256449-68256471 GACAGCGGCGGGGGAGGAGCGGG - Intergenic
1084526667 11:69702477-69702499 CGGGGCCGCGGGAGGGGCGCGGG + Intronic
1085353396 11:75815248-75815270 GGCAGCGGCGGCAGCGGCGGCGG + Exonic
1087034275 11:93740965-93740987 CGCTGCCGGGTGAGAGGCGCTGG - Intronic
1087672758 11:101127556-101127578 GGCGGCGGCGGCAGAGGCGGAGG + Exonic
1090517612 11:127445838-127445860 CTCATCGGCTGGAGAGGAGCAGG - Intergenic
1090635798 11:128689859-128689881 CGCGGCGGCGGGAGGGCCGGGGG - Intronic
1091124480 11:133082735-133082757 CGCAGCGGCGGGACGGGCCGCGG - Intronic
1091211329 11:133864018-133864040 CACAGTGGCGGGGGAGGGGCGGG + Intergenic
1091571520 12:1691081-1691103 CGCGGCGGCGGCAGCGGCGGCGG + Exonic
1092525108 12:9305087-9305109 CCCAGCTGTGGGAGAAGCGCGGG - Intergenic
1092538129 12:9405128-9405150 GCCAGCGGGGGGAGAGGGGCTGG - Intergenic
1092542158 12:9426731-9426753 CCCAGCTGTGGGAGAAGCGCGGG + Intergenic
1093346285 12:18040481-18040503 CACAGGGGCGGGGGAGGCTCAGG - Intergenic
1094041120 12:26122640-26122662 CGCGGCGGCGGCAGCGGCGGCGG - Exonic
1094510855 12:31095702-31095724 CCCAGCTGTGGGAGAAGCGCAGG - Intronic
1095431981 12:42144465-42144487 CGCGGCGCCGTGAGAGGCGCCGG - Exonic
1096670945 12:53197924-53197946 CACCGCGTCGGGAGAGGCGGAGG - Exonic
1097107676 12:56634972-56634994 GGCGGCGGCGGCAGAGGCGCAGG + Intronic
1097284235 12:57865373-57865395 CGCTCCGGCGGGGGAAGCGCGGG - Intergenic
1097990151 12:65825240-65825262 TGCAGCGGCGGTAGCGGCGGCGG + Exonic
1098498801 12:71166578-71166600 AGGTGTGGCGGGAGAGGCGCGGG - Intronic
1100611402 12:96194357-96194379 CGGGGCGGCGGGGGAGGCGCGGG + Intergenic
1100869314 12:98894535-98894557 CGCAGCCGGGGCAGAGGCGGAGG - Intronic
1101605879 12:106247582-106247604 GGCAGCGGCGGCGGAGGCGGAGG + Exonic
1101813628 12:108129304-108129326 GGCGGCGGCGGCAGCGGCGCGGG + Intergenic
1102962060 12:117099345-117099367 CGCAGCGGCGGGACTGGCCTCGG + Exonic
1103074066 12:117968332-117968354 CGCAGTGGTTGGAGAGGCGGAGG - Intronic
1103359059 12:120342875-120342897 AGCAGGGCCGGGAGAGGGGCGGG + Exonic
1103558411 12:121779516-121779538 CGCAACGGCAGAAGAAGCGCCGG - Exonic
1103778522 12:123384009-123384031 CGAAGAGGCGGGAGAAGGGCGGG + Exonic
1104901159 12:132190193-132190215 CCGCGCGGCGGGAGAGGGGCCGG - Intergenic
1105298217 13:19109277-19109299 CGAGGCTGGGGGAGAGGCGCCGG - Intergenic
1105578553 13:21674167-21674189 CGCAGCGGCAGGAGAGTTGGTGG + Intronic
1106810033 13:33350241-33350263 CACGGGGGCGGGGGAGGCGCCGG - Intronic
1108373450 13:49792654-49792676 AGTAGCGCCGGGGGAGGCGCGGG + Exonic
1109201831 13:59439900-59439922 AGGTGCGGAGGGAGAGGCGCAGG + Intergenic
1112504960 13:99970054-99970076 AGCAGCGGCGGAAGCGGCGGCGG + Intronic
1113493984 13:110713802-110713824 GGCAGCGGCGGCCGCGGCGCTGG + Intronic
1115592210 14:34874959-34874981 GGCGGCGGCGGGCGAGGAGCCGG - Intronic
1116817864 14:49599796-49599818 CGCGGCGGCGGCAGCGCCGCGGG + Intronic
1117449778 14:55839498-55839520 AGCTGTGGAGGGAGAGGCGCCGG + Intergenic
1118925681 14:70188451-70188473 CGCTGCGACCGGTGAGGCGCCGG - Exonic
1119743213 14:77027301-77027323 CGCAGCGGCGGCGGCGGCGGCGG + Exonic
1120190639 14:81436491-81436513 AGGAGCGGCGGGAGCGGCGCCGG - Intergenic
1120429802 14:84399773-84399795 AGGTGTGGCGGGAGAGGCGCGGG - Intergenic
1121279298 14:92687778-92687800 GGCAGAGACGGGAAAGGCGCAGG + Intronic
1121417541 14:93789241-93789263 CGCAGCCTCGGGAGAGGCTTGGG - Intergenic
1122130722 14:99603436-99603458 GGCGGCGGCGGGGGCGGCGCCGG - Exonic
1122552078 14:102555613-102555635 CCCGGCGGCGGGGGAGGCGGCGG + Intergenic
