ID: 900371266

View in Genome Browser
Species Human (GRCh38)
Location 1:2333234-2333256
Sequence TGGGCTGGCCCCGCTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900371258_900371266 5 Left 900371258 1:2333206-2333228 CCAGCCAGTGGGCACGTCTAGCA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 900371266 1:2333234-2333256 TGGGCTGGCCCCGCTGCAACAGG 0: 1
1: 1
2: 0
3: 12
4: 126
900371255_900371266 22 Left 900371255 1:2333189-2333211 CCTGGTGCGTAATTATGCCAGCC 0: 1
1: 0
2: 1
3: 3
4: 30
Right 900371266 1:2333234-2333256 TGGGCTGGCCCCGCTGCAACAGG 0: 1
1: 1
2: 0
3: 12
4: 126
900371261_900371266 1 Left 900371261 1:2333210-2333232 CCAGTGGGCACGTCTAGCAGGGC 0: 1
1: 0
2: 1
3: 5
4: 71
Right 900371266 1:2333234-2333256 TGGGCTGGCCCCGCTGCAACAGG 0: 1
1: 1
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900371266 Original CRISPR TGGGCTGGCCCCGCTGCAAC AGG Intronic
900371266 1:2333234-2333256 TGGGCTGGCCCCGCTGCAACAGG + Intronic
900635080 1:3659304-3659326 TGGGCGGCCCACGCAGCAACAGG + Intronic
901426354 1:9184043-9184065 TGGGATTGCCCCCCAGCAACAGG - Intergenic
904699354 1:32349216-32349238 TGGGCTGACCCTTCAGCAACGGG - Intergenic
905304091 1:37005620-37005642 AGGGCTGGCCTGGCTGCAAGTGG + Intronic
905335331 1:37240875-37240897 TGGGCGGGCCCCGCTCCACAGGG + Intergenic
908563092 1:65326591-65326613 TGGGCTGGCTCCACTGCCCCTGG - Intronic
912411391 1:109483186-109483208 TGGGGTGGCCCCGAGGCAGCTGG - Intergenic
912500913 1:110121386-110121408 AGGCCTGGCCCCACTGCAGCAGG - Intergenic
917631339 1:176894137-176894159 TAGCCTGGCCCAGCTGCAGCTGG - Intronic
923296004 1:232595462-232595484 TGGGCTGTCACTGCTGCACCGGG + Intergenic
923341261 1:233008919-233008941 TGGGGTGGCCCAGCTGCTCCAGG - Intronic
1065879789 10:30028635-30028657 GGGGCTGGCCCCACAGCCACCGG + Exonic
1067687568 10:48476336-48476358 TGGGCTGTCCCATCTGCAGCAGG + Intronic
1070922259 10:80195381-80195403 TGGGCTGACCCTTCTGCAGCTGG + Intronic
1071480941 10:86064515-86064537 TGTGCTGGGCCAGCTGCAATGGG + Intronic
1074703377 10:116111310-116111332 TGGGCTGGCCCCACTGCAGTTGG - Intronic
1077049514 11:560550-560572 GGGGCTGGCCCCGCTGCCCCTGG + Intronic
1077296976 11:1830950-1830972 GGGGCCGGCCCCGCTGGGACAGG + Intronic
1079234776 11:18680424-18680446 TCGGCTGGCTCTGCTGCAGCAGG + Intergenic
1081582106 11:44359562-44359584 AGGCCTGGCCCCTCTGCATCTGG - Intergenic
1084428267 11:69097381-69097403 TGGGAGGGCCCAGCTGCACCAGG - Intergenic
1090397928 11:126431595-126431617 GGGGCTGCCCCCGCAGGAACGGG - Intronic
1091632099 12:2169992-2170014 AGGGCTGGCTCCCCTGAAACAGG + Intronic
1091768747 12:3138184-3138206 TGGGCTGGCCCCTCTGCCTGGGG + Intronic
