ID: 900375468

View in Genome Browser
Species Human (GRCh38)
Location 1:2352524-2352546
Sequence GACCCTGTGCTGCGTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900375468_900375475 0 Left 900375468 1:2352524-2352546 CCTGTGCCACGCAGCACAGGGTC 0: 1
1: 0
2: 1
3: 19
4: 151
Right 900375475 1:2352547-2352569 AGCGGCGGGGAGCCACCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 102
900375468_900375474 -1 Left 900375468 1:2352524-2352546 CCTGTGCCACGCAGCACAGGGTC 0: 1
1: 0
2: 1
3: 19
4: 151
Right 900375474 1:2352546-2352568 CAGCGGCGGGGAGCCACCTGAGG 0: 1
1: 0
2: 1
3: 18
4: 193
900375468_900375476 1 Left 900375468 1:2352524-2352546 CCTGTGCCACGCAGCACAGGGTC 0: 1
1: 0
2: 1
3: 19
4: 151
Right 900375476 1:2352548-2352570 GCGGCGGGGAGCCACCTGAGGGG 0: 1
1: 0
2: 2
3: 5
4: 116
900375468_900375477 6 Left 900375468 1:2352524-2352546 CCTGTGCCACGCAGCACAGGGTC 0: 1
1: 0
2: 1
3: 19
4: 151
Right 900375477 1:2352553-2352575 GGGGAGCCACCTGAGGGGCTTGG 0: 1
1: 0
2: 3
3: 37
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900375468 Original CRISPR GACCCTGTGCTGCGTGGCAC AGG (reversed) Intronic
900339275 1:2180193-2180215 CACCCCATGCTGCGTGGCACAGG + Intronic
900375468 1:2352524-2352546 GACCCTGTGCTGCGTGGCACAGG - Intronic
900546910 1:3234462-3234484 GACCCTGTGCCTCGAGGCCCAGG + Intronic
902610694 1:17595599-17595621 GACCATGTGTGGGGTGGCACAGG + Intronic
907392697 1:54168582-54168604 CACGCTCTTCTGCGTGGCACTGG + Intronic
914355626 1:146881931-146881953 GCCTCTGTTCTGGGTGGCACTGG - Intergenic
917703015 1:177600301-177600323 AACCCTGTGCAGAGAGGCACAGG + Intergenic
922565207 1:226597127-226597149 CTCCCTGGGCTGCTTGGCACTGG + Intronic
922937232 1:229432132-229432154 GAAGCTGTGCTACGTGGCCCTGG - Exonic
1063016196 10:2080160-2080182 GACCCTTTTCTGTGTAGCACTGG + Intergenic
1063464218 10:6232600-6232622 GACCGTGAGCTGCGCGGCGCTGG - Intronic
1068858790 10:61825213-61825235 GACCCTGTGCTGCATGTCTGTGG - Intergenic
1071296505 10:84224393-84224415 GACCCTGCGATGCTTGGCACAGG - Exonic
1073068402 10:100778198-100778220 GACACTGGGCTGCATGGCAGGGG - Intronic
1077359716 11:2135412-2135434 GACCCTGTGCGGCGGGGAGCTGG - Exonic
1079335122 11:19564384-19564406 GACCCTGCGCTGGCTGACACTGG + Intronic
1083126460 11:60572341-60572363 CTCCCTGTGCTATGTGGCACTGG - Intergenic
1084316172 11:68347146-68347168 GACCTTGTTCTGCATGGCACTGG + Intronic
1084904293 11:72334266-72334288 GCCCCTGTGCTGGCTGGCCCAGG - Intronic
1089334999 11:117717151-117717173 GACCATCTTCGGCGTGGCACTGG - Intronic
1090263316 11:125338351-125338373 GAGCCTGTGCTTTGTGGCACTGG - Intronic
1090386613 11:126361047-126361069 GACCCTGTGGTGGGTGGAATGGG - Intronic
