ID: 900373354

View in Genome Browser
Species Human (GRCh38)
Location 1:2342258-2342280
Sequence TGCTGCCTGGTGCCCTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900373354_900373363 14 Left 900373354 1:2342258-2342280 CCTGTGTAGGGCACCAGGCAGCA 0: 1
1: 0
2: 1
3: 26
4: 203
Right 900373363 1:2342295-2342317 CCGAATCAACAAGGCTGCTCGGG 0: 1
1: 0
2: 2
3: 6
4: 53
900373354_900373361 13 Left 900373354 1:2342258-2342280 CCTGTGTAGGGCACCAGGCAGCA 0: 1
1: 0
2: 1
3: 26
4: 203
Right 900373361 1:2342294-2342316 CCCGAATCAACAAGGCTGCTCGG 0: 1
1: 0
2: 1
3: 3
4: 73
900373354_900373364 19 Left 900373354 1:2342258-2342280 CCTGTGTAGGGCACCAGGCAGCA 0: 1
1: 0
2: 1
3: 26
4: 203
Right 900373364 1:2342300-2342322 TCAACAAGGCTGCTCGGGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 125
900373354_900373359 5 Left 900373354 1:2342258-2342280 CCTGTGTAGGGCACCAGGCAGCA 0: 1
1: 0
2: 1
3: 26
4: 203
Right 900373359 1:2342286-2342308 GGATGCTGCCCGAATCAACAAGG 0: 1
1: 0
2: 0
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900373354 Original CRISPR TGCTGCCTGGTGCCCTACAC AGG (reversed) Intronic
900373354 1:2342258-2342280 TGCTGCCTGGTGCCCTACACAGG - Intronic
900560793 1:3305088-3305110 TCCGGCCTGGAGCACTACACAGG - Intronic
900800759 1:4735689-4735711 TGCTCCCTGAAGCCCTACCCTGG + Intronic
900876356 1:5345474-5345496 TGCTGACTGATGCCCAACACTGG + Intergenic
901246830 1:7738325-7738347 TGCTGCCTCCTTTCCTACACTGG - Exonic
902057753 1:13616573-13616595 GGCTGCCTGGTGGCCTACTTGGG - Exonic
902236584 1:15061465-15061487 TGCAGCCTGGGGCCCTGCTCAGG + Intronic
902257735 1:15200998-15201020 TGCTGGCAGGTGCCATATACAGG - Intronic
902395606 1:16130945-16130967 TGCTGCCTGGTGCCCTGTGAGGG - Intronic
905323648 1:37134806-37134828 TGGTGCCTGGTACCCGACAAGGG + Intergenic
909263734 1:73529032-73529054 TTCTGCCTGATGCCCTAAGCAGG + Intergenic
910272271 1:85409599-85409621 TCCTGCTTGTTGCTCTACACCGG + Intronic
911577095 1:99590730-99590752 TGCTGCCTGGTTCAGTTCACAGG - Intergenic
913403423 1:118461798-118461820 TGCTGCTTGCTGCCAGACACTGG - Intergenic
914243975 1:145872461-145872483 AGGTGCCTGGCTCCCTACACGGG + Exonic
914720946 1:150288362-150288384 AGAAGCCTGATGCCCTACACAGG - Intergenic
915448609 1:155989393-155989415 TCCTCCCTGGTGCCCGTCACTGG - Intronic
917302834 1:173595334-173595356 TTCTGCCTGGAGCCCTCCAGTGG - Intronic
918907672 1:190519505-190519527 TTCTGCCAAGTGCCCTATACAGG + Intergenic
919861283 1:201740669-201740691 TGAAGCCTGGTGCTCTACCCTGG + Intronic
921202665 1:212822245-212822267 TGCTGCCTGGAGACCTATGCAGG - Intergenic
922333045 1:224594559-224594581 TTCTGCCTCCTGACCTACACTGG - Intronic
922909528 1:229204180-229204202 TGCGGCCTGCTGCCCCACCCAGG + Intergenic
1063567004 10:7180038-7180060 TGCTGCCTGGACCCCTTCACTGG + Intronic
1063678705 10:8165341-8165363 TCCTGCATGGTGTCCTACTCTGG + Intergenic
1065132088 10:22632625-22632647 GTGTGCCTGGTGGCCTACACCGG - Intronic