1094266966 12:28570488-28570510 TGGGCTGGTCCCACTGTAAGTGG - Intronic
1095984612 12:47991134-47991156 TGGGCTGGCCTGGCTGCTTCGGG + Intronic
1101158304 12:101948481-101948503 TGAGCTGGCTCAGCTGGAACTGG + Intronic
1104827468 12:131723594-131723616 AGGGCTGGCCCCACTGCCCCTGG + Intronic
1115263541 14:31477462-31477484 TGTGCTGGACCAGCAGCAACAGG + Intergenic
1117582702 14:57168959-57168981 TGTGCTGCCCCCGCTGCCACTGG - Intergenic
1119804874 14:77476029-77476051 TGGGCAGGTCCCGCAGCATCTGG + Exonic
1122131977 14:99609523-99609545 TGGGCTGGCCCCACCCCAAAAGG - Intergenic
1122207357 14:100154641-100154663 TGGGCTGGCCTCCCTTCAGCAGG - Intronic
1122366340 14:101197022-101197044 TGGGATGGCCCAGAGGCAACTGG + Intergenic
1125508811 15:40282106-40282128 GGGGCTCACCGCGCTGCAACTGG - Exonic
1130265521 15:82398600-82398622 TGTCCTGGCCCTTCTGCAACTGG + Intergenic
1130506490 15:84548285-84548307 TGTCCTGGCCCTTCTGCAACTGG - Intergenic
1131512323 15:93056212-93056234 CGGGCTGGCCCGGCTCCATCAGG - Intronic
1132974166 16:2703262-2703284 TGGCCTGGGCCAGCTGCACCTGG + Intronic
1132976705 16:2714666-2714688 GGGGCTGGCCCTGCTGCACCTGG - Intronic
1133230175 16:4362640-4362662 GGGGCTGGTCCCGATGCCACTGG + Exonic
1133235291 16:4384762-4384784 TGGGCTGCCGCCGCTGCCTCAGG - Intronic
1136377713 16:29875409-29875431 TCGGCTGGCCCCGCTGCCTCGGG - Intronic
1137685973 16:50386988-50387010 TGGGCTGGCCCAGCTCCCAGAGG - Intergenic
1138991209 16:62392828-62392850 TGAGCTGGCCCTGCTGCACAGGG - Intergenic
1140823437 16:78684127-78684149 TCAGCTGTCCCTGCTGCAACAGG + Intronic
1141161317 16:81630841-81630863 TGGGCTGGGCCCCCTGCCTCTGG - Intronic
1141425311 16:83940935-83940957 AGGGCTGCCCCCACTGCACCGGG - Intronic
1141623710 16:85250394-85250416 TTGGCTGGCCCCGCCCCAGCTGG + Intergenic
1142290433 16:89191722-89191744 TGTGCTGGCCCCGCCGCCGCCGG + Exonic
1145739003 17:27256258-27256280 TGGGCTGGACCTGCTGCCCCAGG + Intergenic
1145809167 17:27754547-27754569 TGGGCTGCCCTGGCTGCCACTGG + Intergenic
1145966705 17:28924022-28924044 TAGTCTGGCTCCGCTGCTACTGG + Exonic
1146482760 17:33218273-33218295 TGGGCCTGCCCCGCAGCATCAGG - Intronic
1147961168 17:44168473-44168495 TGGTCTGTCCCCTCTGCATCTGG - Intergenic
1148018829 17:44540296-44540318 GGGGCTGGCCCCGCTGAGATGGG + Intergenic
1148558026 17:48590159-48590181 TGGGCTGGTCCGGCTGCTCCAGG + Intronic
1149521118 17:57318958-57318980 TGGGCTGGCCCTGGAGCCACAGG - Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1150917139 17:69448545-69448567 TGGCCAGGGCCGGCTGCAACTGG - Intronic
1152066931 17:78117304-78117326 TGCGCTGGCCCCGCACCACCTGG + Exonic
1152226571 17:79095522-79095544 TAGGCTGCCGCCGCTGCAGCGGG + Exonic
1155910193 18:31497724-31497746 CGGCCTGGCCCCGCAGCCACTGG + Intergenic
