ID: 900373296

View in Genome Browser
Species Human (GRCh38)
Location 1:2341968-2341990
Sequence GAGGGTCCCCGGCAGTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900373287_900373296 6 Left 900373287 1:2341939-2341961 CCCCAGAGGAACCATTCGTGATG 0: 1
1: 0
2: 0
3: 1
4: 107
Right 900373296 1:2341968-2341990 GAGGGTCCCCGGCAGTGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 126
900373290_900373296 4 Left 900373290 1:2341941-2341963 CCAGAGGAACCATTCGTGATGGA 0: 1
1: 0
2: 1
3: 2
4: 44
Right 900373296 1:2341968-2341990 GAGGGTCCCCGGCAGTGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 126
900373288_900373296 5 Left 900373288 1:2341940-2341962 CCCAGAGGAACCATTCGTGATGG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 900373296 1:2341968-2341990 GAGGGTCCCCGGCAGTGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 126
900373286_900373296 13 Left 900373286 1:2341932-2341954 CCACGGGCCCCAGAGGAACCATT 0: 1
1: 0
2: 1
3: 19
4: 120
Right 900373296 1:2341968-2341990 GAGGGTCCCCGGCAGTGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 126
900373292_900373296 -5 Left 900373292 1:2341950-2341972 CCATTCGTGATGGAGAGTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 127
Right 900373296 1:2341968-2341990 GAGGGTCCCCGGCAGTGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900373296 Original CRISPR GAGGGTCCCCGGCAGTGTCT GGG Intronic
900002330 1:21584-21606 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
900022049 1:192108-192130 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
900244479 1:1630969-1630991 GGGCGTCCCAGGCAGGGTCTGGG + Intergenic
900347114 1:2215168-2215190 AGGGGTCCCTGGCAGCGTCTTGG + Intergenic
900373296 1:2341968-2341990 GAGGGTCCCCGGCAGTGTCTGGG + Intronic
901152552 1:7113469-7113491 GTGGCTCCCGGTCAGTGTCTAGG + Intronic
901529615 1:9844739-9844761 GAGGGACCTCGGCAGAGCCTGGG - Intergenic
902667360 1:17948856-17948878 GAGAGGCCCCTGCAGTGCCTGGG - Intergenic
903164301 1:21509827-21509849 CAGGGTCCCAGGCAGCGGCTCGG - Intronic
904004892 1:27358483-27358505 GGGGTCCCCCAGCAGTGTCTGGG + Exonic
904917031 1:33977549-33977571 GAGGGTCCCTGGAAGTTGCTTGG - Intronic
918042202 1:180920208-180920230 GAGGGAGCCCTGCAGGGTCTTGG - Intronic
918420966 1:184363874-184363896 CTGGGTCCCCGGCAGAGGCTGGG + Intergenic
919602619 1:199641094-199641116 CAGGCTCCCAGGCAATGTCTGGG + Intergenic
923293654 1:232572177-232572199 GAAGGTCCCCAGCTGTGTCCGGG + Intergenic
923961780 1:239093277-239093299 GAGTGTTCCTGCCAGTGTCTGGG - Intergenic
1064283503 10:13971806-13971828 GAGGGTTGGCGGCAGAGTCTGGG - Intronic
1068748494 10:60563488-60563510 GAACATCCCCAGCAGTGTCTTGG + Intronic
1069619997 10:69831414-69831436 AAGGGCCCCCAGCTGTGTCTGGG - Intronic
1070615881 10:77968826-77968848 GGGGGTCCCAGGCACCGTCTTGG + Intergenic
