ID: 900373822

View in Genome Browser
Species Human (GRCh38)
Location 1:2344326-2344348
Sequence TGTGCTCACCGGAGCTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900373822_900373828 -5 Left 900373822 1:2344326-2344348 CCCCAGAAGCTCCGGTGAGCACA 0: 1
1: 0
2: 0
3: 8
4: 130
Right 900373828 1:2344344-2344366 GCACACTCGACAAGGTGGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 76
900373822_900373827 -10 Left 900373822 1:2344326-2344348 CCCCAGAAGCTCCGGTGAGCACA 0: 1
1: 0
2: 0
3: 8
4: 130
Right 900373827 1:2344339-2344361 GGTGAGCACACTCGACAAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 67
900373822_900373830 23 Left 900373822 1:2344326-2344348 CCCCAGAAGCTCCGGTGAGCACA 0: 1
1: 0
2: 0
3: 8
4: 130
Right 900373830 1:2344372-2344394 TGGCTCCGAGCGTCCCCCACAGG 0: 1
1: 0
2: 0
3: 6
4: 82
900373822_900373829 3 Left 900373822 1:2344326-2344348 CCCCAGAAGCTCCGGTGAGCACA 0: 1
1: 0
2: 0
3: 8
4: 130
Right 900373829 1:2344352-2344374 GACAAGGTGGTGCGGCGAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 81
900373822_900373831 24 Left 900373822 1:2344326-2344348 CCCCAGAAGCTCCGGTGAGCACA 0: 1
1: 0
2: 0
3: 8
4: 130
Right 900373831 1:2344373-2344395 GGCTCCGAGCGTCCCCCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900373822 Original CRISPR TGTGCTCACCGGAGCTTCTG GGG (reversed) Intronic
900373822 1:2344326-2344348 TGTGCTCACCGGAGCTTCTGGGG - Intronic
900799158 1:4726954-4726976 TGTCCTCACTGTGGCTTCTGGGG + Intronic
901220645 1:7581698-7581720 GCTCCTCACCGGAGCTTTTGCGG + Intronic
902686117 1:18078743-18078765 TGTGCCCACAGCTGCTTCTGTGG - Intergenic
905871489 1:41406933-41406955 TGGGCTCAGCGGAGTATCTGGGG + Intergenic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
907470445 1:54670462-54670484 TGTCCTCATCGGCCCTTCTGTGG + Intronic
915974786 1:160378100-160378122 CTTGCTCACCAGAGCTTCTCAGG - Intergenic
920708059 1:208269241-208269263 TCAGCTCACCGGAGAATCTGAGG - Intergenic
920712266 1:208306550-208306572 TGTGGTCAGTGAAGCTTCTGGGG + Intergenic
921257651 1:213356979-213357001 TGTGGTCACCAGGGCTGCTGTGG + Intergenic
1067661673 10:48240757-48240779 TGGGCACAGAGGAGCTTCTGGGG - Intronic
1067946021 10:50688400-50688422 CTTGCTCACAGCAGCTTCTGGGG + Intergenic
1071436032 10:85648843-85648865 TGAGCTCACCGGGACTTCAGAGG + Intronic
1071457329 10:85861097-85861119 GGTGCTGACCCCAGCTTCTGGGG - Intronic
1072611584 10:97020716-97020738 TGTGCTCAGCAGGGCTTCTGGGG + Intronic
1077218261 11:1404116-1404138 TGTGCCCACACCAGCTTCTGTGG - Intronic
1077819247 11:5719817-5719839 TGTGCTCACAGGAGGTGGTGGGG - Intronic
1080214640 11:29827071-29827093 TGTGCTCACGGCAGCTGCTCAGG + Intergenic
1084358141 11:68652868-68652890 TCTGCCCAGCGGAGCCTCTGGGG - Intergenic
1085034005 11:73289405-73289427 TGTGGTCACAGGAGCCACTGGGG - Intronic