1090957924 11:131530178-131530200 GACCCTCTGGTGCCTGGCACAGG + Intronic
1091489102 12:917363-917385 AGTCCTGTGCTGCGTGGCACAGG + Intronic
1091804097 12:3343596-3343618 TACCCTGTGCTCCTGGGCACTGG - Intergenic
1091807248 12:3365580-3365602 GACTCTGTGTTGCGTGGGGCAGG + Intergenic
1095671105 12:44861187-44861209 CATGCTGTGCTGCCTGGCACTGG - Intronic
1101758744 12:107642193-107642215 GCCTCTGTGCTGGTTGGCACAGG + Intronic
1103629809 12:122251048-122251070 GCCCCTTGGCTGCGTGGTACAGG + Exonic
1104390129 12:128384897-128384919 GACCACGTCCTGCGTGGCAGAGG - Intronic
1108454430 13:50598699-50598721 GCTCCTGAGCTGCATGGCACAGG + Intronic
1112139537 13:96623311-96623333 CTCCCTGTGCTGGGGGGCACTGG + Intronic
1113783034 13:112987348-112987370 GACCTTGTGCTGGGTGGATCAGG - Intronic
1119113207 14:71994977-71994999 GACCCTGTCCTATGTGGAACTGG + Intronic
1121512518 14:94522883-94522905 GACTGTGTGCTGCATTGCACTGG + Intergenic
1122539536 14:102490189-102490211 GATCCTGTGCTGCTTCCCACTGG + Intronic
1122609836 14:102974454-102974476 GGCACTGTGCTGGGTGACACAGG - Intronic
1122659731 14:103287339-103287361 CACTCTGTGCTGTGTGGCCCTGG + Intergenic
1123041050 14:105490372-105490394 GACCCCGGGCAGCGTGTCACCGG - Intronic
1124866187 15:33493633-33493655 GACCATGTGCTGCCAGGCAGAGG + Intronic
1126065377 15:44822473-44822495 GGCCCTCTGCTGTGTGCCACAGG + Intergenic
1126094457 15:45078121-45078143 GGCCCTCTGCTGTGTGCCACAGG - Intergenic
1128230404 15:66030804-66030826 GTCCTTGTGCAGCTTGGCACGGG - Intronic
1129515078 15:76152372-76152394 GGCCCAGAGCAGCGTGGCACAGG + Intronic
1129955004 15:79628232-79628254 TACCCTGTCCTGTGAGGCACAGG + Intergenic
1130082867 15:80749801-80749823 GACCCTGTGCTGGGTGCCACAGG + Intronic
1132004400 15:98213539-98213561 GCCCCCGTGCTGCATGGTACAGG + Intergenic
1132931115 16:2459731-2459753 GTCCCTGTGCTCGGTGGCCCAGG + Intergenic
1133039623 16:3053506-3053528 GGCCCTGTGCTGAGAGGCATGGG - Intronic
1133043470 16:3073139-3073161 GGCCCTGTGCTGAGAGGCATGGG - Intronic
1133221003 16:4319125-4319147 GGCCCTGTGCTGGGTGGAATTGG + Intronic
1133232597 16:4373564-4373586 GCCCCTGGGCTGCGTGCCAGAGG - Intronic
1133868799 16:9668861-9668883 GAGGCTGTGCTGGGTGGCAGGGG + Intronic
1135099403 16:19593150-19593172 GCCCCTGTGCTGCTTGGCAGTGG + Intronic
1135425855 16:22335539-22335561 CACCCTGTGCTGCCTGGGGCTGG - Intergenic
1136232986 16:28898358-28898380 CACCCTGCGCTGCTTGGCCCTGG + Exonic
1137660894 16:50205190-50205212 GACCCTGTTCTGTGTGGGGCGGG + Intronic
1139978393 16:70833512-70833534 GCCTCTGTTCTGGGTGGCACTGG + Intronic
1142169802 16:88615695-88615717 GTCACTGTGCTGTGTGGCTCTGG + Intronic