1074764033 10:116687339-116687361 CATGGGCCCAGGCAGTGTCTGGG + Intronic
1075913587 10:126147334-126147356 GAGGGTCCCCTGCTCTGTCAGGG - Intronic
1076681258 10:132172662-132172684 GAGGCTCCGTGGCAGCGTCTGGG - Intronic
1076730025 10:132433816-132433838 CGGAGACCCCGGCAGTGTCTAGG + Intergenic
1077131133 11:973247-973269 GAGGGTACTGGGCCGTGTCTTGG + Intronic
1077459221 11:2700410-2700432 GAGGGCCCACAGCAGTGTCGGGG - Intronic
1078532907 11:12150757-12150779 GAGGGTGCCGGGCAGAGACTTGG + Intronic
1078699894 11:13669630-13669652 GAGGGTCTCAGGTAGTGTCTTGG + Intronic
1079064476 11:17277108-17277130 AAGGGACCCCGCCAGGGTCTCGG - Intronic
1080349766 11:31369941-31369963 GAGGGTGCCCGCCAATGGCTGGG + Intronic
1083322448 11:61855898-61855920 GAGGGTGACGGGCAGTGTCCTGG + Intronic
1089739614 11:120573467-120573489 AAGGGTCCCCAGCAGTGGCGGGG - Intronic
1091375748 12:23646-23668 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
1092844594 12:12572310-12572332 GAAGGTCAGAGGCAGTGTCTGGG + Intergenic
1094523942 12:31219559-31219581 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
1095822181 12:46490212-46490234 GAGGTTCCCAGACAGTGACTTGG + Intergenic
1101216648 12:102592676-102592698 GTGGCTCCATGGCAGTGTCTAGG + Intergenic
1104679566 12:130739981-130740003 GAGGGTCCCCTCCACGGTCTGGG + Intergenic
1106554992 13:30801907-30801929 CAAGGTCACCTGCAGTGTCTGGG + Intergenic
1110071289 13:71182331-71182353 GAGGGCCCACAGCAGTGTCTAGG + Intergenic
1119779214 14:77266932-77266954 GGAGGTCCCAGGCAATGTCTTGG - Intronic
1121595045 14:95156611-95156633 AAGGGTCCTCCGCAGGGTCTAGG + Intronic
1122155925 14:99750363-99750385 GGGGGTCCCAGGCTGTTTCTGGG + Intronic
1123038170 14:105479690-105479712 GGGGGGCCCCTGCAGGGTCTGGG - Exonic
1128533216 15:68469310-68469332 GAGGTTCCCCAGCGCTGTCTAGG - Intergenic
1131262575 15:90895350-90895372 GAGGGTCCTCGGCAGACTCTGGG - Intronic
1131431901 15:92394481-92394503 GAGGGCGCCGGGGAGTGTCTCGG + Intronic
1132451182 15:101969355-101969377 GAGGCTCCCTGGCAGGGTGTGGG + Intergenic
1132760858 16:1508053-1508075 GAGGGACCCCAACAGGGTCTAGG - Intronic
1132834677 16:1946833-1946855 TTGTGTCCCCGGCAGTGTCTGGG + Intronic
1134029676 16:10981845-10981867 GGGGATACCTGGCAGTGTCTGGG + Intronic
1139484653 16:67248844-67248866 GAGAGTCCGAGGCAGGGTCTCGG + Intronic
1142803461 17:2359468-2359490 CAAGGTGCCAGGCAGTGTCTGGG - Intronic
1143904379 17:10197882-10197904 GAGCGTTCCCGGCAGTGGCAGGG - Intronic
1144269073 17:13600707-13600729 CAGGGTCCCCGGCGGGGCCTCGG + Exonic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1148217428 17:45840635-45840657 TGGGGTCCCAGGCAGAGTCTCGG + Intergenic
1152125665 17:78445136-78445158 GAGGGTCCCTGACTGTGTCCAGG + Intronic
1152438248 17:80289046-80289068 GATGGTCCCCGGAGGTGTCTGGG + Intronic
1152649135 17:81483887-81483909 GAGGGTCTCCGGCTGTTTCCTGG - Intergenic
