ID: 900375491

View in Genome Browser
Species Human (GRCh38)
Location 1:2352616-2352638
Sequence GCCCACTAGGAACACCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900375491_900375495 1 Left 900375491 1:2352616-2352638 CCAGGTGGGTGTTCCTAGTGGGC 0: 1
1: 0
2: 2
3: 15
4: 102
Right 900375495 1:2352640-2352662 TAGTCTGTGACTGCAGGGAGAGG 0: 1
1: 0
2: 2
3: 23
4: 229
900375491_900375500 30 Left 900375491 1:2352616-2352638 CCAGGTGGGTGTTCCTAGTGGGC 0: 1
1: 0
2: 2
3: 15
4: 102
Right 900375500 1:2352669-2352691 CAGACCTGGAGCTTCCACCATGG 0: 1
1: 0
2: 2
3: 17
4: 242
900375491_900375493 -5 Left 900375491 1:2352616-2352638 CCAGGTGGGTGTTCCTAGTGGGC 0: 1
1: 0
2: 2
3: 15
4: 102
Right 900375493 1:2352634-2352656 TGGGCATAGTCTGTGACTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 170
900375491_900375496 2 Left 900375491 1:2352616-2352638 CCAGGTGGGTGTTCCTAGTGGGC 0: 1
1: 0
2: 2
3: 15
4: 102
Right 900375496 1:2352641-2352663 AGTCTGTGACTGCAGGGAGAGGG 0: 1
1: 0
2: 3
3: 32
4: 354
900375491_900375494 -4 Left 900375491 1:2352616-2352638 CCAGGTGGGTGTTCCTAGTGGGC 0: 1
1: 0
2: 2
3: 15
4: 102
Right 900375494 1:2352635-2352657 GGGCATAGTCTGTGACTGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 148
900375491_900375497 16 Left 900375491 1:2352616-2352638 CCAGGTGGGTGTTCCTAGTGGGC 0: 1
1: 0
2: 2
3: 15
4: 102
Right 900375497 1:2352655-2352677 GGGAGAGGGCTGCCCAGACCTGG 0: 1
1: 0
2: 1
3: 52
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900375491 Original CRISPR GCCCACTAGGAACACCCACC TGG (reversed) Intronic
900375491 1:2352616-2352638 GCCCACTAGGAACACCCACCTGG - Intronic
901931386 1:12597947-12597969 GCCCAACAGGAACACCCAGTGGG + Intronic
912379447 1:109239477-109239499 GCCCACTGGGAACTCTCACAGGG + Intergenic
916585942 1:166150173-166150195 GTGCACTAGGCACAACCACCTGG - Intronic
918263945 1:182822653-182822675 GAGAACTAGGAACATCCACCAGG + Intronic
920170589 1:204070068-204070090 GCCCACAGGGAATGCCCACCTGG + Intergenic
920556025 1:206905204-206905226 GCCCACTATGAAAATCCACCTGG - Intronic
922677851 1:227563735-227563757 GCCATCTTGGAACACCCTCCCGG - Intronic
1070568148 10:77619640-77619662 GCCCTCTAGGACCACCTGCCAGG + Intronic
1070895331 10:79979292-79979314 GCCCTGCAGGAACACCAACCTGG + Intronic
1076803356 10:132843293-132843315 GCACCCTGGGAACACCCACCAGG - Intronic
1076803470 10:132843727-132843749 GCACCCTGGGAACACCCACCAGG - Intronic
1076803521 10:132843910-132843932 GCATCCTGGGAACACCCACCAGG - Intronic
1076803581 10:132844130-132844152 GCACCCTGGGAACACCCACCAGG - Intronic
1076803601 10:132844202-132844224 GCACCCTGGGAACACCCACCAGG - Intronic
1078067250 11:8086539-8086561 GTTAGCTAGGAACACCCACCTGG + Intronic
1078908664 11:15710943-15710965 TTCCACTAGGAACACTTACCTGG + Intergenic
1080598807 11:33802360-33802382 CCCCACTAGGACCACACACCAGG - Intergenic
1084510348 11:69599505-69599527 GCCCACCAGGCACACCCTGCAGG + Intergenic
1091599144 12:1907632-1907654 GCCCACCAGGCACCCTCACCGGG - Intronic
1091599149 12:1907645-1907667 GCCCACCAGACACGCCCACCAGG - Intronic
1091599157 12:1907684-1907706 GCCCACCAGGCACACCCACCAGG - Intronic
1091599168 12:1907722-1907744 GCCCACCAGGCACGCCCACCAGG - Intronic
1091599185 12:1907787-1907809 GCCCACCAGGCACACCCACCAGG - Intronic
1096053017 12:48627904-48627926 GCCCACTAGGATCAGCCAGGTGG - Intergenic