1156476032 18:37405878-37405900 TGGGCTGGCCCCCCTCCAGCCGG + Intronic
1158599078 18:58841664-58841686 TGGGCTTGCGCCACTGCACCTGG + Intergenic
1160765149 19:804357-804379 TGGGCTGGCCGCGCAGCACAGGG - Exonic
1160798599 19:956864-956886 TGGGATGTCCCCGCAGCAGCAGG + Intronic
1160857635 19:1224519-1224541 TGGGCTGGCCCTGCCCTAACTGG - Intronic
1161025058 19:2032936-2032958 TGGGGAGGCCCCGCTGGAAGGGG + Intronic
1161089118 19:2351474-2351496 CGGGCTGGCCACGCTGCATCAGG - Exonic
1161250337 19:3276530-3276552 TGGCCTGGCCCCGCCCCACCTGG - Intronic
1161575791 19:5053584-5053606 TGGGCTGGGGCCACTGCAGCGGG - Intronic
1162060378 19:8091132-8091154 TGGGCTGGCTCCGTTTCAGCTGG - Intronic
1164146117 19:22513616-22513638 TGGGGTGGCACTGCCGCAACTGG - Intronic
1164417473 19:28058948-28058970 TGGGCTGGCCCCGATGTCAATGG - Intergenic
1164816237 19:31205573-31205595 TGGGCTGAGCCCGCTTCACCAGG + Intergenic
1165073087 19:33266956-33266978 TGGGCCGGCTCCACTGCACCTGG - Intergenic
1165105140 19:33464725-33464747 TGGGCTGTGCCTCCTGCAACTGG + Intronic
1167357657 19:49014142-49014164 TGGGCTGGCCCCGCTGCAGCAGG + Intronic
1168098237 19:54127594-54127616 GGATCTGTCCCCGCTGCAACAGG + Intronic
1168233741 19:55049044-55049066 TGGGCCGCCCCCGCTGGAAGTGG + Intronic
927096283 2:19749948-19749970 TGGGCTGGCCCAGCTGCAGGAGG - Intergenic
928952351 2:36824311-36824333 TGGGCTTGCCACGCTGCCACAGG - Intergenic
930805660 2:55486707-55486729 TGGGCTAGGCTCACTGCAACAGG - Intergenic
933491104 2:82986131-82986153 TGGGCTGGCCAGGCTGAAGCCGG - Intergenic
934157216 2:89214581-89214603 TTGGCTGGCCCAGCTGAAAGAGG - Intergenic
934210098 2:89968163-89968185 TTGGCTGGCCCAGCTGAAAGAGG + Intergenic
947588299 2:231370455-231370477 TGAGCTGGCCCTGCTGCCCCGGG + Intronic
948360004 2:237413199-237413221 TGGGCTGGCCCTGCAGCCCCAGG + Intronic
1169046260 20:2536668-2536690 TGGGCGGGCCCCGCAGGATCAGG - Intronic
1172269282 20:33644543-33644565 TGGGCTGGGCACGCTGCAGTCGG - Exonic
1172606013 20:36214539-36214561 TGAGCTGCCCTCGCTGCATCAGG + Intronic
1174170217 20:48613011-48613033 TGTGCTGGTCCCCCTGCAATAGG + Intergenic
1175223942 20:57433959-57433981 TGGCCTGGACCCCCTCCAACTGG - Intergenic
1175256877 20:57652966-57652988 TGGGCTGCTCCCGCTGCGGCTGG - Intronic
1176375602 21:6085624-6085646 TCGGCTGCCCCCGCTGGAAGGGG + Intergenic
1179220895 21:39406261-39406283 TTGGCTGGCCCCCCTGAAGCAGG + Exonic
1179352071 21:40621522-40621544 TGGCCTGGCCTGGCTGCAAAGGG - Intronic
1179747872 21:43452620-43452642 TCGGCTGCCCCCGCTGGAAGGGG - Intergenic
1179800452 21:43809343-43809365 TGGGCTGGCAGGACTGCAACTGG - Intergenic
1179894196 21:44352168-44352190 TGAGCTGTCCCCGCAGCCACTGG - Intronic