1153838882 18:8988759-8988781 GAGGGTCCATGGCAGTATCAGGG - Intergenic
1154201436 18:12303194-12303216 GAGAGTCCCAGGGAGTGCCTGGG - Intergenic
1157573686 18:48730252-48730274 GAGGGGCCCCCGCAGTGTGAGGG + Intronic
1160634082 19:63192-63214 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
1160889936 19:1372171-1372193 GGGGGACACTGGCAGTGTCTGGG + Intronic
1160900194 19:1424136-1424158 CAGGGACCCCGCCTGTGTCTCGG + Intronic
1163751583 19:19081441-19081463 TAGCGTCCCTGGCAGTGTCATGG + Intronic
1163782345 19:19257180-19257202 GAGAGTCCCCTGCAGTTTCTGGG - Exonic
1164464358 19:28475032-28475054 GGGGGTGGGCGGCAGTGTCTTGG - Intergenic
1165476195 19:36032438-36032460 GAGGGTGCCCGGCAGGCTCCAGG + Intronic
1166229144 19:41415431-41415453 GAGGGTCAGCAGAAGTGTCTGGG + Intronic
1166283933 19:41811953-41811975 TAGAGTCCCAGGTAGTGTCTGGG - Intergenic
1167354160 19:48993150-48993172 TAGGGACCCCGGAGGTGTCTAGG + Exonic
1167522050 19:49960965-49960987 GGGGGTCCCAGGCAGGGGCTGGG - Intronic
1167523332 19:49969760-49969782 GGGGGTCCCAGGCAGGGGCTGGG + Intergenic
1167529010 19:50003189-50003211 CAGGGTCCCCAGCAGGGCCTGGG - Intronic
1167697987 19:51026167-51026189 GGGGGTCCCAGACATTGTCTGGG - Intronic
924986796 2:278595-278617 GAGGGTCCCAGGCAGTGCCATGG + Intergenic
928170615 2:29000770-29000792 GAGGCTCCCTGGCATTGTCCTGG - Intronic
936060545 2:109293103-109293125 GTGTGTCCCCTGCAGTGTCATGG - Intronic
936567397 2:113591836-113591858 GAGGCTCCCTGGCAGGGTGTGGG + Intergenic
937992863 2:127674120-127674142 GAGGGTACAGGGCAGTGTCCAGG - Intronic
938925620 2:136038901-136038923 GAGGGACCCAGGCAGTGCCCAGG - Intergenic
946333312 2:219022312-219022334 GAAGGTCCACGTCAGCGTCTGGG + Exonic
947968056 2:234298811-234298833 GAGTGGCCCAGGGAGTGTCTTGG - Intergenic
1171342934 20:24444784-24444806 GAGGGGTCCCTGCTGTGTCTCGG + Intergenic
1172123218 20:32610642-32610664 GCGGGTGCCCGGAAGTGGCTCGG + Intergenic
1174190518 20:48737304-48737326 GAGGGTCCCAGGCAGATTTTGGG + Intronic
1179648174 21:42788432-42788454 GCAGGTCTCCGGCAGTCTCTCGG - Intergenic
1180790644 22:18573843-18573865 GAGGGTCCCAAGCAGTTTCTTGG + Intergenic
1181231093 22:21421471-21421493 GAGGGTCCCAAGCAGTTTCTTGG - Intronic
1181247555 22:21513397-21513419 GAGGGTCCCAAGCAGTTTCTTGG + Intergenic
1184562032 22:45268950-45268972 GAGGGTCCCGCCCAGTGTCTAGG - Intergenic
1185258455 22:49849157-49849179 GAGGTCCCCCGGGAGCGTCTGGG + Intergenic
1185338095 22:50279758-50279780 GGGGCTCCCCGGCACTGTCCTGG + Exonic
950573789 3:13818709-13818731 GAGGGACCTGGGCTGTGTCTGGG + Exonic
953337807 3:42108637-42108659 GAGGGTGCCAGGTAGTGTCCGGG - Intronic
953730121 3:45440055-45440077 GAGAGTGGCCGTCAGTGTCTTGG + Intronic
954417928 3:50403167-50403189 GAGGGGCCCTGGCAGTGTTTTGG - Intronic
965981711 3:174699926-174699948 TAGGGTCCCAGGTAGTTTCTGGG + Intronic
968915706 4:3496255-3496277 GAAGGTCGCCTGCAGTGTCAGGG + Intronic