1096053246 12:48629394-48629416 GCCCACTAGGATCAGCCAGGTGG - Intergenic
1100052883 12:90471584-90471606 TCTCACTAGGAACACCAAACAGG - Intergenic
1103913231 12:124363296-124363318 GCCCTCTGGGAACACCCTCCTGG - Intronic
1104170201 12:126273312-126273334 GCCTACTAGGACCACCAGCCTGG + Intergenic
1113485041 13:110647035-110647057 GCCCACCAGCAGCACCCAGCAGG + Intronic
1115780593 14:36764245-36764267 GCCAGCTAGGAACACTCACTCGG + Intronic
1121901748 14:97699013-97699035 GCAGACTAGGATCAGCCACCTGG - Intergenic
1122842510 14:104473289-104473311 CCTCACAAGGAACCCCCACCTGG + Intergenic
1202895321 14_GL000194v1_random:3191-3213 GCCAAGCAGGAACAGCCACCTGG + Intergenic
1127232732 15:57014645-57014667 GCCTGCTAGGTACACCCTCCAGG + Intronic
1128285945 15:66437115-66437137 GTGCTCTAGGTACACCCACCAGG - Intronic
1129458572 15:75688667-75688689 GCACACTCAGAACACCCAGCAGG - Exonic
1129725220 15:77898205-77898227 GCACACTCAGAACACCCATCAGG + Intergenic
1129823991 15:78622262-78622284 GCCCTCTCTGACCACCCACCAGG + Intergenic
1130273269 15:82463411-82463433 GCACACTCAGAACACCCAGCAGG + Intergenic
1130465620 15:84190782-84190804 GCACACTCAGAACACCCAGCAGG + Intergenic
1130487071 15:84404038-84404060 GCACACTCAGAACACCCAGCAGG - Intergenic
1130498645 15:84482754-84482776 GCACACTCAGAACACCCAGCAGG - Intergenic
1130587910 15:85195377-85195399 GCACACTCAGAACACCCAGCAGG + Intergenic
1138645215 16:58419741-58419763 ATCCACTAAGAAAACCCACCTGG + Intergenic
1138850419 16:60622423-60622445 TCCCACCAGGAAATCCCACCTGG + Intergenic
1141280176 16:82624283-82624305 GCCCTTTGGGCACACCCACCTGG + Intergenic
1142059883 16:88022502-88022524 TCCCACTAGGTACCACCACCTGG - Intronic
1144495008 17:15740595-15740617 GCCAAGCAGGAACAGCCACCTGG - Intronic
1145976739 17:28988270-28988292 GCCCACTAGGAAGTGCCCCCAGG - Intronic
1146659144 17:34652994-34653016 ACCCACAAGGTCCACCCACCTGG - Intergenic
1147141429 17:38462837-38462859 GCCCACTAGGACCCTCCCCCCGG + Exonic
1147656824 17:42095846-42095868 GCCCACCTGGAACACTCACAGGG + Intergenic
1148647387 17:49226808-49226830 TTCCACCAGGAATACCCACCTGG + Intronic
1151178266 17:72306813-72306835 GACCACAAGGAAGACCGACCAGG + Intergenic
1151475408 17:74342146-74342168 GCACACAAGGCACACACACCCGG + Intronic
1154055155 18:11005709-11005731 TCCCACAAAGAACACACACCAGG + Intronic
1154492589 18:14933245-14933267 GCCCACCAGGACCACTAACCAGG + Intergenic
1155984997 18:32220583-32220605 ACCCACTAGAAACACCCAATGGG + Intronic
1157330373 18:46699814-46699836 GCCCTCCAGGAACCTCCACCTGG + Intronic
1157570176 18:48707004-48707026 GCACACTGGGACTACCCACCAGG - Intronic
1159952654 18:74496428-74496450 GTCCATCAGGAAGACCCACCTGG - Exonic
1160034486 18:75287657-75287679 GTCCATCATGAACACCCACCTGG + Exonic
1162931425 19:13959670-13959692 GCCCACTGCCCACACCCACCTGG - Exonic
1167153433 19:47723171-47723193 GCCCACTGGGGACACAGACCTGG - Intronic
929354386 2:41002033-41002055 GACCACCAGGAACACACACAGGG + Intergenic
933762455 2:85681681-85681703 GCCCACTCTGAACCCTCACCTGG - Intergenic
935141141 2:100354052-100354074 GGCCAATAGGAACATGCACCTGG + Intergenic
936045755 2:109186646-109186668 GCCCCCTAGGAAGACCCTGCGGG + Intronic
936070069 2:109362494-109362516 GCCCACAGGGAACATTCACCAGG - Intronic
937443125 2:121933777-121933799 GCCCACCAGGAAAACCCATCAGG - Intergenic
938492878 2:131775211-131775233 GCCAAGCAGGAACAGCCACCTGG - Intergenic