1122707279 14:103629214-103629236 TTCGGCGGCGGGAGCGGCGCAGG + Intronic
1122722072 14:103727742-103727764 CGCAGCGGCGACAGTGGTGCTGG - Exonic
1122827323 14:104376576-104376598 CACAGCGGCTGGAGAGGCAGCGG - Intergenic
1122992097 14:105241271-105241293 CGCAGAGGCCCGAGGGGCGCCGG + Exonic
1122996415 14:105267728-105267750 GGCAGCAGAGGGAGAGGAGCAGG + Intronic
1124323601 15:28737740-28737762 CGCAGCGGCGCGAGGGGGCCCGG + Intronic
1124527485 15:30470936-30470958 CGCAGCGGCGCGAGGGGGCCCGG + Intergenic
1124771168 15:32536747-32536769 CGCAGCGGCGCGAGGGGGCCCGG - Intergenic
1125429502 15:39581066-39581088 CGCAGCGGCTGGCAAGGCGGAGG - Intronic
1125674504 15:41494943-41494965 CGCAGGGGAGGGAGGGGCGTGGG + Intronic
1126113378 15:45187979-45188001 CGCAGCGGCGGGTGGGGGGCGGG + Intronic
1126150887 15:45522783-45522805 CGCAGGGCGGGGAGAGGCGGTGG - Exonic
1127144108 15:56007282-56007304 TGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1127144116 15:56007300-56007322 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1127144124 15:56007318-56007340 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1127144132 15:56007336-56007358 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1127144140 15:56007354-56007376 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1129191607 15:73941037-73941059 CGCAGCTGAGGGAAAGGCACTGG + Intronic
1129423979 15:75451657-75451679 GGCCGCGGCGGTAGAGGCGGCGG - Exonic
1129676015 15:77632737-77632759 CCCCGCGTCGGGAGAGGGGCCGG + Intronic
1130540273 15:84817144-84817166 CGCCGCGTCTGGAGAGGCCCGGG - Exonic
1130564427 15:84981701-84981723 GGCGGCGGCGGGAGCGGGGCCGG + Intronic
1131367584 15:91853486-91853508 CGCAGCGGCGGCCCAGGCCCAGG + Intergenic
1131466056 15:92655619-92655641 AGCAGCGGCAGGAGCGGGGCGGG + Exonic
1132942282 16:2514188-2514210 CGCGGCGGCGGGAGGGACTCGGG + Intronic
1132954382 16:2583748-2583770 GGCAGTGGCGGGTGAGGTGCTGG + Intronic
1132959963 16:2616415-2616437 GGCAGTGGCGGGTGAGGTGCTGG - Intergenic
1132978269 16:2721154-2721176 CGCCGCGGCGGAAGAGGCTCGGG + Intergenic
1134419320 16:14071329-14071351 GGCGGCGGCGGGAGCGGCGGCGG + Intronic
1136556693 16:31011184-31011206 CACCGCGGCGGGAGAGGCCCAGG - Intergenic
1136779022 16:32885642-32885664 CGGGGCGGCGGGAGAGCGGCGGG + Intergenic
1136891596 16:33975876-33975898 CGGGGCGGCGGGAGAGCGGCGGG - Intergenic
1138360767 16:56425498-56425520 GGCAGCAGCGGGAGCAGCGCGGG - Exonic
1139643594 16:68311089-68311111 TCCCGCGGCGGGTGAGGCGCTGG + Intronic
1141156775 16:81602576-81602598 CGCTGGGGCGGGCGAGGGGCAGG - Intronic
1141831145 16:86510531-86510553 AGCAGCGGCGGCAGCGGCGGCGG + Exonic
1141837678 16:86553419-86553441 CGGTGTGGAGGGAGAGGCGCGGG + Intronic
1141952566 16:87348275-87348297 TGCAGGGGCCGGAGAGGGGCTGG - Intronic
1142136484 16:88453965-88453987 CGCAGATGCGGGGGAGGGGCAGG - Intronic
1142303122 16:89270437-89270459 GGCAGGGGCGGGGGAGGTGCCGG - Intronic
1142321442 16:89385795-89385817 CGCAGCGGCGGGGGTGAGGCAGG - Intronic
1142379195 16:89721972-89721994 GGCTGCGTCGGGATAGGCGCTGG + Intronic
1142430285 16:90022728-90022750 AGCAGGGGCGGGAGCGGGGCTGG + Intronic
1142667275 17:1470294-1470316 GGCAGCGGGGGGCGTGGCGCAGG + Exonic
1143244134 17:5468723-5468745 GGCAGCGGCGGCAGAGGAGGAGG - Exonic
1143494974 17:7307652-7307674 GGCGGCGGCGGTAGAGGCGGCGG + Intronic
1143863066 17:9905196-9905218 GGCAGCGGCTGGGGAGTCGCTGG + Exonic
1146957226 17:36942726-36942748 CGGAGCGGCGGGGAGGGCGCAGG - Intronic
1147185650 17:38711859-38711881 CACAGCAGCGGGGGAGGCGGAGG + Exonic
1147400414 17:40177545-40177567 CGCTGCGGCGGCAGAGGCAGCGG - Intronic