969101190 4:4769419-4769441 GAGGGTCCACGGCACTTGCTGGG - Intergenic
969700252 4:8764079-8764101 GAGGGTCCCCGGCCGCCCCTTGG + Intergenic
978944791 4:114482119-114482141 GAGGGTCCCCCACAGTGTAGCGG + Intergenic
981038224 4:140194550-140194572 GAGAGTCTCAGGGAGTGTCTGGG + Intergenic
985820179 5:2154259-2154281 GAGGGACCCCGGCAGTAGGTAGG + Intergenic
985957111 5:3274151-3274173 GATGGTCCCCTGCTGTGCCTGGG - Intergenic
986437579 5:7748988-7749010 GAGGGTGCCAGGCTGTGTGTGGG + Intronic
987327335 5:16824305-16824327 GAGTGTCCCCAGCAGTGGCGGGG - Intronic
996052146 5:118947179-118947201 GGGGCCCCCCGGCAGTGTCTAGG + Intronic
999731253 5:154478063-154478085 GGTGGCCCCCGGCAGTCTCTGGG - Exonic
1001092788 5:168753759-168753781 GTGGGACCCAGGCACTGTCTTGG - Intronic
1002533934 5:179865745-179865767 GGGGCTCCCTGGCAGTGACTGGG + Intronic
1006473869 6:34243081-34243103 GAGGGTCCCTGCCAGTCCCTGGG + Intronic
1011353286 6:86446636-86446658 GCAGGCCCACGGCAGTGTCTAGG + Intergenic
1018746289 6:166764651-166764673 GAGGGCACCCGGCTGTGCCTGGG - Intronic
1018906239 6:168077838-168077860 TGGGGTCCCCAGCAGTGCCTCGG - Intronic
1019708809 7:2509108-2509130 GAGGGGCCGGGGCAGTGTCAGGG + Intergenic
1022387435 7:29915008-29915030 GAGGCTGCGCGGCACTGTCTGGG - Exonic
1023931397 7:44708612-44708634 GAGGGTTCCAGGCTGTGTGTGGG + Exonic
1026675583 7:72425419-72425441 GAGGGCCCCCGGTAGTAACTGGG - Intronic
1026952186 7:74354975-74354997 GAGGGTCTAAGGCTGTGTCTGGG + Intronic
1032426928 7:131830055-131830077 GAGGCTCCCAGGCGGGGTCTGGG - Intergenic
1033976011 7:147101415-147101437 CTGGCTCCACGGCAGTGTCTAGG + Intronic
1034445478 7:151111799-151111821 GAGGCTCCATGGCAGTTTCTGGG - Intronic
1035731130 8:1854157-1854179 CAGGGCCCAGGGCAGTGTCTGGG + Intronic
1040278532 8:46026019-46026041 GAAGGCCCCCAGCAGTGACTTGG - Intergenic
1040408868 8:47134725-47134747 GATGGTCCCAGGCAGTGACAGGG - Intergenic
1042657484 8:71115739-71115761 GAGTGGCTCTGGCAGTGTCTGGG + Intergenic
1042932038 8:74023259-74023281 GTGGGTGCCCTGCAGTATCTTGG + Intronic
1047113838 8:121818788-121818810 TACTGCCCCCGGCAGTGTCTAGG - Intergenic
1049647262 8:143741042-143741064 GACGGTCCCGGGCAGAGCCTCGG - Intergenic
1049744733 8:144258443-144258465 GTGGGTGCCCAGCAGCGTCTGGG + Intronic
1049885136 9:21697-21719 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
1057199270 9:93131712-93131734 GAGGGCCCCCATCAGTGTCCAGG - Intronic
1061570949 9:131477134-131477156 GAGGGTCCCCTGCACAGTCTGGG + Intronic
1062205202 9:135332662-135332684 GAGGTTCCACGGCAGCCTCTAGG - Intergenic
1062392751 9:136340510-136340532 GAGGGTCCCCCACAGAGCCTCGG + Intronic
1186160709 X:6774300-6774322 GAGGGTTCTTGGCTGTGTCTAGG - Intergenic
1187480131 X:19647867-19647889 GATGGTTCCCAGCAGTCTCTAGG + Intronic
1192200930 X:69066296-69066318 GAGGGTCCAGGGCAGAGGCTGGG + Intergenic