1092117502 12:6019656-6019678 GGGGCTCACCGGGGCATCTGTGG + Exonic
1100530417 12:95456724-95456746 TGTGCTCACCGAAGCAGCAGTGG + Intergenic
1102865819 12:116373194-116373216 TGTGGTCACCTGGGCTTGTGGGG + Intergenic
1104417501 12:128607325-128607347 AGTCCTCACCAGGGCTTCTGAGG - Intronic
1104799766 12:131546684-131546706 GGTTCTCACCAGAGCCTCTGGGG - Intergenic
1107769710 13:43776747-43776769 TGTGCTCAACAGACCTTCTCTGG - Intronic
1113585691 13:111462767-111462789 TGTGCTCCTGGGAGCTACTGAGG + Intergenic
1114225356 14:20732912-20732934 AGTCCCCACCGGAGCTACTGTGG - Intronic
1115378922 14:32711360-32711382 TGTGCTCACAGGCACTTCTCTGG + Intronic
1116542616 14:46116988-46117010 TTTGCTTGCCCGAGCTTCTGGGG - Intergenic
1118882507 14:69841441-69841463 ACTGCTCACCAGAGCCTCTGTGG - Intergenic
1119207093 14:72802539-72802561 TGTGCTCACAGGAGGGGCTGGGG - Intronic
1119708517 14:76803777-76803799 TGTGCTCACCTGATCTCTTGGGG + Exonic
1120954949 14:90073582-90073604 TGTGCTCCCCGGAGCCCGTGGGG + Intronic
1125507391 15:40274617-40274639 TGTGCTCAGTGAAGCTTCTCCGG - Intronic
1126353400 15:47768834-47768856 GGGCCTCACAGGAGCTTCTGCGG + Intronic
1127975174 15:63991636-63991658 TGTGTTCCCTGGAGCTTTTGGGG - Intronic
1128260816 15:66231663-66231685 TGTGCTCACACCAGCTTCTCTGG + Intronic
1129458236 15:75687103-75687125 TGTGCTCCCAGGAGTTTCTGGGG - Intronic
1129725546 15:77899763-77899785 TGTGCTCCCAGGAGTTTCTGGGG + Intergenic
1132141549 15:99401060-99401082 TTTGGTCACCCGAGTTTCTGAGG + Intergenic
1132600936 16:772675-772697 TTGGCTCACCGGAGCTCCTGGGG + Exonic
1132759242 16:1500880-1500902 TGTGCTCACCCGACCCTGTGTGG - Intronic
1132997293 16:2829934-2829956 TGGGCCCCACGGAGCTTCTGTGG + Intergenic
1133353008 16:5114702-5114724 TGTGGACAGCAGAGCTTCTGAGG - Intergenic
1140194364 16:72844620-72844642 TCTGGTCACCAGAGCATCTGAGG - Intronic
1140499365 16:75420045-75420067 TGGGCTCAAGAGAGCTTCTGAGG - Intronic
1141161252 16:81630558-81630580 TTTTCTCACAGAAGCTTCTGTGG + Intronic
1142220710 16:88853675-88853697 TCTGCTCTCCAGGGCTTCTGGGG - Intronic
1143029747 17:3961347-3961369 TGGGCTCACAGGAGGTGCTGGGG + Intronic
1143042568 17:4049761-4049783 TGTGCCCACCGGAGCGTCAGAGG - Exonic
1144760449 17:17704139-17704161 TGTGCTCACCCTTGCTTCTGAGG + Intronic
1151266149 17:72956942-72956964 TGGGCTCACTGGTGCATCTGAGG + Intronic
1156378592 18:36536606-36536628 TGTGCTCAGGGTAGCTTCTCTGG - Intronic
1157895517 18:51463186-51463208 TGTGATCACCTGAGCTTTTCAGG + Intergenic
1160573409 18:79833940-79833962 TGTGCTGCCCAGAGCATCTGTGG - Intergenic
1160704407 19:523339-523361 CGTGCTCACCGGAAATGCTGCGG - Intergenic
1160704461 19:523537-523559 CGTGCTCACCGGAAATGCTGCGG - Intergenic
1160724272 19:610693-610715 GGTGCTCAGCGGGGCCTCTGCGG - Intronic
