ID: 900372054

View in Genome Browser
Species Human (GRCh38)
Location 1:2336538-2336560
Sequence CAATCTTTCTAGAAGGCAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 211}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900372054_900372067 14 Left 900372054 1:2336538-2336560 CCGCCTGCCTTCTAGAAAGATTG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 900372067 1:2336575-2336597 AGAAGGAAAGGCTCAGAAGGTGG 0: 1
1: 3
2: 5
3: 66
4: 650
900372054_900372062 -10 Left 900372054 1:2336538-2336560 CCGCCTGCCTTCTAGAAAGATTG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 900372062 1:2336551-2336573 AGAAAGATTGGGCAGGAGGAGGG 0: 1
1: 0
2: 8
3: 98
4: 977
900372054_900372063 -9 Left 900372054 1:2336538-2336560 CCGCCTGCCTTCTAGAAAGATTG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 900372063 1:2336552-2336574 GAAAGATTGGGCAGGAGGAGGGG 0: 1
1: 0
2: 6
3: 83
4: 770
900372054_900372065 2 Left 900372054 1:2336538-2336560 CCGCCTGCCTTCTAGAAAGATTG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 900372065 1:2336563-2336585 CAGGAGGAGGGGAGAAGGAAAGG 0: 1
1: 1
2: 31
3: 354
4: 2580
900372054_900372066 11 Left 900372054 1:2336538-2336560 CCGCCTGCCTTCTAGAAAGATTG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 900372066 1:2336572-2336594 GGGAGAAGGAAAGGCTCAGAAGG 0: 1
1: 0
2: 7
3: 61
4: 641
900372054_900372069 21 Left 900372054 1:2336538-2336560 CCGCCTGCCTTCTAGAAAGATTG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 900372069 1:2336582-2336604 AAGGCTCAGAAGGTGGGCCTAGG 0: 1
1: 0
2: 2
3: 22
4: 231
900372054_900372068 15 Left 900372054 1:2336538-2336560 CCGCCTGCCTTCTAGAAAGATTG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 900372068 1:2336576-2336598 GAAGGAAAGGCTCAGAAGGTGGG 0: 1
1: 1
2: 3
3: 51
4: 413
900372054_900372064 -3 Left 900372054 1:2336538-2336560 CCGCCTGCCTTCTAGAAAGATTG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 900372064 1:2336558-2336580 TTGGGCAGGAGGAGGGGAGAAGG 0: 1
1: 0
2: 10
3: 254
4: 2669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900372054 Original CRISPR CAATCTTTCTAGAAGGCAGG CGG (reversed) Exonic
900372054 1:2336538-2336560 CAATCTTTCTAGAAGGCAGGCGG - Exonic
901489603 1:9589796-9589818 CCACCTTTCCAGAGGGCAGGGGG + Intronic
903980942 1:27187776-27187798 AAATCTTTATAGGAGGCAGAGGG - Intergenic
904564148 1:31417514-31417536 CAATTTTTTTAAAAGGGAGGGGG - Intronic
904672020 1:32173092-32173114 CAATCTCCCAGGAAGGCAGGGGG + Exonic
905272583 1:36796575-36796597 CCACTGTTCTAGAAGGCAGGAGG + Exonic
905772148 1:40645313-40645335 CAGTATTTCTGGAAGGCATGTGG + Intronic