1142188260 16:88705118-88705140 GCGCCTGTGCTGCCTGACACAGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1142691171 17:1606816-1606838 GGCCCTGTGCTGCAGGGCCCTGG + Intronic
1143025813 17:3941507-3941529 CACGCTGCGCTGCCTGGCACTGG - Exonic
1143866165 17:9925654-9925676 GAAGCTGGGCTGCGTGGCCCAGG - Intronic
1144789931 17:17851878-17851900 GTCCCTGAGGTGCTTGGCACAGG - Intronic
1147661305 17:42118453-42118475 GTCCCTCTGCTGCCTGGCCCAGG - Intronic
1147769317 17:42856715-42856737 GACCCTGTGATGCCTGACACAGG + Exonic
1147772055 17:42874534-42874556 GACCCTGTGATGCCTGACACAGG + Intergenic
1149599014 17:57881440-57881462 GACTCTCTGGTGCCTGGCACAGG + Intronic
1152561997 17:81083252-81083274 GACCCTCTGGGGCGTGGGACCGG + Intronic
1152920339 17:83063396-83063418 GTCTCTGTGCTGTGTGGCCCTGG - Intergenic
1153082267 18:1241690-1241712 CACACTGTGCTGCCTGGGACTGG - Intergenic
1153665097 18:7360968-7360990 GACCCGGTGCTGCGAAGCAGGGG - Intergenic
1154292770 18:13124558-13124580 GGCACTGTGCTGCCTGGGACAGG + Intronic
1157520512 18:48342157-48342179 GAACCTGTGCTCCTGGGCACTGG - Intronic
1160606067 18:80050221-80050243 TACCCTGGCCTGGGTGGCACAGG - Intronic
1161087929 19:2343698-2343720 GAGCCGGCCCTGCGTGGCACAGG + Intronic
1161155570 19:2730645-2730667 AACCCTGTGCAGCCTGGCCCTGG - Intronic
1161467094 19:4437080-4437102 TGGCCTCTGCTGCGTGGCACAGG + Intronic
1162790297 19:13059345-13059367 GGCCCTGTGCTGGGGGGCTCTGG - Intronic
1165342799 19:35224725-35224747 CACCCTGGGCTACGGGGCACCGG + Intergenic
1165402702 19:35612094-35612116 GACCCTGTGCTGGGTGATGCTGG - Intergenic
1166780248 19:45338526-45338548 GGGCCTGTGCTAGGTGGCACTGG + Intronic
1166872818 19:45881295-45881317 GACCCTGTGCTGGGTGATGCTGG + Intergenic
1167124383 19:47539200-47539222 GGCCCTGTGCTGGGTGGTGCTGG - Intronic
1167356236 19:49006014-49006036 AACCCTGTGCTGGGCAGCACTGG + Intronic
1168267911 19:55232269-55232291 GACCCTGGGCTGCAGGGAACAGG - Intronic
925031277 2:651667-651689 TACCCTGACCTGAGTGGCACAGG - Intergenic
926159457 2:10477440-10477462 GCCCCTGTGCTGCCAGGCCCGGG - Intergenic
927830569 2:26346372-26346394 CACCTTGTGCCGCGTGGCTCCGG + Intronic
928414871 2:31083774-31083796 GACCTTGGGCTGCCTAGCACAGG - Intronic
929732215 2:44508146-44508168 GACCCTGTTTTGAGTAGCACTGG + Intronic
929878175 2:45814336-45814358 GACCCTTGGCTGCGAGGCAAGGG - Intronic
930564121 2:52998113-52998135 GATCCTGTGATTTGTGGCACAGG - Intergenic
931168729 2:59779494-59779516 GGCCCTGTGTTGCGTGCCTCAGG + Intergenic
932429887 2:71667880-71667902 GGCCCTGTGCTGGGTGGCTGTGG + Intronic
936075514 2:109399078-109399100 TGCCCTTTGCTGCCTGGCACTGG + Intronic