1147571157 17:41571934-41571956 CGCAGCGGCGGGGGTGGCGGGGG - Exonic
1147598862 17:41733844-41733866 CGCAGTGCCAGGAGAGGGGCGGG - Intronic
1147793077 17:43025276-43025298 TGCAGGGGCGGGGGAGGCGGCGG + Exonic
1148157591 17:45432572-45432594 CGCTGGGGCGGGAGCTGCGCGGG - Intronic
1148440547 17:47709508-47709530 CTCAACGGAGGGTGAGGCGCTGG - Intronic
1148779389 17:50112923-50112945 CGCGGCAGCGGGAGAAGCTCCGG - Exonic
1148819793 17:50353869-50353891 GGCAGCAGCTGGGGAGGCGCTGG + Exonic
1151370813 17:73645125-73645147 GGCAGCGGCGGCCGAGGCGCTGG - Intergenic
1151497379 17:74466928-74466950 TGCAGAGCCGGGAGAGGCCCTGG - Intronic
1151673793 17:75588083-75588105 CCCAGCGCCTGGAGAGGCCCGGG + Intergenic
1151830259 17:76545157-76545179 CCCAGGGGTGGGAGAGGCCCCGG - Intronic
1152357716 17:79814836-79814858 GGCGGCGGCGGGAGGGGCGCGGG + Intergenic
1152924160 17:83079891-83079913 AGCAGCAGCGGGAGCGGCGGCGG - Exonic
1152952843 18:11075-11097 CGCAGCGCCGGCGCAGGCGCAGG + Intergenic
1152952851 18:11110-11132 CGCAGCGCCGGCGCAGGCGCAGG + Intergenic
1153489280 18:5630593-5630615 CGCAGCTGCGGGAGGAGCCCGGG - Intronic
1154097637 18:11432661-11432683 AGGTGCGGAGGGAGAGGCGCCGG - Intergenic
1155392632 18:25351889-25351911 AGCAGCGGCGGCAGCGGCGGCGG + Intronic
1155474804 18:26226959-26226981 AGCAGCCGGGGGAGCGGCGCCGG - Exonic
1158436954 18:57440634-57440656 CGCAGCGGCGGGACACGGCCCGG + Intronic
1160164304 18:76496161-76496183 CGCGGGGGCGGGGGAGGGGCGGG + Intronic
1160453345 18:78979750-78979772 GGCGGCGGCGGGGGGGGCGCGGG + Intergenic
1160773516 19:844234-844256 CGCGGGCGGGGGAGAGGCGCGGG - Intronic
1160773534 19:844283-844305 CGCGGGCGGGGGAGAGGCGCGGG - Intronic
1160773541 19:844300-844322 CGCGGGCGGGGGAGAGGCGCGGG - Intronic
1160773589 19:844432-844454 AGCGGCCGGGGGAGAGGCGCGGG - Intronic
1160773602 19:844466-844488 CGCGGGCGGGGGAGAGGCGCGGG - Intronic
1160858812 19:1229103-1229125 CTCGGCGGCGGGAGAGACGTGGG - Exonic
1160967777 19:1754116-1754138 CGCTGCGGCGGGGGTGGCGGGGG - Exonic
1161218972 19:3109247-3109269 GGCAGAGGCAGGAGAGGGGCTGG + Intronic
1161382151 19:3971086-3971108 CGTCGCGGCGGCAGGGGCGCGGG - Intronic
1161420345 19:4173176-4173198 AGCAGCGGAGGGAGAGGCGCCGG + Intergenic
1161425043 19:4198552-4198574 CGCAGGAGCGGGCGGGGCGCGGG + Intronic
1161461889 19:4402659-4402681 CGCGGCGGCAGCAGCGGCGCGGG + Exonic
1161505092 19:4639532-4639554 CGCGGCGGTGGGAGCAGCGCCGG - Intronic
1161562900 19:4983598-4983620 CGCAGCTGGTGGGGAGGCGCAGG + Intronic
1162030912 19:7916901-7916923 GGCGGCGGCGTCAGAGGCGCAGG - Exonic
1162378453 19:10318317-10318339 AGCAGCGGTGGGAGTGGCGGGGG - Exonic
1162421671 19:10568983-10569005 CTCAGCGGCGGCGGCGGCGCAGG - Intronic
1162486041 19:10961126-10961148 CGGAGGGGCGGGGGAGGCGCCGG + Exonic
1162577140 19:11505684-11505706 CGCAGCGGGCCGAAAGGCGCGGG - Exonic
1162740226 19:12769872-12769894 CGCAGCGGCGGCAGGTGCGGCGG - Exonic
1162909796 19:13842705-13842727 CGCCTCGGCGGCAGCGGCGCCGG - Intergenic
1162934159 19:13972870-13972892 GGCGGCGGCGGGGGAGGCGGTGG - Exonic
1163129650 19:15264638-15264660 GCCAGCGGCGGGAGAGCAGCCGG - Exonic
1163144960 19:15373813-15373835 GGCAGGGGCGGGAGCGGCGGCGG - Exonic
1163509603 19:17726991-17727013 CCCAGCCGCGGGAGGTGCGCCGG + Exonic
1163592876 19:18204203-18204225 AGTAGGGGCGGGAGCGGCGCGGG + Intergenic
1163607095 19:18281485-18281507 CGGCGCGGCGGGGGAGGCGGAGG - Exonic
1163796520 19:19341231-19341253 AGCTGGGGAGGGAGAGGCGCAGG - Exonic
1165493919 19:36141048-36141070 GGCGGCGGCGGGGGAGGCGGGGG + Exonic