907124365 1:52036309-52036331 AAATCTTTCCAGGAAGCAGGGGG + Intronic
908786746 1:67742029-67742051 CAATGTTTCAAGCAGGCAGTGGG + Intronic
908934425 1:69357493-69357515 AAATCTTTATGGAAGGCAGAGGG + Intergenic
909192732 1:72574032-72574054 CAATCATGGTGGAAGGCAGGAGG - Intergenic
909529796 1:76669658-76669680 TAATCTTTCCAAAAGGAAGGGGG + Intergenic
910015425 1:82517810-82517832 CAGTCTTTCTACCAGACAGGAGG + Intergenic
911930373 1:103895224-103895246 AAATTTTTCAAGCAGGCAGGTGG + Intergenic
912748389 1:112265149-112265171 CAATGTTTCTAGAAGGGAAATGG - Intergenic
915511624 1:156389919-156389941 GGATCTTTATAGAGGGCAGGGGG - Intergenic
915769275 1:158402126-158402148 CATTCTTTCTTTGAGGCAGGGGG + Intergenic
917538481 1:175891641-175891663 ACAGCTTTCCAGAAGGCAGGAGG + Intergenic
918802975 1:188997327-188997349 GAATTTTTCTTGAACGCAGGAGG - Intergenic
919357033 1:196537124-196537146 CAACCTTTCTAGCAGCCAAGTGG - Intronic
920283865 1:204865417-204865439 AAAACTTTCAATAAGGCAGGGGG + Intronic
920683212 1:208089130-208089152 ACATCTTTCCAGAAGGCAGATGG - Intronic
920979369 1:210818550-210818572 AAATCTTACTATAAGGCAGATGG - Intronic
922168940 1:223139034-223139056 CAATCATTGTGGAAGGCAAGGGG - Intronic
922217700 1:223534098-223534120 AAATGTTTCAAGAATGCAGGTGG + Intergenic
923662477 1:235970267-235970289 CAAACTTTCTGTAAGGCAGTTGG + Intergenic
1063582463 10:7321087-7321109 CAATCTTTCTGCAAGGGAAGAGG + Intronic
1063790063 10:9434503-9434525 CTATTTATCTAGAATGCAGGTGG - Intergenic
1065696222 10:28382526-28382548 GAATCTTTCTAGACGGGCGGCGG - Intergenic
1066583156 10:36902441-36902463 CAATCATGGCAGAAGGCAGGGGG + Intergenic
1067331552 10:45326659-45326681 CAGTCTTTCTAGATGGAAAGAGG - Intergenic
1068485842 10:57657315-57657337 CAACCTTTCTTGAAGGCAGAGGG + Intergenic
1070728198 10:78806905-78806927 CAATCTCCAGAGAAGGCAGGAGG + Intergenic
1071042479 10:81330289-81330311 CACTCTTTTAAGAAGGCAGAGGG + Intergenic
1071477092 10:86034425-86034447 GAATCTTTCCAGAAGCCTGGTGG + Intronic
1071478117 10:86042184-86042206 CCATCTTTCTGGAAGGAAGGTGG - Intronic
1074781848 10:116807919-116807941 CCAGCTCTCTAGAAGGCAGGAGG + Intergenic
1075011015 10:118870210-118870232 CCATCTTTCTAGAATGAATGAGG + Intergenic
1076499821 10:130928792-130928814 AAGTCTTTCTAGAAGGAAGAAGG - Intergenic
1077057018 11:598746-598768 CAATCCTTCCAGAAAGCAGAGGG - Intronic
1077945437 11:6892230-6892252 CCTTCTTTCTGGAAAGCAGGTGG + Exonic
1078491433 11:11772814-11772836 CCTTCTTTTTAGAAGGCATGTGG - Intergenic
1080109138 11:28546063-28546085 CAATCATGGTAGAAGGCAGAGGG + Intergenic
1080576637 11:33605666-33605688 CAATCTCTCAAGCAGACAGGAGG + Intronic
1081619052 11:44608019-44608041 CATCTTTTCTGGAAGGCAGGGGG + Intronic