942210559 2:173665182-173665204 GACCCTGTGCTGTGGCACACAGG - Intergenic
943052766 2:182936791-182936813 GACACTGTGCTGAGTGCTACAGG - Intronic
944348698 2:198701206-198701228 GAACCTGTCCAGCGTGGCAGAGG + Intergenic
947669303 2:231926361-231926383 GTCCCAGTGCTGCGCGGCGCCGG + Exonic
948845550 2:240681287-240681309 GCCTCTGTCCTGGGTGGCACCGG - Intronic
948848303 2:240693443-240693465 GCCTCTGTCCTGGGTGGCACCGG + Intronic
1172603517 20:36199673-36199695 GACCCTGGGCTGGGTGGCGGAGG + Intronic
1173319570 20:41975275-41975297 GACCCTGTGAGGACTGGCACTGG - Intergenic
1174500457 20:50980560-50980582 GAACTTGGGCTGTGTGGCACAGG + Intergenic
1179546075 21:42113074-42113096 GAGCCTGTGCTGCTTAGCAGAGG - Intronic
1184291655 22:43500687-43500709 GCCCCTGTGCTGGGTGACACTGG + Intronic
1184313659 22:43665550-43665572 CACCCTGAGCTACGTGGCACGGG - Intronic
1184443224 22:44531672-44531694 GAACCTGTGCAGCTTGGCTCTGG + Intergenic
1184714645 22:46273921-46273943 GGCCTTGTGCTGATTGGCACTGG + Exonic
1185149869 22:49158156-49158178 GAGCTGGTGCTGCGTGGCAGGGG + Intergenic
1185373422 22:50471150-50471172 AACGGTGTGCTGGGTGGCACTGG + Intronic
950549557 3:13657967-13657989 GCCCCAGAGCTGCGTGGCTCCGG + Intergenic
951585457 3:24210661-24210683 GACGCTGGGCTACCTGGCACTGG + Intronic
954444104 3:50537397-50537419 GTCCAGGTGCTGCCTGGCACAGG - Intergenic
955331151 3:58048519-58048541 GAGCCTGTGCTGTGAGGCAGTGG - Intronic
962045431 3:131754724-131754746 GACCCATAGCTTCGTGGCACAGG - Intronic
968966666 4:3772371-3772393 GGCCCTGTGCGGAGTGCCACAGG + Intergenic
973757782 4:54092347-54092369 AACCCTGTGCTGCGCGGCCGAGG - Intronic
973931967 4:55802425-55802447 GGCCCTGTGCTGTGCAGCACGGG + Intergenic
973936576 4:55852711-55852733 GACCCTTTCCTGCTTGGCACCGG - Intergenic
978324562 4:107537792-107537814 GTCCCAGAGCTGCGTGGGACTGG + Intergenic
981042838 4:140238809-140238831 GAGCCTGGGCTGGGAGGCACAGG - Intergenic
984597221 4:181683784-181683806 GACCCTGTGCTGTCTGAGACAGG + Intergenic
985937896 5:3110676-3110698 GACCCTGCAGTGCCTGGCACTGG + Intergenic
988424937 5:31053155-31053177 GAGCCTGTGGTGCCTTGCACTGG - Intergenic
995223160 5:109673840-109673862 GTCCCTGTGGTGCTTGGCACAGG - Intergenic
995300095 5:110569918-110569940 GAGACTGTGCTGCATGGGACAGG - Intronic
995738496 5:115329090-115329112 GGCTCTGTGCTCCGTGGCATTGG - Intergenic
998146888 5:139734129-139734151 GCCCATGTACTCCGTGGCACAGG - Intergenic
1002629684 5:180563133-180563155 CACCCTGTGCTGTGAGGCAGTGG - Intronic
1002896304 6:1382339-1382361 GGCCCGGGGCTGCCTGGCACGGG + Intergenic
1003610067 6:7604700-7604722 AACCCTGTGCTTGGTGGCATGGG + Intronic
1007777016 6:44229528-44229550 GACTCTGTGCTGGTAGGCACAGG + Intronic