1166219058 19:41353693-41353715 CGCAGTGGCGGGGGCGGCGGCGG + Exonic
1166306901 19:41940407-41940429 CGCGGCGGCGGGGGAGGGGCGGG - Intergenic
1166354786 19:42220493-42220515 CGCTAGGGCGGGAGCGGCGCGGG + Intronic
1166802583 19:45467618-45467640 CGCAGGCGCGGGCGGGGCGCGGG + Intronic
1167428906 19:49443197-49443219 CTCAGCGCCGGGAGATGGGCTGG - Intergenic
1167454568 19:49591560-49591582 AGCAGCGGAGGGAGCGGCGGCGG + Intergenic
1167613478 19:50518298-50518320 GGCAGCGGCGGGGGCGGCCCTGG - Exonic
1167622691 19:50568131-50568153 CGCAGCGGCGGCGGTGGGGCTGG + Intergenic
1167650034 19:50724050-50724072 CTCAGGGGTGGGAGAGGGGCTGG - Exonic
1167943092 19:52963017-52963039 CGCGGGGGCGGGAAAGGGGCGGG + Intergenic
1168721768 19:58558392-58558414 CGCGGCGGCGGCAGCGGCGGCGG - Exonic
1202712719 1_KI270714v1_random:26636-26658 CCCAGCTTAGGGAGAGGCGCAGG - Intergenic
927596553 2:24402850-24402872 AGGTGCGGAGGGAGAGGCGCGGG + Intergenic
927684577 2:25161583-25161605 AGCAGCGGCAGCAGCGGCGCAGG - Exonic
927714319 2:25342183-25342205 CGCCGCGGCGGGAGCGGCCTGGG + Intronic
928093922 2:28392715-28392737 CGCGGAGGAGGAAGAGGCGCGGG - Intronic
928518269 2:32063920-32063942 CCCGGCGGCGGGAGGGGCGGGGG - Exonic
930075675 2:47403596-47403618 CGGGGCGGCTGGAGAGGCACGGG - Intronic
931696345 2:64873569-64873591 GGCTGCGGCGGGAGAGAGGCAGG - Intergenic
933658085 2:84905588-84905610 TGCTGCGGCGGGTGAGGGGCGGG + Intronic
934815575 2:97323466-97323488 AGCAGGGGAGGGAGAGGCCCTGG + Intergenic
934822120 2:97385017-97385039 AGCAGGGGAGGGAGAGGCCCTGG - Intergenic
935592561 2:104855622-104855644 GGCGGCGGCGGGGGCGGCGCAGG + Exonic
935592905 2:104857107-104857129 CGCGGCGGCGGCAGCGGCGGCGG - Exonic
936221928 2:110610788-110610810 GGCAGCGGCGGCAGCGGCGGCGG - Intergenic
937305373 2:120867496-120867518 CCCAGCGGCAGGAGAGGCGGTGG - Intronic
938077386 2:128346937-128346959 AGCAGCGGCGGGCGGGGGGCGGG + Intergenic
938639631 2:133265918-133265940 CCAAGCGACAGGAGAGGCGCTGG + Intronic
939153845 2:138501857-138501879 CGCGGGGGCGGGAGTGGCGGAGG + Exonic
939612933 2:144332294-144332316 AGCAGCGGCGGCTGCGGCGCGGG - Intronic
940265158 2:151828450-151828472 CGCAGCCGCCCGAGAGGAGCTGG - Exonic
941762093 2:169254895-169254917 GGCAGCGGCGGGAGGGGGACGGG + Intronic
942046189 2:172100742-172100764 GGCAGTGGCGGCAGCGGCGCCGG - Exonic
942328801 2:174799799-174799821 CGCAGAGGCGGTGCAGGCGCAGG + Exonic
944273088 2:197804959-197804981 CCCAGCGGCGGCAGTGGCGGCGG - Exonic
945988380 2:216372304-216372326 AGCAGCGGCGGCCGCGGCGCCGG - Intergenic
946395428 2:219441855-219441877 AGCAGCGGCGGCGGCGGCGCTGG - Intronic
948047201 2:234953013-234953035 AGGAGCCGCGGGAGAGCCGCCGG + Intronic
948643017 2:239387342-239387364 CGCAGCGGCGGGACTGAGGCTGG - Intronic
1171346440 20:24469580-24469602 CGCAGGGCGGGGAGAGGCGTGGG + Exonic
1172019179 20:31900846-31900868 AGCAGAGGCAGGAGAGGGGCAGG - Intronic
1172100890 20:32483556-32483578 AGCAGCGGCGGCAGCGGCGGCGG + Intronic
1172118473 20:32584697-32584719 GGCGGCGGCGGGACTGGCGCGGG - Intronic
1172408940 20:34708745-34708767 AGAAGAGGCTGGAGAGGCGCTGG - Exonic
1172702844 20:36863420-36863442 CCCAGCGGCCGGAGCCGCGCCGG - Exonic
1173576463 20:44115679-44115701 CGCACTGGCGGCAGAGGCGGAGG - Exonic
1174317522 20:49713913-49713935 CGCAGCGGCGGGGGCGGAGGCGG + Intergenic
1174468012 20:50731924-50731946 CGGAGCGCCGGGGGAGGCGACGG + Intronic
1175873794 20:62220199-62220221 TGCTGCAGCGGGAGAGGAGCCGG + Exonic
1176029797 20:63006475-63006497 AGCAGCGGCGGCGGCGGCGCGGG - Exonic
1176062317 20:63177826-63177848 GGCGGCGGCGCGGGAGGCGCAGG + Intergenic