1066101950 10:32125296-32125318 TGCTGTCTGTTCCACTACACTGG - Intergenic
1067544664 10:47184285-47184307 AGCTGCCTGGTGCCCATCCCTGG - Intergenic
1067563866 10:47322712-47322734 TGCTGGCTGGCTCCCTACAGGGG + Exonic
1067718387 10:48707446-48707468 TGCTGCGTGGGTCCCTTCACTGG - Intronic
1068395618 10:56457271-56457293 TGCTGTATGGTGGCATACACTGG - Intergenic
1069854435 10:71431970-71431992 TGAAGCCTGGTGTCCTAGACTGG - Intronic
1075788104 10:125063869-125063891 TGCTGCAGGGGTCCCTACACGGG - Intronic
1077106270 11:843820-843842 TGATGCCTGGAACCCAACACAGG - Intronic
1080028590 11:27637477-27637499 TGCTGCCTGATGGGCTACATGGG + Intergenic
1084126154 11:67100310-67100332 TGCGCACAGGTGCCCTACACAGG - Intergenic
1085110108 11:73880219-73880241 TGCTGCGTGGTCTCCTACCCTGG + Intronic
1085558093 11:77443843-77443865 AGCTGCTTGGTGCCCTAGACAGG - Intronic
1086293475 11:85337701-85337723 TCCTTCCTGGTGCTCTACACTGG + Intronic
1088626157 11:111732092-111732114 TGCTGTCTGGTTCCATCCACTGG - Intronic
1088953643 11:114596404-114596426 TGATTACTGCTGCCCTACACAGG + Intergenic
1094494769 12:30982470-30982492 TGCAGCCTGGGACCCTACGCAGG + Intronic
1096210775 12:49763842-49763864 TGCTCCCTGCTGCCCCAAACAGG - Exonic
1097359395 12:58641754-58641776 TCCTGCCTGGTCCCCTAGGCTGG + Intronic
1098702366 12:73645450-73645472 TGCTGCGTTGGGCCCTACACTGG + Intergenic
1099450792 12:82803936-82803958 TTCTGCCTTGTGCCCTTCAGTGG + Intronic
1100385436 12:94101453-94101475 AGGTGCCTGCAGCCCTACACTGG - Intergenic
1104620780 12:130311023-130311045 TGCTACCTGGTCACCCACACTGG + Intergenic
1106248841 13:27969038-27969060 TGCTGCCTGGGGACCGACGCTGG + Exonic
1106279903 13:28257460-28257482 TGCGGCCTGGTTCCTAACACTGG - Intronic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1112674219 13:101679528-101679550 TGCTTCATGGTGGACTACACTGG + Intronic
1114567706 14:23644748-23644770 TTCTGCCTGGTGGCCTTCCCGGG + Intronic
1119259656 14:73230236-73230258 TGCTGCCTGGAGGCCTGCGCTGG + Intergenic
1119580086 14:75770692-75770714 TTCTGCCTGGTGGCCTAGGCTGG - Intronic
1119630921 14:76231333-76231355 TGCTGCCTGTCGCCCTGCTCAGG + Intronic
1121454517 14:94029808-94029830 TGCTGCCCGGCTCCCTCCACTGG - Intronic
1121901093 14:97694089-97694111 TGCTGCTTGGTGCTCTGCCCAGG + Intergenic
1121944421 14:98105272-98105294 TGCTGCCTGCTGCCCTTGAAGGG - Intergenic
1122365958 14:101194991-101195013 TGCTGCCTGGTGCCACATAGTGG + Intergenic
1122788318 14:104174013-104174035 GGCTGCCTGGGGCCCCACGCTGG + Intronic
1122809743 14:104282020-104282042 TGCTGTCTGCTGACCTACACTGG + Intergenic
1122881101 14:104690773-104690795 TGCTCCCTGCCGCCCTGCACTGG + Intronic
1123049216 14:105532568-105532590 TGGGGCCTGGTGCCCAACCCAGG + Intergenic
1124645962 15:31437698-31437720 TGCAGCCTGGTGGCCTGCCCTGG - Intergenic
1124846356 15:33295042-33295064 TGCAGCCTGGTGCCTTTCATTGG - Intergenic