1083566606 11:63724100-63724122 CAGCCTTTCTGGAAGGCAGTTGG + Intronic
1085944007 11:81244189-81244211 TAATCTGTCTAGAAGGCATGAGG - Intergenic
1086730552 11:90243520-90243542 CAATATCTGTAGAAGGAAGGAGG + Intergenic
1090955788 11:131511986-131512008 CGATCTGTCTAGACAGCAGGTGG - Intronic
1093082181 12:14825268-14825290 CAGTATTTCCAGAAGCCAGGAGG - Intronic
1093667931 12:21836542-21836564 CACTCTGTCTAGAAGGAATGGGG - Intronic
1093850896 12:24036749-24036771 CAATATTTCAGGAAGGCAGTGGG + Intergenic
1094699501 12:32855065-32855087 TAATCTTTCAGGAAGGCAAGTGG + Intronic
1097207308 12:57333713-57333735 AAATATTTCTAGAGGGAAGGAGG + Intronic
1098160023 12:67640958-67640980 AAATCCTTCTAGAAGTCAGTGGG + Intergenic
1098383367 12:69893150-69893172 AAATCTTTCTAGAAAGCAACTGG - Intronic
1099015338 12:77337411-77337433 CAACCATCCTAGAAGGAAGGAGG - Intergenic
1099770084 12:87041183-87041205 CAGACTTTCTAGAATGCAGCTGG + Intergenic
1099812663 12:87604811-87604833 CAATCATGGCAGAAGGCAGGAGG + Intergenic
1101164122 12:102010424-102010446 GAATGTGTCTAGAACGCAGGTGG + Intronic
1101304243 12:103511983-103512005 CACTCTCCCTAGAAGGCAGTTGG + Intergenic
1102472222 12:113165777-113165799 GAGTCCTTCTACAAGGCAGGGGG - Intronic
1102698481 12:114818140-114818162 CCTTCTTGGTAGAAGGCAGGCGG + Intergenic
1102716550 12:114978406-114978428 CAATCATGGTAGAAGGCAGAAGG + Intergenic
1104003711 12:124877475-124877497 CCTTCTTTCTTGAAGGCAGAGGG + Intronic
1104192155 12:126492444-126492466 CAATCATTGTAGTAGGCAGGGGG - Intergenic
1104756806 12:131274374-131274396 CAAGCTGTTTCGAAGGCAGGTGG + Intergenic
1105826044 13:24124484-24124506 CAGACTTTCTCGAAGGAAGGTGG + Intronic
1107613265 13:42138315-42138337 CCATCTTTCTAGAATGCAGTTGG + Intronic
1107660083 13:42630122-42630144 CAATCTTTCTATAAGGCATTTGG + Intergenic
1108005507 13:45942063-45942085 CCATCTTTCCACAAGGCAAGTGG + Intergenic
1110390869 13:74972356-74972378 CAACCATTCTAGAATGAAGGGGG + Intergenic
1111551586 13:89819344-89819366 CAATCATGATAGAAGGCAAGGGG - Intergenic
1111643963 13:91006624-91006646 AAATCTTTCTATAACACAGGTGG - Intergenic
1112486629 13:99826006-99826028 GGATCTTTCTAGAAGGGAGAAGG + Intronic
1115787133 14:36838435-36838457 CAATCTTAGTAGAAGCTAGGTGG - Intronic
1116515444 14:45799706-45799728 AATTCTTTCTGGAAGGCAGAAGG + Intergenic
1117236854 14:53787102-53787124 AGATCTCTTTAGAAGGCAGGAGG + Intergenic
1117562688 14:56958365-56958387 CTATATTTCTAAAATGCAGGTGG + Intergenic
1118871783 14:69749143-69749165 CAAACTTGCTGCAAGGCAGGAGG - Intronic
1119179343 14:72594444-72594466 AGATCTTTCTAGAAGGCTGGGGG - Intergenic