1176100195 20:63361251-63361273 CGAAGCGGCCCGCGAGGCGCGGG - Exonic
1177074106 21:16550326-16550348 CTCAGGGGTGGGAGAGGCGAGGG + Intergenic
1178488521 21:33033483-33033505 AGCAGCCGCGGGACTGGCGCAGG - Intergenic
1178845594 21:36171644-36171666 AGCAGCGGGGGGAGAGGCACGGG + Intronic
1178948457 21:36966803-36966825 GGCTGCGGCGGGAGGGGCGGGGG + Intronic
1179586419 21:42376509-42376531 CGCAGCGGTGGGCGAGGCCGTGG - Intronic
1179674833 21:42974442-42974464 CGCGGCGGCGGGCGCGGGGCGGG - Intergenic
1180101810 21:45590964-45590986 CGCGCCTGCGGGAGAGGCGGAGG + Intergenic
1180966228 22:19789240-19789262 CCCAGCTGCAGGAGAGGGGCTGG + Intronic
1181085619 22:20438082-20438104 GGGAGCGGAGGGAAAGGCGCGGG - Intronic
1182464446 22:30505720-30505742 CGCCCCGACGGGAGAGGCACTGG + Intergenic
1183468156 22:37990493-37990515 CCCAGCAGCTGGAGAGGCTCAGG - Intronic
1183486222 22:38089048-38089070 AGGAGGGCCGGGAGAGGCGCGGG - Intronic
1184412230 22:44331876-44331898 GGCGGCGGCGGGCGCGGCGCGGG - Intergenic
1184465899 22:44668776-44668798 GGCAGCGGCGGCGGCGGCGCGGG + Intronic
1185055203 22:48575678-48575700 GGCCGCGGCGGCGGAGGCGCGGG + Intronic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
1185259542 22:49853877-49853899 CGGGGCCGCGGGAGGGGCGCGGG + Exonic
950153860 3:10708085-10708107 TGCAGCGGTGGCAGAGGCGGCGG - Intergenic
950182998 3:10928210-10928232 CACAGAGGAGGGAGAGGCTCAGG - Intronic
953627241 3:44581033-44581055 CGCGGCGGCGGCGGCGGCGCAGG + Intronic
954202104 3:49029506-49029528 CGCTGCGGCGGGGGCGGAGCTGG + Intergenic
954414382 3:50385808-50385830 CTCAGAGGAGGGGGAGGCGCGGG + Intronic
956659491 3:71583814-71583836 GGCGGCGGCGGCAGAGGCGCGGG + Intronic
956678022 3:71753668-71753690 GGCAGCGGCGGCAGCGGCGGCGG + Intronic
958419903 3:93917856-93917878 CACAGAGGCGGGGGAGGCTCAGG - Intronic
961268740 3:125671668-125671690 AGGTGCGGAGGGAGAGGCGCAGG + Intergenic
963673541 3:148280888-148280910 AGGTGTGGCGGGAGAGGCGCGGG - Intergenic
964622732 3:158732677-158732699 GGCCGCGGCGGGAGAGGGTCGGG + Exonic
964771189 3:160225684-160225706 AGCAGCGGCAGCAGAGGCGGCGG - Exonic
966182150 3:177197349-177197371 CGCCGCGGGGGGAGGGGCGGGGG + Intronic
967210271 3:187162261-187162283 AGCAGCCGAGGGAGAGGCCCCGG - Intronic
967867734 3:194204148-194204170 GGCAGCCGCGGGGGCGGCGCTGG + Intergenic
968756122 4:2417470-2417492 CGCGGCGCTAGGAGAGGCGCGGG + Intronic
969414022 4:7047199-7047221 CGCAGTGGTGGCAGAGGAGCCGG + Intronic
969563869 4:7966376-7966398 CGCAGCGCATGGAGGGGCGCTGG + Exonic
969715852 4:8867787-8867809 AGCAGCGGTGGGGGCGGCGCGGG + Exonic
970202895 4:13627526-13627548 GGCTGCGGCGGGGGAGGCGGCGG + Exonic
970456140 4:16226269-16226291 ACCGGCGGCGGGAGAGGCGCCGG - Exonic
971457808 4:26860792-26860814 CGCCGCGGCGGCGGCGGCGCGGG + Intronic
971457931 4:26861319-26861341 CGCCGCGGCGGGAGAGGAGGCGG - Exonic
974929874 4:68349818-68349840 CGCAGCCGCGGCAGAAGCACGGG + Exonic
975778978 4:77819658-77819680 TGCGGCGGCGGGGGAGGCGGCGG + Intergenic
976390044 4:84497806-84497828 CGCGGCGGCGGCAGAGGCGGAGG + Exonic
977607309 4:98995883-98995905 CGCAGCGGCGGCATATCCGCGGG - Intronic
978618107 4:110615389-110615411 TGCAGGGGCGGGAGGGGCGAGGG + Intergenic
981136205 4:141213701-141213723 AGCAGCTGCGGAGGAGGCGCTGG + Intergenic
985340711 4:188950319-188950341 CGCAGCGGTGGAAGAGCTGCTGG - Intergenic
985696681 5:1344901-1344923 CGGAGCGGCGGGCTGGGCGCCGG - Exonic
985727109 5:1522390-1522412 CAGAGCGGCGGCAGAGGGGCCGG + Intronic
985791606 5:1931182-1931204 CACGGCGGAGGGAGAGGCCCGGG - Intergenic