1125751756 15:42033842-42033864 TGCTGCCAGCTCCCCTACACAGG - Intronic
1126687351 15:51260076-51260098 TGATTCCTGTTGCCCTTCACTGG - Intronic
1128937366 15:71758103-71758125 TGCTGCCTTTTGCCTGACACAGG - Intronic
1129247177 15:74286694-74286716 TTCTGCCTGGTGCCCTATCTGGG - Intronic
1129290807 15:74565860-74565882 TGCTGCCAGGTGCCATAACCTGG + Intronic
1129741527 15:77991954-77991976 TGCTGCCTCGTGCCCTCTGCCGG + Intronic
1129844132 15:78760450-78760472 TGCTGCCTCGTGCCCTCTGCCGG - Intronic
1129867166 15:78918097-78918119 TGCTCCCTGGTGCCTGGCACAGG + Intergenic
1130257674 15:82333350-82333372 TGCTGCCTCGTGCCCTCTGCCGG + Intergenic
1131798940 15:96049621-96049643 TGCTGCCTGCTGACCTATATTGG - Intergenic
1134216726 16:12322068-12322090 TCCTACCTGGTTCCCTTCACTGG + Intronic
1134501242 16:14770719-14770741 TGATGCCGAGTGCCCAACACAGG - Intronic
1134569768 16:15281198-15281220 CGCTGCCTGCTGCCCTTCCCCGG - Intergenic
1134579338 16:15358315-15358337 TGATGCCGAGTGCCCAACACAGG + Intergenic
1134723244 16:16399239-16399261 TGATGCCGAGTGCCCAACACAGG - Intergenic
1134732613 16:16474850-16474872 CGCTGCCTGCTGCCCTTCCCCGG + Intergenic
1134934828 16:18237117-18237139 CGCTGCCTGCTGCCCTTCCCCGG - Intergenic
1134944184 16:18312631-18312653 TGATGCCGAGTGCCCAACACAGG + Intergenic
1136165609 16:28450975-28450997 TGATGCCCAGTGCCCAACACAGG + Intergenic
1136197363 16:28664034-28664056 TGATGCCCAGTGCCCAACACAGG - Intergenic
1136213702 16:28778181-28778203 TGATGCCCAGTGCCCAACACAGG - Intergenic
1136258435 16:29058105-29058127 TGATGCCCAGTGCCCAACACAGG - Intergenic
1136320060 16:29478211-29478233 TGATGCCCAGTGCCCAACACAGG + Intergenic
1136434631 16:30217552-30217574 TGATGCCCAGTGCCCAACACAGG + Intergenic
1142519526 17:495069-495091 TGGTGCCCCGTGCCCGACACCGG + Intergenic
1144993749 17:19252175-19252197 TGCTGCCTGGTGGTCTGAACTGG + Intronic
1145230514 17:21170232-21170254 TGCTGCCTGGAGTCCTGCACGGG - Intronic
1145960509 17:28884167-28884189 AGCTGCCTGGTCCCGTACTCGGG - Intronic
1146652293 17:34614141-34614163 GGCTGCCTGGTGCCCAATCCAGG - Intronic
1146666613 17:34709269-34709291 TGCTGCCTGTTGCCACACACTGG - Intergenic
1148110865 17:45144182-45144204 TGCTGTCTGGTCCCCTACGGAGG + Intergenic
1149579092 17:57735906-57735928 CACTGCCTGGAGCCCTCCACAGG - Intergenic
1150647019 17:66985106-66985128 TACTGCCTGGTACCCTGCTCTGG + Intronic
1150647452 17:66988150-66988172 TGCTCCCAGGTGCAGTACACGGG - Intronic
1151947169 17:77326012-77326034 TGCTGCCTGGTGCTCTAGGTTGG + Intronic
1152091717 17:78251041-78251063 TGGTGCCTGGTGCCCTCTAGTGG - Intergenic
1152173984 17:78774570-78774592 TGGTGCCTGGGGCCCTACAGAGG - Intronic
1152716093 17:81901624-81901646 TCCTGCCTGGTGCCCCCCAAGGG + Intronic
1154145993 18:11866649-11866671 CTCTGCCTGGTGACCTGCACTGG - Intronic
1154411837 18:14145891-14145913 TGCTGCCCTGTGCCCGGCACAGG - Intergenic
1155172067 18:23274466-23274488 TACTGCCTGGTGCCCCACAGTGG + Intronic