1120396784 14:83977313-83977335 CAAACTTTATAGAAAGCAGTTGG - Intergenic
1121267968 14:92616554-92616576 AAATCTTTATAGGAGGCAGAGGG + Intronic
1121555973 14:94837523-94837545 CAGTATTTCTAGAATGCAGATGG - Intergenic
1121941107 14:98071832-98071854 CCATCTTTCAAGAAGGCACAGGG + Intergenic
1124143055 15:27094370-27094392 CAATTTTTTAAGAAGGCAGCTGG - Intronic
1125140265 15:36398048-36398070 CAAAGTTTCTAGAAGAAAGGAGG + Intergenic
1125425097 15:39540601-39540623 CAAACTTTCAAGAATGCAAGGGG + Intergenic
1125526081 15:40375760-40375782 AAGACTTTCTAGAAGGTAGGTGG + Intergenic
1130954656 15:88619129-88619151 AAATCCTTCTACAAGTCAGGTGG - Intergenic
1131990575 15:98088981-98089003 TAAGCTTCCTAGAAGGAAGGAGG + Intergenic
1132099567 15:99014319-99014341 TAAGCTTCCTAGAAGGAAGGAGG - Intergenic
1133958466 16:10468810-10468832 CAATCTTTCTTCTAGCCAGGGGG - Intronic
1134589431 16:15440344-15440366 CAATCTTTCCATAAGCCCGGGGG + Intronic
1138538980 16:57676933-57676955 CATTTCTTCCAGAAGGCAGGAGG - Intronic
1139890794 16:70252084-70252106 CCATCTTGCTGGAAGGGAGGGGG + Intergenic
1141764324 16:86048544-86048566 CACTCTCTCTAGCTGGCAGGAGG + Intergenic
1141980438 16:87546977-87546999 CTAGCTTTCCAGCAGGCAGGGGG + Intergenic
1143056215 17:4163773-4163795 CAAACTTTCTGGAGGGCAGCTGG + Intronic
1143438751 17:6951489-6951511 CAATCTCTCCAGCAGGCAGTCGG - Intronic
1143989650 17:10945813-10945835 CAGTGTTTCTAAGAGGCAGGAGG + Intergenic
1145996279 17:29106685-29106707 CATTCCTCCTAGAAGGAAGGTGG - Intronic
1146421517 17:32690719-32690741 CAATCATTGCAGAAGGCAGAGGG - Intronic
1146513093 17:33467513-33467535 CAATAATTCTAAAAGGGAGGAGG - Intronic
1146745125 17:35321921-35321943 AAATCTTTATGGGAGGCAGGGGG - Intergenic
1148662656 17:49347705-49347727 CAATTTTTCTTGCAGGCATGGGG - Intronic
1149990265 17:61379304-61379326 CCATGTTTCGAGAAGGCAGAGGG - Intronic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1153411708 18:4800525-4800547 AAATCTCTCTAGCAGCCAGGTGG + Intergenic
1155765733 18:29629943-29629965 CCTTCTTTGTAGAAGGGAGGAGG - Intergenic
1156010286 18:32489355-32489377 CAAGTTTTCTAGGTGGCAGGAGG - Intergenic
1156817358 18:41327377-41327399 CAATCATAGTAGAAGGCAAGGGG - Intergenic
1157792418 18:50544552-50544574 CAATCCTTGTAAAAGGGAGGGGG + Intergenic
1159554353 18:69929676-69929698 GAAGCTCTCTAGCAGGCAGGAGG - Intronic
1160971580 19:1770078-1770100 CAATAATTCTACAAGGCAGGGGG - Intronic
1161948811 19:7455758-7455780 CAATCATGGCAGAAGGCAGGAGG + Intronic
1162273617 19:9636165-9636187 CAATTTTTTTTGCAGGCAGGAGG + Intronic
1163345192 19:16736799-16736821 CAGTTTGTCTAGAAAGCAGGGGG - Intronic
1165702423 19:37948699-37948721 CTGACATTCTAGAAGGCAGGTGG + Intronic