946200579 2:218068688-218068710 GCCCACCTGGGAAACCCACCTGG + Intronic
946690880 2:222307345-222307367 GCCCACTAGCACCACCCGCCAGG + Intergenic
1169357991 20:4924132-4924154 GCCTGCTAGGCACACCCATCAGG + Intronic
1174896195 20:54452381-54452403 ACCTTATAGGAACACCCACCTGG + Intergenic
1175240359 20:57543086-57543108 GGCCACTATGAACAAGCACCTGG + Intergenic
1176615019 21:9019178-9019200 GCCAAGCAGGAACAGCCACCTGG + Intergenic
1176710182 21:10144693-10144715 GCCAAGCAGGAACAGCCACCTGG - Intergenic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1179488976 21:41728131-41728153 GCCCTCCAGGAAAACCCACAGGG + Intergenic
1181731698 22:24851680-24851702 GCCCCCTTGGAACATCCATCAGG - Intronic
1183254834 22:36755789-36755811 GCCTGCTAGGAAGACCCAGCAGG - Intergenic
1184950033 22:47834482-47834504 CCCCACTGGGACCACCCCCCGGG - Intergenic
954360219 3:50118235-50118257 ACCCAGCAGGACCACCCACCAGG - Intronic
956881849 3:73519128-73519150 TCCCACTGGCCACACCCACCTGG + Intronic
968752663 4:2398265-2398287 GCCCACCATGACCACCCATCGGG - Intronic
976745967 4:88403298-88403320 GCTCACCAGAATCACCCACCAGG + Intronic
979358326 4:119731947-119731969 TCCCTCTAGGAACACCCAACTGG + Intergenic
980595450 4:134948428-134948450 CCGCACTAGGAACAGCCAGCTGG - Intergenic
982988821 4:162244709-162244731 TTCCACTAGGAACACTCAACTGG + Intergenic
984901557 4:184590937-184590959 GCACACCAGGAATGCCCACCAGG - Intergenic
985975532 5:3416686-3416708 CCCCACAAGGAACGCCCCCCAGG + Intergenic
990150348 5:52810322-52810344 GGACACTAGAAAGACCCACCGGG + Intronic
1001133552 5:169083859-169083881 GCCTACTTAGAATACCCACCTGG + Intronic
1003191410 6:3878442-3878464 ACCCACCAGGGACACCCACATGG + Intergenic
1003241182 6:4347070-4347092 GCCCACCAGGAGCCCCCACTGGG - Intergenic
1006626642 6:35402531-35402553 GCCCCCTAGGAACAGCCTCCAGG - Intronic
1007910238 6:45506129-45506151 GCACACTAAGAACCACCACCAGG - Intronic
1012894698 6:104935570-104935592 GCCCCCTTGGTACCCCCACCAGG + Intergenic
1022010009 7:26300579-26300601 GGCAACTGGGAACACTCACCTGG - Intronic
1022232397 7:28426976-28426998 GTCCTCCAGGAACACTCACCAGG - Intronic
1026342726 7:69448000-69448022 GCCCACTTGGCACCCCCAGCTGG + Intergenic
1026504141 7:70967912-70967934 GCCCATAGGGAACACCCACAGGG + Intergenic
1029580976 7:101436408-101436430 CCTCACTAGGAACCCCCACGAGG - Intronic
1035047632 7:155979720-155979742 GGCCACCAGGCACACTCACCAGG + Intergenic
1040665570 8:49627687-49627709 GCCCCCTAGTAACAGCCACAAGG - Intergenic
1041096086 8:54351589-54351611 GCCTACTAGGAACACATACCTGG - Intergenic
1044973862 8:97644649-97644671 GCCCACCAGGATCACCCAGCCGG - Exonic
1053647161 9:40130391-40130413 GCCAAGCAGGAACAGCCACCTGG - Intergenic
1053758564 9:41333452-41333474 GCCAAGCAGGAACAGCCACCTGG + Intergenic
1054537419 9:66245779-66245801 GCCAAGCAGGAACAGCCACCTGG + Intergenic
1057185610 9:93055987-93056009 GCCCACTAGGGACAACCGCCTGG - Intergenic
1057826842 9:98378162-98378184 GCTGCCTAGGAACACCCACTTGG - Intronic
1060047731 9:120353911-120353933 TTCCACTAGGAGCACCCCCCCGG - Intergenic
1202794946 9_KI270719v1_random:113688-113710 GCCAAGCAGGAACAGCCACCTGG - Intergenic
1186055730 X:5647664-5647686 GCCCACAAGGAAAATCCATCAGG - Intergenic
1186509489 X:10119911-10119933 GCCCTCTGGGGACACCCAGCAGG - Intronic
1192351536 X:70360494-70360516 GGCCACAAGGACCACCCACGTGG - Intronic
1198508279 X:137323467-137323489 GCCCTCTGGGAAGACCCATCTGG - Intergenic