1155835357 18:30575349-30575371 TGCTGCATCGTGCCCAACATGGG + Intergenic
1158135529 18:54203763-54203785 TGTTGCCTGGTGGCCTGCATTGG - Intronic
1160674626 19:383309-383331 TGCTGCCTGGCTCCCTCCCCAGG + Intergenic
1160702540 19:514890-514912 CACTCCCTGGTGCCCTCCACGGG + Intronic
1161285768 19:3467527-3467549 TGCTGCCTGGGGACCTGCAGGGG - Intronic
1161365956 19:3879927-3879949 TTCAGCCTCGTGCCCTAAACAGG - Intronic
1162739460 19:12765834-12765856 TGCTGCCCGATGCCCCATACAGG - Exonic
1162904314 19:13814578-13814600 TGCTGGCTGGAGAGCTACACTGG + Intronic
1163153223 19:15427046-15427068 TGCTGCCGGGGGCCCTTCATGGG - Exonic
1163534711 19:17870442-17870464 TGCTCCCTGGTGGCCTCCTCTGG - Intergenic
1163667338 19:18609557-18609579 TGCTGCCTGGGGTCCTAGCCTGG + Intronic
1163700904 19:18785982-18786004 TGCCGCCTGGTGCCTAACCCCGG - Exonic
1165138396 19:33685045-33685067 TGCTGCCTGGAGCCAGGCACAGG + Exonic
1166542148 19:43612478-43612500 TTCTGCCAGGTGTCCTACCCCGG - Exonic
1168405029 19:56106175-56106197 TGCTGCCGTGTGCTCTGCACAGG + Intronic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
925142020 2:1557390-1557412 AGCTGCCTGGTGCCCCATCCAGG - Intergenic
926609864 2:14935925-14935947 TCCTGCTTGGTGCCATACTCTGG - Intergenic
928370205 2:30735086-30735108 TGCTTCCTGGAGCCCAGCACAGG + Intronic
932716039 2:74101269-74101291 AGCTGCCTGCTGCCCCTCACCGG - Exonic
933811693 2:86036642-86036664 TGCTGCCTGGGGCCTGACAAAGG + Intronic
937205263 2:120232351-120232373 AGCTGCCTGCTGCCCTGCTCTGG + Intergenic
938062028 2:128261871-128261893 TGCTCCCTGCTGCCTTTCACTGG - Intronic
938127860 2:128687328-128687350 TGGTCTCTGGTGCCCAACACTGG - Intergenic
940768107 2:157811301-157811323 TCCAGCCTGGTGGCCTACAGTGG - Intronic
942066973 2:172280781-172280803 TACAGCCTGGAGCCCTGCACTGG + Intergenic
942624739 2:177887860-177887882 TGCTGCCTAGTGCACTATAAAGG + Intronic
944501559 2:200365414-200365436 TGCTGGCTGGTTGCCTACACAGG + Intronic
945811948 2:214559472-214559494 TGCTGCCTGATGCCTCTCACTGG + Intronic
947360319 2:229339731-229339753 TGCTGACAGGTGGCCTCCACTGG + Intergenic
948585717 2:239018428-239018450 TGCAGCCGGGAGCCCTAGACAGG - Intergenic
948864906 2:240770294-240770316 TGCTCCCTGGTGCCCAGCAATGG - Intronic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1170321983 20:15110314-15110336 GCCTGCCGGGTGCCCTGCACTGG + Intronic
1170983292 20:21235835-21235857 TGCAGGCTGGCGCCCTCCACTGG - Intronic
1172427090 20:34862914-34862936 TGCTGCCCGCTGCACTTCACTGG - Exonic
1172943777 20:38672842-38672864 TGCTACTTGGTGCCCAGCACTGG - Intergenic
1175726243 20:61320637-61320659 TGCTGCCAAGTGCCCTACCCAGG + Intronic
1176095794 20:63343795-63343817 CGCTGCCTGGTGCCTGGCACAGG + Intronic
1179524534 21:41967182-41967204 TCCTGCATGGTGCCCAACACAGG + Intergenic
1179553792 21:42159948-42159970 TGCTGGCTGGTGGCCTCCAAAGG + Intergenic
1179598077 21:42456651-42456673 TGCAGCCTGGTTCCCAACAGGGG + Intergenic