1168637184 19:58005389-58005411 CACTAATTCTAGAAGGGAGGAGG - Intronic
925866134 2:8227787-8227809 CAAACTTTCTGGAAATCAGGTGG + Intergenic
927287737 2:21374213-21374235 CAACAGTTCTAGGAGGCAGGTGG + Intergenic
927304361 2:21553736-21553758 CACTCTCTCTAGAAGTGAGGTGG + Intergenic
929244149 2:39683819-39683841 GTATTTTTCTAGAAGTCAGGAGG - Intronic
930023697 2:47016847-47016869 CAATTTTTCCAGATCGCAGGTGG + Intronic
931105077 2:59046489-59046511 CAAGCTTTCTTAAAGCCAGGCGG - Intergenic
932126682 2:69151327-69151349 AAATCTTTCTAGGAGAGAGGGGG - Intronic
933634752 2:84695423-84695445 AAATCTTTCTGGAAGGTAGTTGG + Intronic
933993230 2:87648822-87648844 CAATGTTTTTAGCAGGCAAGAGG - Intergenic
934757134 2:96832198-96832220 CCATCCTTCTGGAAGACAGGAGG + Intronic
936300627 2:111302061-111302083 CAATGTTTTTAGCAGGCAAGAGG + Intergenic
936813514 2:116432191-116432213 CAATCATGGCAGAAGGCAGGAGG + Intergenic
937571372 2:123366920-123366942 TTATCTTTTTAGAAGGCAGGTGG + Intergenic
937961781 2:127465581-127465603 CAATCATGGCAGAAGGCAGGAGG - Intronic
942187555 2:173438638-173438660 CAATCCCTTTAGAAAGCAGGGGG + Intergenic
943182970 2:184567327-184567349 AAAGTTTTCTAGAAGGCAGTAGG - Intergenic
947073628 2:226318312-226318334 CACTTTATCTAGAATGCAGGAGG - Intergenic
947084373 2:226434678-226434700 CAACCTTTCTAGAGGGTTGGAGG + Intergenic
947565184 2:231189093-231189115 AAAGCTTTCTTGAAAGCAGGGGG + Intergenic
1168954420 20:1824851-1824873 AAATGTTTCTAGAAGGAAGAAGG + Intergenic
1170710447 20:18786118-18786140 CAATCATGGTGGAAGGCAGGAGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1174099809 20:48118671-48118693 CAAGCTTTCTAGAGGGCAATTGG - Intergenic
1174148141 20:48466864-48466886 CAACCTTTCTAGAGGGCAATTGG - Intergenic
1174547860 20:51339454-51339476 CACTCTTTCTAGATGGCACAAGG + Intergenic
1174912624 20:54623258-54623280 CATTCTTTGTCGAGGGCAGGGGG - Intronic
1177149264 21:17438251-17438273 CTATATTTCTAGAATGCAGGAGG + Intergenic
1178792537 21:35713486-35713508 ACATCTTTTTAGAAGGCAGAGGG + Intronic
1178884736 21:36476242-36476264 CACTTTTTCTAGATGGCAGAAGG - Intronic
1181859472 22:25806931-25806953 CAATGATTGTAGAAGGTAGGTGG - Intronic
1183471120 22:38007283-38007305 GAACCTTTCAAGAAGGCAGAGGG + Intronic
949572590 3:5308014-5308036 CAATTCTTCTTGAAGGCTGGAGG + Intergenic
951116817 3:18872992-18873014 CAAGATTTCTAGTAGGCAGTTGG + Intergenic
953718443 3:45335379-45335401 CAGGCATACTAGAAGGCAGGCGG + Intergenic
953798451 3:46003073-46003095 CTATCCTTGTAGAAGGCAGCTGG + Intergenic
953901174 3:46845130-46845152 GAACGTTTCTAGACGGCAGGGGG - Intergenic
953966577 3:47311950-47311972 CACTCTTTGTAGAAGCCAAGGGG + Intronic