1016598579 6:145829361-145829383 GACCCTGTGCCTCATGGCCCTGG + Intergenic
1019147238 6:169983269-169983291 GACTCTGTCCTGCGTAGCATGGG - Intergenic
1019318354 7:401921-401943 CACACTGTGCTGGGTGGCTCAGG + Intergenic
1020005703 7:4782903-4782925 GCCCCTGTGCTGGGTGTCTCTGG + Intronic
1022597274 7:31724583-31724605 GAGCCTGGGCTGTGGGGCACTGG - Intergenic
1023891703 7:44397233-44397255 CACACTGTGCTTCATGGCACAGG + Intronic
1029649907 7:101884480-101884502 GACCTTGTGCTGTTTGGGACAGG + Intronic
1032854649 7:135824354-135824376 GACCCGGTGCTGCCGGACACTGG - Intergenic
1034405409 7:150899486-150899508 GACCCTGGGCTGGGGAGCACAGG - Intergenic
1034546600 7:151793685-151793707 GCCCCTCTGCTGGGAGGCACGGG + Intronic
1035019151 7:155790058-155790080 GACACAGTGCTGCGCGGCAGCGG + Intergenic
1035483538 7:159205003-159205025 GTCCCTGTGGAGCCTGGCACTGG + Intergenic
1035549014 8:505929-505951 GACCCTGTCCTGGCTGGCACTGG - Intronic
1035844721 8:2850791-2850813 GTGCCTGTGCTGCTTGGGACTGG + Intergenic
1038098034 8:24337517-24337539 GACACTGTGCTGGGAGGCACTGG - Intronic
1038481798 8:27907090-27907112 GCCCATGTGCTGCCTGGGACTGG + Intronic
1046915210 8:119672281-119672303 AAACCTGTGCTCCGTGGAACTGG + Intronic
1049211263 8:141387434-141387456 GTCCCAGTGATGCCTGGCACAGG + Intergenic
1049251442 8:141591225-141591247 GGCCCTGTGCTGTGTGGAAGTGG + Intergenic
1049259113 8:141629388-141629410 GAGCCTGTGCTGCCTGCCGCTGG + Intergenic
1055470749 9:76607964-76607986 GACCCAGGGCTGCATGTCACTGG - Intergenic
1056215288 9:84400632-84400654 AACCCTGTGCTGCAAGCCACAGG - Intergenic
1057180507 9:93027183-93027205 GCACCTGTCCTGCTTGGCACAGG - Intronic
1057211866 9:93204881-93204903 GACCCTGTCCTGCCTGGCCCTGG + Intronic
1057439851 9:95074975-95074997 GACCCTGTGCTCACTGCCACGGG + Intronic
1057841581 9:98489801-98489823 GCCCCTGTTATGCTTGGCACAGG + Intronic
1058818633 9:108708774-108708796 GACCGTGTGCTCTGGGGCACGGG - Intergenic
1060528428 9:124333467-124333489 GACCCTGTGCTGCCAGGCTCAGG + Intronic
1060958076 9:127658675-127658697 GAGCCTGTGTTCCGTGGCCCTGG + Intronic
1062138537 9:134942845-134942867 CACCCTGCTCTGCTTGGCACAGG + Intergenic
1192502358 X:71662431-71662453 GACCGTGTGCATGGTGGCACCGG + Intergenic
1192509546 X:71713785-71713807 GACCCTGTGCATGGTGGCACCGG + Intergenic
1192511204 X:71721357-71721379 GACCGTGTGCATGGTGGCACCGG - Intergenic
1192515493 X:71760196-71760218 GACCGTGTGCATGGTGGCACCGG + Intergenic
1192517151 X:71767768-71767790 GACCCTGTGCATGGTGGCACCGG - Intergenic
1197147309 X:123184726-123184748 GTCCCTGTCCTGCGTGGCCTGGG + Intronic
1200765751 Y:7079362-7079384 GACCATGTCCTGAGAGGCACTGG - Intronic