1179887832 21:44322026-44322048 TGCAGCGTGATGCCCAACACTGG + Intronic
1179955951 21:44738723-44738745 AGCTGCCTGGTGTCCTCCACAGG + Intergenic
1180021220 21:45128782-45128804 TGGTGCCTGCTGCCCTCCAGTGG + Intronic
1180957903 22:19749465-19749487 TGCTCTCTGCTGCTCTACACAGG + Intergenic
1181039901 22:20187112-20187134 TGCTGTCTGGTGGCCAACACTGG + Intergenic
1181940324 22:26470813-26470835 TGATGCCTCTTGCCCTGCACAGG - Exonic
1182133894 22:27882712-27882734 TGCAGCCTGGTGCCCAGCACTGG + Intronic
1183063481 22:35349077-35349099 TCCTGCCAGGTGCCCTACCCTGG + Intergenic
1183721746 22:39566841-39566863 TGCTGCTTGGTGGGCTACTCAGG + Intergenic
1184836035 22:47021548-47021570 TTCTGCCTGGTTCCCTGCTCAGG - Intronic
952053644 3:29416770-29416792 TGGTCTCTGGTGCCCAACACTGG + Intronic
953686467 3:45082052-45082074 TGGTGGCTGGTGACCTCCACGGG + Intergenic
956915729 3:73868892-73868914 TGTTGACTGGTGCCCTCCAGTGG - Intergenic
961106715 3:124248907-124248929 TCCACCCTGGTTCCCTACACAGG + Intronic
963715572 3:148799475-148799497 TGCTCCCTGGTTTCCTACACTGG - Intronic
968451226 4:676912-676934 TGCTGCCTGGTGCCATCCCCAGG - Intronic
968568393 4:1326945-1326967 TGCTGGCTGGTGCCTCACAGGGG - Intronic
968568419 4:1327048-1327070 TGCTGGCTGGTGCCTCACAGGGG - Intronic
968873706 4:3254454-3254476 AGCTGCCTGGGGCCTTGCACAGG + Intronic
968940192 4:3633665-3633687 GGCTGCCTGCTGCTCTGCACCGG + Intergenic
969569673 4:8001201-8001223 TGCTGCCTGGGCCCCGACACCGG - Intronic
973057617 4:45680022-45680044 AGCTTCCTGGGGCCCTACCCAGG + Intergenic
977665734 4:99645289-99645311 TGATGCATGGGGCCCTATACAGG + Intronic
978885521 4:113762152-113762174 TGCTGCCCGGCGCCCAAAACAGG - Intergenic
979140379 4:117164932-117164954 TTCAGCCTGGTGGCCTACATAGG - Intergenic
979142889 4:117200986-117201008 TTCTGCCTGGTGCCCTATCCTGG - Intergenic
980007315 4:127557924-127557946 TGCTGACTGGTGCCTTCCAGGGG + Intergenic
981422068 4:144562532-144562554 TGCTGACCGTTGCCCTCCACAGG + Intergenic
985524522 5:395207-395229 TCCTGCCAGGTGGCCGACACTGG + Intronic
985654133 5:1121293-1121315 TGCTGTCTGGGGACCGACACAGG - Intergenic
986268743 5:6213085-6213107 TGCTGCCGTGTGCCCAAGACAGG + Intergenic
988302572 5:29449843-29449865 TGATGCCTGATGGCCTACACAGG - Intergenic
991762201 5:69930080-69930102 TGATGCCTAATGACCTACACAGG + Intergenic
991785127 5:70188020-70188042 TGATGCCTAATGACCTACACAGG - Intergenic
991841429 5:70805129-70805151 TGATGCCTAATGACCTACACAGG + Intergenic
991877574 5:71188418-71188440 TGATGCCTAATGACCTACACAGG - Intergenic
992433666 5:76734291-76734313 TGCTGCCTGGAGTCCTCCATCGG - Exonic
995794581 5:115928085-115928107 TGCTTTCTAGTGCCCTACAATGG + Intergenic
997354999 5:133256677-133256699 TGCACCCTGGTGCTCTAAACAGG - Intronic
998228109 5:140342315-140342337 TCTTGCCTGATGCCCTACTCTGG - Intronic
999114456 5:149150149-149150171 TTCTGCCTGCTTCCCTACTCTGG - Intronic