959745315 3:109769461-109769483 CAATCTATGTGGAAGGCAAGAGG - Intergenic
959745371 3:109770072-109770094 CAATCTATGTGGAAGGCAAGAGG + Intergenic
963358213 3:144237307-144237329 CAATCTTCCCAAAAGGCATGTGG - Intergenic
963772407 3:149401369-149401391 CAGTCTTTCTGCATGGCAGGTGG - Intergenic
963903900 3:150758059-150758081 CAAACTTTCTAAATGGGAGGAGG - Intronic
965428787 3:168561211-168561233 CAACCTTTCTAGAAGACTGAGGG + Intergenic
966989522 3:185214986-185215008 CATCCTGTCTAGAAGGCAGCTGG - Intronic
967962025 3:194933229-194933251 CAATCTTTCTTGAGAGCATGGGG - Intergenic
968120351 3:196121531-196121553 CCATCTCTCCAGCAGGCAGGAGG + Intergenic
970157113 4:13152724-13152746 CAATCATGCCAGAAGGCAAGGGG + Intergenic
971299302 4:25428641-25428663 CAATCATGGCAGAAGGCAGGAGG + Intergenic
971321901 4:25612455-25612477 CAATCTATTAAGAAGGCTGGTGG - Intergenic
974106936 4:57480312-57480334 CAATATTTCTAGAATCCATGTGG - Intergenic
976225094 4:82789673-82789695 CAACCTTTCTAGTAAGCAGCAGG + Intronic
976372777 4:84309327-84309349 CACTCTTGCTAGCAGGAAGGTGG + Intergenic
978990664 4:115078243-115078265 CAATCATGGTAGAAGGCAAGGGG + Intronic
979856850 4:125644253-125644275 CAATCTTCCAAGATGGTAGGTGG - Intergenic
980065902 4:128187944-128187966 CAATCATGGTGGAAGGCAGGGGG - Intronic
980606929 4:135104422-135104444 CAATTTTTTTAGATGGCAGTAGG - Intergenic
982054641 4:151536023-151536045 CACTCTTTCCAGAAGGCATTTGG - Intronic
985810054 5:2076054-2076076 TAATCTTTCCAGAAGCCAGAGGG - Intergenic
986616668 5:9624463-9624485 CAATGTTTCTAGAAGCCACCAGG + Intergenic
993936374 5:94009309-94009331 CAGTCTTTGGAGAAAGCAGGTGG - Intronic
996510431 5:124309801-124309823 AAATGTTTCTGGAAGACAGGAGG + Intergenic
996951541 5:129132418-129132440 CAAGCGTTCTAGAAAGCAGTTGG + Intergenic
999543897 5:152605547-152605569 CAATCATTCTAAAAGGAATGAGG + Intergenic
1000752087 5:165109151-165109173 CAATATTTATAGAAGACAAGTGG + Intergenic
1002826464 6:778347-778369 CCAACTTTCTAAAAGCCAGGAGG + Intergenic
1004093943 6:12534224-12534246 CAGCCTTTCTGGAAGGGAGGAGG - Intergenic
1004769479 6:18765638-18765660 AAATATTTATAGGAGGCAGGAGG + Intergenic
1006479419 6:34279876-34279898 CATTCTCTCTAGATGGCAGGGGG + Exonic
1007972342 6:46065730-46065752 AGATCCTTCTAGGAGGCAGGAGG + Intronic
1010713293 6:79200443-79200465 GAATCTTTTAAGATGGCAGGTGG - Intergenic
1011475599 6:87748116-87748138 CTCTCTTCCTAGAAGGAAGGTGG - Intergenic
1013287193 6:108691644-108691666 CAATCTTTTGAGAGGGCATGTGG + Intergenic
1013301236 6:108806596-108806618 CATCCTTGCTCGAAGGCAGGAGG - Intergenic
1016561886 6:145404802-145404824 CAATCTTTCAAGAAGGTGTGAGG - Intergenic