986608623 5:9546173-9546195 CGCGGCGGCGGGGGCGGGGCAGG - Intergenic
986912572 5:12574844-12574866 CGGTGTGGAGGGAGAGGCGCAGG - Intergenic
987050735 5:14144683-14144705 GGTGGCCGCGGGAGAGGCGCGGG + Intronic
987387698 5:17345725-17345747 CGCAGCTTCGGGAGGGACGCAGG - Intergenic
991391053 5:66144156-66144178 CGCAGCCGCGCGAGAACCGCCGG + Intronic
991913914 5:71587463-71587485 CGGCCCGGCGGGAGAGGCGCGGG - Exonic
992487420 5:77210361-77210383 GGGAGCGGCGGGAGGGGCGGAGG + Intergenic
993901220 5:93585114-93585136 CGCGGCGGCGGCGGCGGCGCCGG + Exonic
994710418 5:103258822-103258844 GACAGGGGCGGGAGAGGCGCAGG - Exonic
996478693 5:123949400-123949422 AGCAGCTGCGGGGGTGGCGCTGG - Intergenic
996552419 5:124744453-124744475 CGCGGTGGCGGCAGAGGTGCTGG + Exonic
997984483 5:138492018-138492040 CGCAGCCGCGGGCGGGGCGCAGG - Intergenic
1000588978 5:163135315-163135337 CGCTGAGGCAGGAGAGGCGGAGG + Intergenic
1002291771 5:178205112-178205134 CGCGGCGGGGGGAGGGGCGGCGG + Intronic
1002368162 5:178729414-178729436 CGCAGCGGCGTGAACGGGGCAGG - Intronic
1002368457 5:178730674-178730696 CGCCGCGGGGTGAGCGGCGCCGG - Exonic
1002385163 5:178860634-178860656 CGCAGCGGCGTGAACGGGGCAGG + Intronic
1002645237 5:180649537-180649559 CGCAGCGGCCGGAGATGCAGCGG - Exonic
1003242006 6:4353204-4353226 GGCAGCAGCAGGAGAGGCGGTGG + Intergenic
1004906236 6:20239286-20239308 CGGAGTGGCGGGGGAGGCGCAGG - Intergenic
1005327887 6:24720271-24720293 GGCGGCGGCGGAAGAGGCGGCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006302351 6:33200320-33200342 CGCAGCGGCGGCGGCGGCGGCGG - Exonic
1006337412 6:33427913-33427935 GGCAGCGGCGGGAGCGGCGGCGG + Intronic
1006458414 6:34144702-34144724 CGGAGAGGCGGGACAGGCGGGGG - Intronic
1006614665 6:35318254-35318276 GGGAGCAGCGGGAGCGGCGCCGG + Exonic
1006642758 6:35497236-35497258 CGCACGGGCGGGCGAGGAGCGGG - Intergenic
1006717621 6:36130500-36130522 CGCAGCGGGGGTCGGGGCGCTGG + Exonic
1007274227 6:40661623-40661645 GGCAGAGGAGGGAGAGGAGCAGG + Intergenic
1007785234 6:44276027-44276049 CGCTGCGGCGGGGCAGGCGGCGG + Exonic
1007927740 6:45663550-45663572 CGCAGCGGCGGGCCGGGCTCGGG - Intronic
1008378688 6:50819878-50819900 GGCCGAGGCGGGCGAGGCGCGGG + Intronic
1008520902 6:52362004-52362026 CGCAGCGGCGGCAGCGGCGCGGG + Intronic
1008673319 6:53794990-53795012 CGCGGCGGCGGGGGCGGCGACGG + Exonic
1009975671 6:70668186-70668208 CGCAGCGGCGGGAAGGTCACCGG - Intronic
1010083093 6:71886696-71886718 AGGCGCGGCGGGAGAGGCGAGGG - Intronic
1012475916 6:99614313-99614335 GGCAGCGGAGGCAGCGGCGCAGG + Exonic
1013156029 6:107491226-107491248 AGCTGCGGCCCGAGAGGCGCGGG + Intronic
1015220640 6:130801498-130801520 GGCAGCGGCGGCAGCGGCGGGGG + Intergenic
1015910195 6:138161887-138161909 CGGGGCGGCGGGCGGGGCGCGGG + Intergenic
1015976438 6:138795998-138796020 CGCGGCGGCGGGAGGGGCTGCGG + Intronic
1017470567 6:154733855-154733877 CCCGGCGGCGGAAGAGGCGGCGG - Exonic
1018613099 6:165662349-165662371 CGCAGCGGCGGCGGCGGCGGCGG - Intronic
1018876522 6:167826856-167826878 CACGGCGGCGGGCGGGGCGCGGG + Intergenic
1018898938 6:168041338-168041360 CGCAGGGGCTGGAAAGGCACAGG + Intronic
1019491586 7:1316291-1316313 GGCAGCGGCCGGAGAAGCCCAGG + Intergenic
1022048257 7:26640606-26640628 CGGAGCGGTGAGAGAGGGGCAGG - Intronic
1022477969 7:30723994-30724016 AGCAGCGGAGGGAGGGGAGCAGG - Intronic
1022500761 7:30881164-30881186 CCCAGGGTCAGGAGAGGCGCTGG + Intronic
1023059304 7:36313215-36313237 CGCAGTGCCGGGAGCGGCGCAGG + Intergenic
1023870211 7:44259174-44259196 GGCAGCGGAGGGTGAGGCACTGG - Intronic