1181844309 22:25694343-25694365 TGAGCTTGCCCGGCTGCAGCAGG - Intronic
1183495338 22:38140100-38140122 AGGGCTGACCCCGCTGCACCTGG - Exonic
1184782842 22:46657716-46657738 TGGGCTGTCCCCGCTGGCCCAGG + Intronic
1184900589 22:47444246-47444268 TGGGCTGGCCCAGCTGGTCCGGG - Intergenic
954688527 3:52383648-52383670 TGGGCTGGCCCCGGGGACACTGG + Intronic
966372114 3:179261279-179261301 TGGGCTCGGCCCGCTCCACCCGG + Intronic
968914001 4:3489300-3489322 AGGGCCGGCCTCGCTGCAAGAGG - Intronic
975473275 4:74794290-74794312 GGAGCTGGCGCCGCTGCACCGGG + Exonic
989950531 5:50292801-50292823 TGGGCTGGCCAGGCTGGAGCTGG + Intergenic
999324686 5:150636615-150636637 AGGTCTGGCCCCACTCCAACAGG - Intronic
1005838308 6:29724021-29724043 TGGGCGGGTCCCGCTGCCTCGGG - Intronic
1019424546 7:968136-968158 TGGGCGGGCCCAGCCGCAATAGG + Exonic
1019530115 7:1499085-1499107 TGGGCTGGCGCCGGTTCAGCTGG + Exonic
1020338103 7:7080134-7080156 TGGGCTCTCCCAGCTGGAACAGG - Intergenic
1020804465 7:12771581-12771603 AGCCCTGGCCTCGCTGCAACTGG - Intergenic
1022496385 7:30855607-30855629 TGGGGTGGCCCCTCAGCACCAGG + Intronic
1022522628 7:31017803-31017825 TGGGCTTCCCCTGCTGCCACAGG + Intergenic
1023133465 7:37027042-37027064 TGTGCTGGCCCAGCTGCAGGAGG - Intronic
1025942845 7:66086615-66086637 TGGGCTGGGCCCTCTGCAAATGG - Exonic
1034957548 7:155344431-155344453 TCGGGAGGCCCCGCAGCAACAGG - Intergenic
1036168838 8:6463627-6463649 TGGCCTGGCCACACTGCATCTGG - Intronic
1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG + Intergenic
1039791911 8:40882998-40883020 TGTGCTGGACCCTTTGCAACAGG + Intronic
1040898659 8:52394165-52394187 TGGGATGGCTCCTCTGCATCTGG - Intronic
1041394039 8:57373772-57373794 TGGGGTGGCCCCTCTGGAAGTGG + Intergenic
1043701306 8:83291616-83291638 TGTGCAGGCCCCGCAGCAGCAGG + Intergenic
1046251866 8:111642925-111642947 TCGGCTGGCCCCGCTGGCCCCGG + Intergenic
1051333808 9:16048423-16048445 TTGGCTGGCCCCACTTCACCTGG - Intronic
1051843096 9:21420441-21420463 GGGCCTGGGCCTGCTGCAACTGG - Intronic
1057050000 9:91916401-91916423 AGGGCTGGCCTGGCTGCGACAGG - Intronic
1057206396 9:93175570-93175592 GGGGCTGGCCCTGCTTCAGCAGG + Intergenic
1057265362 9:93613914-93613936 TGGGCTGGCCCCTCTCCTCCTGG + Intronic
1057892186 9:98877583-98877605 TGGGCTGGCCAGACTGCACCTGG - Intergenic
1060852688 9:126890312-126890334 TGGTCTGGCCCAGCTGGAAAGGG + Intergenic
1061874780 9:133538268-133538290 TGGGCTGGCCCCACGGCCACTGG - Intronic
1062496315 9:136833299-136833321 TGGGCTGCCCCAGCTGGATCTGG + Intronic
1062519042 9:136950074-136950096 TGGGCCGGCGGCGCTGGAACGGG - Intronic
1199974785 X:152886997-152887019 TGGGCTGGGCCCACAGCAGCAGG + Intergenic