1162948528 19:14057518-14057540 GGGGCTCACCGGAGCTCCCGGGG + Intronic
1163693961 19:18753359-18753381 TGTCCTAACGGGAACTTCTGTGG - Intronic
1164760798 19:30726897-30726919 TGTGCTCACAGCCGGTTCTGGGG - Intergenic
1166388375 19:42395072-42395094 TGTGATCACGGGCGATTCTGTGG + Intergenic
1167769918 19:51508667-51508689 TGTGGCCACTGGAGCATCTGAGG - Intergenic
1167998110 19:53423128-53423150 TCTGCCCACCTGAGCTCCTGGGG - Intronic
1168007588 19:53503722-53503744 TCTGCCCACCTGAGCTCCTGGGG - Intergenic
926235530 2:11040542-11040564 AGTGCTGACTGGAGCTTGTGCGG - Intergenic
926718667 2:15942817-15942839 TGTCCTCTCCGGAGGTACTGAGG - Exonic
927184094 2:20469771-20469793 ATGGCTCACCGGGGCTTCTGGGG + Intergenic
927937848 2:27085627-27085649 TGCGCTCCCCGGAGCTTCCCTGG + Intronic
932598074 2:73106625-73106647 TGTGCACCCCGGAGTTTCTGTGG - Intronic
936045048 2:109180844-109180866 TGTGGTCACAGGGGCTTCAGGGG + Intronic
937030348 2:118733819-118733841 AGTTCTCTCCGGAGGTTCTGGGG + Intergenic
948139969 2:235665292-235665314 GGTGCTCAGAGGACCTTCTGGGG + Intronic
948798434 2:240419061-240419083 GATGCTCACCTGAGCCTCTGTGG - Intergenic
949016143 2:241712223-241712245 TGTCCTCACCGCAGCCTTTGAGG + Intronic
1169644135 20:7790452-7790474 TGTGCTCTCCAGAGATGCTGAGG + Intergenic
1173283467 20:41649696-41649718 TGTGCTCACTGGAGCGTGGGTGG + Intergenic
1174663217 20:52233807-52233829 TGTGCTCACCAGGGCATCTCTGG + Intergenic
1175138963 20:56845499-56845521 TGTCCCAAACGGAGCTTCTGAGG - Intergenic
1175685396 20:61024540-61024562 TGTCCTCACCGTCGCCTCTGCGG - Intergenic
1176264100 20:64199642-64199664 GCTGCTCAGGGGAGCTTCTGCGG + Intronic
1179439195 21:41381224-41381246 TGTGCCCACCACAGCTACTGTGG + Intronic
1180069773 21:45430506-45430528 TGTGCCCAAGGGAGCTGCTGAGG + Intronic
1180568936 22:16698069-16698091 GGGGCTCACCGGGGCATCTGTGG + Intergenic
1181135403 22:20762480-20762502 TGGGCTCACAGGAGCTGCTATGG + Intronic
1185155225 22:49189566-49189588 GGAGCTCACCGGTGCCTCTGCGG + Intergenic
950154716 3:10712879-10712901 TGTGCAAACCTGAGCTTGTGTGG - Intergenic
950629687 3:14274259-14274281 CGTGCTCACAGGGGCTCCTGGGG - Intergenic
953919544 3:46942607-46942629 TCTGCTCCCCGGAGGTTGTGTGG - Intronic
954107558 3:48417629-48417651 TCTGCTCACCTGGTCTTCTGAGG - Intronic
955485206 3:59428098-59428120 TGGGCCCACGGGAGCTCCTGTGG + Intergenic
957142118 3:76373838-76373860 TGGGCTCACTCGTGCTTCTGTGG + Intronic
958194561 3:90227053-90227075 TGTTTTCACCGAAGTTTCTGTGG + Intergenic
964877356 3:161383064-161383086 TGTGCCCACAGGAGCTGCTGTGG + Intergenic
967292269 3:187932705-187932727 TGTGCTCTCTGGAGGCTCTGCGG + Intergenic
968068913 3:195773958-195773980 TGGGCCCACCGCTGCTTCTGCGG - Intronic
983178203 4:164616334-164616356 TCTCCTCACAGGAACTTCTGTGG + Intergenic
983989981 4:174106800-174106822 TGGGCTGACCGCAGCTACTGGGG + Intergenic