1023875816 7:44285791-44285813 CCCAGCGGTGGGAGATGCGGCGG + Intronic
1026822279 7:73557579-73557601 GGCGGCGGCGGGAGCGGCGGGGG + Exonic
1026935822 7:74254680-74254702 CGCGGCGGCGTGGGAGGAGCAGG + Intergenic
1027233061 7:76283018-76283040 AGTAGCTGCGGGAGCGGCGCCGG - Exonic
1028567211 7:92246234-92246256 CGCAGCGGCCGGAGAGGGATGGG + Exonic
1029238811 7:99144078-99144100 GGCAGCGGCGGAAGCGGCGAGGG - Exonic
1029491929 7:100875358-100875380 CGCTGGGGCGGGAGAGGAACCGG + Intronic
1031899630 7:127393923-127393945 CCCAGCTACGGGAGAGGCGGGGG + Intronic
1033033173 7:137846633-137846655 AGCAGCAGCGGAAGCGGCGCCGG - Exonic
1033186548 7:139231770-139231792 GGCAGCGGCGGGAACGGCGGCGG - Exonic
1034420636 7:150988920-150988942 GGGAGCAGCGGGAGAGGGGCGGG - Intergenic
1034470512 7:151252033-151252055 CGCGGCGGCCGGGGAGGCGGCGG + Intronic
1034560619 7:151877316-151877338 CGCGGCGGGGGGCGAGGAGCGGG - Intergenic
1035378794 7:158425243-158425265 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378827 7:158425393-158425415 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378851 7:158425493-158425515 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378863 7:158425543-158425565 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378886 7:158425643-158425665 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378907 7:158425743-158425765 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378918 7:158425793-158425815 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378930 7:158425843-158425865 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378973 7:158426041-158426063 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378995 7:158426141-158426163 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379017 7:158426241-158426263 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379048 7:158426391-158426413 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379070 7:158426491-158426513 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379082 7:158426541-158426563 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379105 7:158426641-158426663 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379127 7:158426741-158426763 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379149 7:158426841-158426863 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379180 7:158426991-158427013 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379247 7:158427290-158427312 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379280 7:158427440-158427462 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379292 7:158427490-158427512 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379315 7:158427590-158427612 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379338 7:158427690-158427712 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379360 7:158427790-158427812 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379383 7:158427890-158427912 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379395 7:158427940-158427962 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035683644 8:1507607-1507629 CGCCGAGGCGGAGGAGGCGCCGG + Intronic
1036168061 8:6456506-6456528 CGCATCAGCAGGAGAGGCACGGG - Intronic
1036788657 8:11703850-11703872 CGCAGCGGCGGGCGAGGGGCGGG - Intronic
1037901905 8:22693392-22693414 GGCAGCGGCGGCAGAGGCGGCGG - Intergenic
1038039724 8:23714548-23714570 CTCAGCGGCCAGAGAGGCGGCGG + Intergenic
1038540342 8:28385856-28385878 GGCCGCGGCGGGCGGGGCGCGGG - Intronic