1000204398 5:159044560-159044582 TTCTGCCTCGTGACTTACACTGG - Intronic
1001883237 5:175264001-175264023 TGCTGCCTGGGGCCCAACGTAGG + Intergenic
1002106263 5:176880725-176880747 GGCTGGCTGGTGCCCCACGCGGG + Exonic
1002524060 5:179806080-179806102 TGCTGCCTGCTGCCCCGCGCCGG - Intronic
1002958571 6:1892924-1892946 TGCTGCCTGGTCCTCTCCAGCGG + Intronic
1009005866 6:57785750-57785772 TGATGCCTAATGACCTACACAGG - Intergenic
1014295643 6:119614136-119614158 GGCTCCCTGTTACCCTACACTGG + Intergenic
1017232813 6:152091217-152091239 TGCTGCCTGTTGCCCTTCAGGGG - Intronic
1019122457 6:169814064-169814086 TGGTGCCTGGTGACCAACCCTGG + Intergenic
1019390566 7:784321-784343 AGCTGCCTGGTGCCGAACCCTGG + Intronic
1024491847 7:49994713-49994735 TGCTGCTTGGAGCCCTTGACAGG - Intronic
1026593723 7:71716891-71716913 AACTGCCTAGTTCCCTACACAGG - Intergenic
1029459761 7:100687917-100687939 TGCTGCCAGATCCCCTCCACAGG + Intronic
1033548937 7:142427645-142427667 TGATGAGTGGTGCCCTGCACTGG - Intergenic
1034870023 7:154675752-154675774 TGCTGCCCGTTGCCCTGCTCTGG + Intronic
1035813839 8:2517155-2517177 TGGTGCCTGGTCCCCTGCACCGG - Intergenic
1036431896 8:8699458-8699480 TGCTAACTGGTCTCCTACACCGG - Intergenic
1037674209 8:21040307-21040329 TCCTGCCTGGTTCCCGCCACAGG - Intergenic
1043515024 8:80988129-80988151 TCCTGCCTGGTGACCTACACAGG + Intronic
1047339346 8:123965595-123965617 TCCTGCCTGATTCCATACACAGG - Intronic
1048052958 8:130836689-130836711 TGTTGCCTTCTTCCCTACACAGG + Intronic
1048327051 8:133447995-133448017 AGCTGGCTGCTTCCCTACACTGG - Intergenic
1049007458 8:139864522-139864544 ATCTGCCTGGTGCCATCCACAGG - Intronic
1049262528 8:141647130-141647152 TGCTTCCTGGTGCCCTGTGCTGG + Intergenic
1052974605 9:34401535-34401557 GGCTGGGTGGTGCCCTGCACAGG - Intronic
1054450564 9:65401632-65401654 GGCTGCCTGCTGCTCTGCACCGG - Intergenic
1056182778 9:84102027-84102049 CCCTGCCTGGTGCCCGGCACAGG - Intergenic
1057216211 9:93230277-93230299 TGCTGCCTGGTGCTGTATCCTGG + Intronic
1057282584 9:93723441-93723463 GGCTTCCTGGTGCCCTAGGCAGG - Intergenic
1057807975 9:98234239-98234261 TGTTTGCTGGTGCCCAACACTGG + Intronic
1059528044 9:115011052-115011074 TGCTGACTGTTCCCCTGCACAGG - Intergenic
1060943825 9:127558309-127558331 TGCCGTCTGGGGCCCTGCACGGG + Intronic
1061217897 9:129232227-129232249 TGCTGCCTGGGGCCCACCCCTGG + Intergenic
1061475183 9:130860600-130860622 TGCTCCCAGGTGCCCTGCCCTGG + Intronic
1061946862 9:133913432-133913454 CGCTTCCTGGTGCCCCACTCCGG + Intronic
1062427597 9:136513020-136513042 AACTGCCTGCTGCCCTACACAGG - Exonic
1186423611 X:9445636-9445658 TGCTGCCTGTTTCTCTAAACAGG + Intergenic
1191715694 X:64192187-64192209 TCCTGCCTGGTGACCTACCAAGG - Exonic
1195004401 X:100671768-100671790 TGCTGCCCAGTGCCCTAGAAGGG - Intergenic
1196190767 X:112791910-112791932 TGCTGCCTGGAGCTGTACAAGGG + Exonic
1198718123 X:139584373-139584395 TGCTCCTTGGTGCCCTTCAGAGG - Intronic