984912489 4:184687460-184687482 TGGGCCCACAGGTGCTTCTGAGG - Intronic
990521554 5:56586330-56586352 TGTTCTCAACGGAATTTCTGAGG + Intronic
1001175116 5:169461355-169461377 TGTCCTCCTTGGAGCTTCTGGGG + Intergenic
1002603536 5:180368961-180368983 TGTGCTCAGTGGAGCTCTTGGGG - Intergenic
1004418187 6:15444485-15444507 TGTGCGCACTGGAGGTTGTGGGG - Intronic
1008217836 6:48816958-48816980 TGAGATCTTCGGAGCTTCTGAGG - Intergenic
1010629071 6:78175438-78175460 TGTGCTAACAGGAGCTTTAGTGG - Intergenic
1019467873 7:1200260-1200282 ACTTCTCACCGGGGCTTCTGTGG - Intergenic
1019495867 7:1340411-1340433 TGGGGTCACGGGACCTTCTGAGG - Intergenic
1021075777 7:16302756-16302778 TGTGCTCACTAGAGCCTCAGGGG - Intronic
1023991845 7:45133269-45133291 TGGGCACACAGGAGCTGCTGGGG - Intergenic
1026856337 7:73757639-73757661 TGTGCTCACAGGGGCTCCTAAGG + Intergenic
1031439992 7:121782353-121782375 CCTGCTCCCCGGAGCTCCTGTGG + Intergenic
1033600979 7:142888284-142888306 GGTGCTTTCAGGAGCTTCTGGGG - Intergenic
1038928375 8:32165877-32165899 TGTGCTCACAGGTGCTTTCGGGG - Intronic
1039660831 8:39462757-39462779 TGTGATTGCCTGAGCTTCTGAGG - Intergenic
1042367881 8:67957398-67957420 TGTGCTCCCTGGAGCTCCAGAGG + Intronic
1042843418 8:73147354-73147376 AGTGCTCAGTGGAGCATCTGGGG + Intergenic
1044580360 8:93820113-93820135 GGTGCTTACTGGAGTTTCTGAGG - Intergenic
1046742319 8:117842818-117842840 TGTGCTCACAGGTCCTCCTGTGG + Intronic
1048744716 8:137601174-137601196 AGTGCACACCGGAGTTACTGGGG - Intergenic
1048996023 8:139794172-139794194 TCTGCTCTCAGGAGCTCCTGGGG - Intronic
1049044953 8:140142428-140142450 TGTGGACACCGGGGCTGCTGCGG - Intronic
1049473218 8:142785443-142785465 TGTGCCCAGTGGAGCCTCTGAGG - Exonic
1055053970 9:72006675-72006697 TATGCACTCAGGAGCTTCTGAGG + Intergenic
1055095699 9:72411365-72411387 TGGGCTCTTCGGAACTTCTGTGG + Intergenic
1057880660 9:98790506-98790528 TGTGCTCACTGTGGCTTCTCGGG - Exonic
1061034604 9:128106691-128106713 AGGGCTCACAGGAGCTGCTGGGG - Intronic
1062455658 9:136636625-136636647 TGTGATCCCAGGAGCTTCGGAGG + Intergenic
1186273306 X:7913473-7913495 AGTGCCCACAGAAGCTTCTGGGG + Intronic
1186321570 X:8432258-8432280 TGTGCTCCAGGCAGCTTCTGGGG + Intergenic
1186827343 X:13353533-13353555 TATCCTCATCGGAGCTCCTGAGG - Intergenic
1191794641 X:65007922-65007944 TTTGGTCACCTGAGCTTTTGGGG - Intronic
1194009476 X:88541753-88541775 TGTGTTCACCGGGGCCACTGCGG - Intergenic
1196807711 X:119603700-119603722 TGTGCACACAGGTGCATCTGTGG - Intronic
1202272242 Y:23083396-23083418 TGTGCTCACCGACGCTGCAGCGG + Intergenic
1202293784 Y:23337286-23337308 TGTGCTCACCGACGCTGCAGCGG - Intergenic
1202425239 Y:24717140-24717162 TGTGCTCACCGACGCTGCAGCGG + Intergenic
1202445550 Y:24952945-24952967 TGTGCTCACCGACGCTGCAGCGG - Intergenic