1016958712 6:149651335-149651357 CAATCATTTTAGAAGGGTGGTGG - Intergenic
1017586187 6:155926804-155926826 CAATCTTTGTATATGGCATGAGG + Intergenic
1018860231 6:167705882-167705904 CCAGCTTCCTAGAAGGCAGCGGG + Intergenic
1021961892 7:25881319-25881341 AAATCTTACTGGAAAGCAGGAGG - Intergenic
1022457636 7:30572897-30572919 AAATCTTTCTGGGAGGCAGAGGG + Intergenic
1022617957 7:31951829-31951851 CAACCTTTCCAGCAGGCAGAGGG - Intronic
1022761658 7:33361502-33361524 CAATTTTTCAAAAAGGCAGCTGG - Intronic
1023495738 7:40794691-40794713 AAATCTTTCCGGAAGGCAGGAGG - Intronic
1024577787 7:50778847-50778869 CATTCTTAAAAGAAGGCAGGTGG + Intronic
1026175687 7:67994866-67994888 AAATTTTTCAAAAAGGCAGGCGG + Intergenic
1026409173 7:70101404-70101426 CACTCTTTTTAGAAGGAAGGAGG - Intronic
1027745744 7:82071711-82071733 GACTCTTACTAGAAGGAAGGAGG - Intronic
1028014162 7:85686117-85686139 CAATCATGCTGGAAGGCAGCAGG - Intergenic
1029531503 7:101128341-101128363 GAATCGTTCTGGAAGACAGGCGG - Intronic
1032514230 7:132495072-132495094 CAATCCATCTTGAAGGCAGCAGG + Intronic
1036207066 8:6813432-6813454 CAATCTTTCCAGAGGCCATGTGG + Intronic
1038191372 8:25324121-25324143 CACTCTCTCCAGAAAGCAGGTGG - Intronic
1038914558 8:32006303-32006325 TACTCTTTCTGGAAGGCAGAAGG - Intronic
1039873987 8:41569908-41569930 CAGGCCTTCTAGAAGGCAAGGGG - Intergenic
1041972377 8:63758903-63758925 CAATTTTTCTAAAAGGATGGAGG - Intergenic
1044056580 8:87578171-87578193 CAGTCTTTTCTGAAGGCAGGTGG + Intronic
1045193599 8:99907654-99907676 CTCTCTCTCTAGAAGGCAGAGGG - Intergenic
1049942367 9:559628-559650 CAATCTTTCAAGACGGGAGAAGG + Intronic
1055190500 9:73515790-73515812 CAATTATTCTAGAAGGGAGGGGG + Intergenic
1055453316 9:76450485-76450507 CAAACTTTCTAGAAGGCATTTGG - Intronic
1055833325 9:80408636-80408658 CAATCTTTAAAGAAGGCTGGGGG + Intergenic
1055884543 9:81045243-81045265 TAATCTTTGTGGAAGGCATGAGG - Intergenic
1056480914 9:87005013-87005035 CAGTCTTTCTGCAAGGCAGTAGG - Intergenic
1057549619 9:96042633-96042655 ATATCTATCTAGAAGGCATGAGG - Intergenic
1058439337 9:104992649-104992671 CAACCCTTCTAGAAGACAGTTGG + Intergenic
1059379543 9:113912479-113912501 CAGTCTTTCTAGGATGCAAGGGG + Intronic
1060454191 9:123775385-123775407 CAATATTTCTGAAAGGAAGGGGG + Intronic
1061296461 9:129679468-129679490 CAAACATTCTAGAAGGCAGGCGG + Intronic
1185981139 X:4780224-4780246 AAACATTTCTAGAAGGCAGTTGG - Intergenic
1186928852 X:14364983-14365005 CAAGCTTTCTAAAAGGCAAGTGG + Intergenic
1187120838 X:16404757-16404779 CAAGCTCTCTCGAAGGCAGAGGG - Intergenic
1193431989 X:81419055-81419077 TAATATTTCTAGAAGGTAGGAGG - Intergenic
1195083205 X:101390142-101390164 CAATAATTCTAGGAGACAGGTGG - Intronic