1038632856 8:29262704-29262726 CGCAGGGGCGGGGCGGGCGCAGG + Intronic
1038644387 8:29350511-29350533 CAGAGCGGAGGGGGAGGCGCCGG + Exonic
1038644549 8:29351122-29351144 TGCAGCGGCGGCACAGGTGCCGG - Intergenic
1039542301 8:38382235-38382257 GGCGGCGGCGGGAGAGGCGGCGG - Exonic
1039587637 8:38720068-38720090 CACAGAGGCGGGGGAGGCTCAGG - Intergenic
1041067052 8:54092119-54092141 GGCAGCGGCGGCAGAGGAGATGG + Intronic
1041244757 8:55879833-55879855 CGGCGCGGCGGGAGAGGAACTGG - Exonic
1043769684 8:84183130-84183152 GGCAGCAGCGGCAGAGGCGGCGG + Intronic
1045305458 8:100952820-100952842 CGCGGCGGCGGGAGGGAGGCCGG - Intronic
1045737922 8:105318458-105318480 CGGAGCGGCGGCGGCGGCGCCGG + Intronic
1047292292 8:123541124-123541146 CGGGGCGGCGGGAACGGCGCGGG + Exonic
1047423930 8:124728664-124728686 CGCACCGGAGGGAGAGGCTCCGG - Intergenic
1049336792 8:142090928-142090950 CGCAGCGTTGGGAAAGTCGCTGG - Intergenic
1049419656 8:142511087-142511109 CGGGCCGGCGGGAGGGGCGCCGG + Intronic
1049675912 8:143888943-143888965 CGCCGGGGAGGGAGAGGCGGAGG + Intergenic
1049774423 8:144397899-144397921 CTCAGCGGCGGGCAAGGGGCAGG + Intronic
1049861549 8:144902200-144902222 CGCACCTGGGGGAGAGGGGCGGG + Intergenic
1051287291 9:15510442-15510464 CGCACTGGCGGGGGAGGAGCGGG - Intronic
1051483599 9:17585194-17585216 GGCAGCGGCGAGAGAAGGGCAGG + Intronic
1052925949 9:34016353-34016375 AGCAGCGGCGGCAGCGGCGGTGG + Intronic
1052964572 9:34329870-34329892 CCCAGAGGCGGGAGAGGTCCAGG + Intronic
1055945527 9:81688711-81688733 GGCGGCGGCGGGCGAGGTGCAGG + Exonic
1055945721 9:81689522-81689544 GTAAGCGGCGCGAGAGGCGCGGG - Intergenic
1056154055 9:83817565-83817587 GGGAGCCGCGGGAGAGGCGGCGG - Exonic
1056356442 9:85805528-85805550 GGGAGCCGCGGGAGAGGCGGCGG + Intergenic
1056712355 9:89001216-89001238 CGCACCGGCTGGAGACGCGGCGG - Exonic
1057245538 9:93451693-93451715 CGCAGCGGCGGCAGCGGCGGCGG + Intronic
1058942861 9:109830376-109830398 AGCAGGGGCGGGAGAGGTTCTGG + Intronic
1060531743 9:124351107-124351129 AGCAGCTGAGGGAGGGGCGCTGG + Exonic
1060883576 9:127135381-127135403 CACAGAGGCTGGAGAGGGGCTGG + Intronic
1060897139 9:127225202-127225224 CCCAGCGAGGGGAGAGGGGCGGG + Intronic
1061052401 9:128204217-128204239 CGCGGCGAGGGGGGAGGCGCGGG + Intronic
1061273564 9:129557472-129557494 CCCAGCTGCGGGCGAGGCCCAGG - Intergenic
1061666189 9:132162084-132162106 CACAGCGGCGGGAGCGGCGCGGG + Exonic
1061797796 9:133098444-133098466 CCCAGCAGCGGGAGAGGTTCAGG + Exonic
1062300553 9:135865463-135865485 GGCAGAGGCGGGAGAGCCTCTGG + Intronic
1062389246 9:136327501-136327523 CACGGCGGCGGGAGGGGCGGCGG + Exonic
1062567429 9:137169516-137169538 CGCAGCGGCGCGAAAGTCCCTGG + Exonic
1062659101 9:137619090-137619112 GGCAGCGGCGGAGGCGGCGCGGG + Intronic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1187915717 X:24150334-24150356 GGCGGCGGCGGCAGCGGCGCCGG + Intronic
1189005129 X:36986446-36986468 CGGAGCGGGAGGAGTGGCGCGGG - Intergenic
1189043894 X:37571496-37571518 CGGAGCGGGAGGAGTGGCGCGGG + Intronic
1189325290 X:40107811-40107833 CGCAGGCCCGGGAGAGGGGCGGG - Intronic
1190246898 X:48696808-48696830 AGCAGTGGAGGCAGAGGCGCGGG + Intronic
1190335292 X:49258284-49258306 CGCAGCTGCAGGTGAGGCCCTGG - Exonic
1190542972 X:51496873-51496895 CGCGGCGGAGGGCGAGGGGCGGG + Intergenic
1191830206 X:65407585-65407607 GGCGGCGGCGGGCGAGGCGCAGG - Intronic
1195668345 X:107449903-107449925 CGCAGCGGCGGCGGCGGCGGCGG - Intergenic
1196783003 X:119399631-119399653 CGCTGCAGGGGAAGAGGCGCAGG - Exonic
1197806370 X:130402124-130402146 CCGAGGGGCGGGAGCGGCGCGGG + Intronic