ID: 900372242

View in Genome Browser
Species Human (GRCh38)
Location 1:2337169-2337191
Sequence AGGCACTCGCTTCCAGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900372229_900372242 27 Left 900372229 1:2337119-2337141 CCAGCGCTTTGCAGTGGGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 147
Right 900372242 1:2337169-2337191 AGGCACTCGCTTCCAGGGTAGGG 0: 1
1: 0
2: 0
3: 7
4: 75
900372232_900372242 0 Left 900372232 1:2337146-2337168 CCATCAGCAGCCCCCGTCAGCCG 0: 1
1: 0
2: 1
3: 13
4: 158
Right 900372242 1:2337169-2337191 AGGCACTCGCTTCCAGGGTAGGG 0: 1
1: 0
2: 0
3: 7
4: 75
900372231_900372242 1 Left 900372231 1:2337145-2337167 CCCATCAGCAGCCCCCGTCAGCC 0: 1
1: 0
2: 1
3: 33
4: 169
Right 900372242 1:2337169-2337191 AGGCACTCGCTTCCAGGGTAGGG 0: 1
1: 0
2: 0
3: 7
4: 75
900372227_900372242 28 Left 900372227 1:2337118-2337140 CCCAGCGCTTTGCAGTGGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 176
Right 900372242 1:2337169-2337191 AGGCACTCGCTTCCAGGGTAGGG 0: 1
1: 0
2: 0
3: 7
4: 75
900372234_900372242 -10 Left 900372234 1:2337156-2337178 CCCCCGTCAGCCGAGGCACTCGC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 900372242 1:2337169-2337191 AGGCACTCGCTTCCAGGGTAGGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900372242 Original CRISPR AGGCACTCGCTTCCAGGGTA GGG Intronic
900372242 1:2337169-2337191 AGGCACTCGCTTCCAGGGTAGGG + Intronic
901225673 1:7611720-7611742 CTGCACTCGCTGCCAGGGTAAGG + Intronic
910677572 1:89830589-89830611 AGGCACTCGCCCTCAGGGTGGGG + Intronic
912924133 1:113898405-113898427 AGGCAGTGGCTTCCAGGGTTGGG - Intronic
912993535 1:114511339-114511361 AGGAACTGGCTTCGAGGGTCCGG - Intergenic
915933363 1:160074605-160074627 AGGCCTTCTCTTCCAGGGAAAGG - Intergenic
921342010 1:214143636-214143658 ATGCATTTCCTTCCAGGGTAAGG - Intergenic
1070586770 10:77772481-77772503 AGGACCTCACATCCAGGGTAAGG + Intergenic
1075715359 10:124552155-124552177 ATGAACTCACTTCCAGGGTGGGG - Intronic
1076313622 10:129525681-129525703 AGGCACAGACTTCCAGGGTCTGG - Intronic
1093116691 12:15220942-15220964 AGTCACTTGCTTTCAGGCTAGGG + Intronic
1093849623 12:24019759-24019781 AGCCATTCTCTTCCAGGGAAAGG + Intergenic
1095727411 12:45469146-45469168 AGGCTCTGCCTTCCCGGGTACGG + Intergenic
1101947338 12:109147599-109147621 CGGAACTTGCTTCCAGTGTAGGG - Intronic
1112351110 13:98634168-98634190 AGGCACTCTCATTCAGGGAATGG - Intergenic
1121029008 14:90641887-90641909 AGGCATTGGACTCCAGGGTATGG - Intronic
1124019618 15:25908527-25908549 ATGCACTGGATTCCAGGGTTTGG + Intergenic
1133664320 16:7951024-7951046 AGGCACTCTGTTACTGGGTAAGG - Intergenic
1137408152 16:48206122-48206144 AGGCACTGGCTGCCAGGGAATGG - Intronic
1139513273 16:67439264-67439286 AGGCACTCACCTCCAGGATGGGG + Exonic
1140034725 16:71363555-71363577 AGGCAGGCTCTTCCAGGGCACGG + Intronic
1142921554 17:3191751-3191773 AGCTACTCTCTTACAGGGTAGGG - Intergenic
1143966903 17:10762067-10762089 AGGAACTCTTTTCCAGGGTGTGG + Intergenic
1145788160 17:27607670-27607692 AGGCACTGGCTCTCAGGGAATGG + Intronic
1146654841 17:34628998-34629020 TGGCCCTCCCTGCCAGGGTAGGG - Exonic
1148760606 17:49997933-49997955 AGGCACTGGGCTGCAGGGTAGGG + Intergenic
1160442527 18:78903272-78903294 GGGCACTTGCTTCCAGGGAGTGG + Intergenic
1160535810 18:79590731-79590753 AGGCACTGGCTTCTAGGCGAGGG + Intergenic
1167630314 19:50622329-50622351 ATCCTCTCGCTTCCAGGGTTAGG + Exonic
927218772 2:20687194-20687216 AGGGACTAGCTCCCAGGGTCAGG - Intronic
927276288 2:21265128-21265150 ATGCAATCGCTTCCAGTGGATGG - Intergenic
928199843 2:29240808-29240830 AGGGACCAGCTGCCAGGGTATGG + Intronic
935210991 2:100939139-100939161 AGGGAGTGGCTTCCAGGGAAAGG - Intronic
935685375 2:105678212-105678234 AGGCTCTGGCTGCAAGGGTAAGG + Intergenic
937450303 2:121996738-121996760 GGACACTCTTTTCCAGGGTATGG + Intergenic
946182876 2:217959573-217959595 AGGCACCGGGTTCCAGGCTAGGG - Intronic
947899669 2:233711117-233711139 AGGCATCAGCTTCCAGGGTCTGG - Intronic
947900367 2:233716901-233716923 AGGCATCAGCTTCCAGGGTCTGG - Intronic
1173523499 20:43715840-43715862 AGGCTCTGGCTTCTAGGGGAGGG + Intronic
1176137769 20:63532036-63532058 AGACAATCGCTGCCAGGGAATGG - Intronic
1179146326 21:38771184-38771206 AGACAGTCGTTTCCAGGGTAGGG + Intergenic
1180752041 22:18131239-18131261 AGGCACCCTCCTCCTGGGTAAGG - Exonic
1182984428 22:34703042-34703064 AGTCACTCTGTTCAAGGGTATGG - Intergenic
950135525 3:10578047-10578069 AGGCCCTAGATTCCAGGGCAAGG + Intronic
952843766 3:37669476-37669498 AAGCTCTGGCTTCCAGGGAAGGG + Intronic
954706687 3:52484733-52484755 AGGCAGATGCTTCCAGGGTTTGG + Intronic
955478953 3:59369603-59369625 AGGCACTGTATACCAGGGTAAGG - Intergenic
960543876 3:118889872-118889894 AGTCACTCCCTTCCAGGAAAAGG - Intergenic
962915209 3:139895021-139895043 AGGAACTCCCTTTCAGGGGAAGG - Intergenic
964485205 3:157179139-157179161 AGGCACTCGCTTCCTAGATGGGG + Intergenic
969155512 4:5206309-5206331 AGGCAGTGGCTTCCATGGGAGGG + Intronic
977252132 4:94700908-94700930 AGGGACTCCCTTCCTGGGTAGGG - Intergenic
981119557 4:141034078-141034100 TGGCACTTTCTTCCAGTGTAAGG + Intronic
986252627 5:6074573-6074595 AGCCACTCCATTACAGGGTAGGG + Intergenic
986759816 5:10869671-10869693 AGGCTCACACTTCCAGGGGAGGG + Intergenic
992137637 5:73763373-73763395 AGACACTGGCTTCCAGTGCAAGG + Intronic
995518243 5:112975375-112975397 AGGCACTTGACTCCAGGTTAAGG + Intergenic
995874706 5:116778248-116778270 AGGCACTGCCTGCCAGAGTAAGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1004515795 6:16321389-16321411 AGCAACTCTCTTCCAGGGTGGGG + Intronic
1006028102 6:31160014-31160036 AGGCACTCTGTTCCTGGGTTAGG + Intronic
1007666398 6:43516026-43516048 AGGCTCTAGCTTCGAGGATATGG - Exonic
1016125522 6:140397809-140397831 AGGCAGTGGCTTCCAGTGAAAGG + Intergenic
1017521896 6:155209790-155209812 AGGCACTCACTTCTAAGATAGGG - Intronic
1018956079 6:168411386-168411408 AGGCAGTCGGCTCCAGGGAAAGG + Intergenic
1019130482 6:169869438-169869460 AGGCAGTCACTTCCAGGCTGTGG + Intergenic
1019523240 7:1469783-1469805 AGGCACCAGCTCCCAGGGGAGGG - Intergenic
1030077252 7:105747383-105747405 AGGAACTCACTTTCAGGGCAGGG + Intronic
1030624565 7:111830607-111830629 AGGTACTAACTTCCAGGGTGAGG - Intronic
1031117516 7:117683933-117683955 AGTCACTCGCTGCCAGCATATGG - Intronic
1037957808 8:23072293-23072315 AGGCTCTAGCTTCCAGGTTGGGG + Intergenic
1037969283 8:23160687-23160709 AGGCTCTAGCTTCCAGGTTGGGG - Intronic
1040107468 8:43548806-43548828 AGGCACTGGCCTCTAGGGGACGG + Intergenic
1042612385 8:70613391-70613413 AGGCACTCTCTTCAAGCGTGTGG - Intronic
1045498678 8:102728909-102728931 AGGCGCTGGCTTCCAGGGGTAGG - Intergenic
1047114534 8:121826045-121826067 AGGCACATCCTTCCAGGGTAGGG - Intergenic
1056294038 9:85173568-85173590 AGGCACTGGCTTTCAGTGTCTGG - Intergenic
1057384034 9:94591963-94591985 AGGCAGTGGCTGCCATGGTAGGG - Intronic
1058943372 9:109834582-109834604 AGGCTCTGGCTTTCAGGGTCGGG + Intronic
1061014586 9:127974408-127974430 AGGCACTTGTTCCCAGGGTCAGG - Intronic
1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG + Intronic
1062353406 9:136150056-136150078 AGGGGCTTGCTTCCAGGGTGAGG - Intergenic
1194584531 X:95716562-95716584 AAGTACTAGCTTCCAGGGTCGGG - Intergenic