ID: 900376071

View in Genome Browser
Species Human (GRCh38)
Location 1:2355472-2355494
Sequence CACAGACCCCCGAGGCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900376067_900376071 2 Left 900376067 1:2355447-2355469 CCTAGAAGAGTGAGCTCCCTGCA 0: 1
1: 0
2: 2
3: 25
4: 187
Right 900376071 1:2355472-2355494 CACAGACCCCCGAGGCTCTGAGG 0: 1
1: 0
2: 1
3: 16
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900376071 Original CRISPR CACAGACCCCCGAGGCTCTG AGG Intronic
900376071 1:2355472-2355494 CACAGACCCCCGAGGCTCTGAGG + Intronic
900607213 1:3529222-3529244 CACTGGCCCCCGAGACTCAGAGG + Intronic
900964906 1:5951171-5951193 AGGAGACCCGCGAGGCTCTGAGG + Intronic
901153665 1:7121627-7121649 CAGAGACCCCCTGGGCACTGAGG - Intronic
901448667 1:9323266-9323288 CACAGCCCCCCTCGGCTCGGCGG - Intronic
902090832 1:13901965-13901987 CACATAGCCTCAAGGCTCTGAGG + Intergenic
902821352 1:18945244-18945266 CCCAGACCTCCGAGACTCTCTGG + Intronic
903172135 1:21560912-21560934 GACAGCCCCCTGAGGATCTGGGG + Intronic
904137766 1:28327251-28327273 CACAGACACCTGATGCTCAGTGG + Intergenic
905695981 1:39973811-39973833 CACACACCAACTAGGCTCTGAGG + Intergenic
912305179 1:108560042-108560064 CCCCGACCCCCGAGGCGCTGAGG + Intergenic
912492672 1:110070627-110070649 CACAGGCCTCCGGGGCTCCGGGG + Exonic
914801771 1:150967537-150967559 CACAAACCCCCTAGCCCCTGAGG + Intronic
915493274 1:156263562-156263584 CACCCACCCCCCAGCCTCTGAGG - Exonic
917499774 1:175575746-175575768 CACAGTCCCCCGGTGCACTGTGG - Intronic
918072293 1:181141806-181141828 CACAGAGGCCCGAGGCTCTCAGG + Intergenic
919570554 1:199242979-199243001 AACAGAGACCAGAGGCTCTGAGG - Intergenic
920201660 1:204263299-204263321 CAAAGCCCCCGGAGCCTCTGTGG + Intronic
921028455 1:211313425-211313447 CACAGACCCCACAGGCTCCTCGG + Exonic
921360191 1:214324364-214324386 CAAAGACCCCCAAGACTCTGAGG - Intronic
924651549 1:245932670-245932692 CAGTTACCCCGGAGGCTCTGAGG - Intronic
1063380471 10:5582358-5582380 CCCAGACCAGGGAGGCTCTGGGG - Intergenic
1064683876 10:17838720-17838742 CTCAGCCTCCCAAGGCTCTGGGG - Intronic
1070981439 10:80651902-80651924 CACAGACCCCCGAGGATGGCTGG + Intergenic
1071205322 10:83269206-83269228 CACACACCACCTAGACTCTGAGG + Intergenic
1071753290 10:88505996-88506018 CACAGACCCCAGGAACTCTGGGG + Intronic
1073536469 10:104281116-104281138 TGCAGAACCCAGAGGCTCTGAGG - Intronic
1074401461 10:113144280-113144302 CATGGTCCCCAGAGGCTCTGTGG + Intronic
1075072016 10:119325969-119325991 CACAAACCCCAGAGTCTCCGAGG - Intronic
1075391098 10:122092699-122092721 CACAGACCCCCATGGGTGTGAGG - Intronic
1075618959 10:123911735-123911757 CAGAGCCCACAGAGGCTCTGTGG - Intronic
1076374935 10:129977103-129977125 CACCGACTCCTGCGGCTCTGAGG + Intergenic
1076429460 10:130391497-130391519 CACAGACCCCATAGGCTCTGTGG + Intergenic
1076644907 10:131946443-131946465 CACATTCCACCGAGGCACTGGGG - Intronic
1077017475 11:403367-403389 CGCTGACCTCCGAGGCTCCGCGG - Intronic
1077430426 11:2513459-2513481 CCAAGACCCCCTAGGCTCTATGG - Intronic
1077546887 11:3175798-3175820 CACTGAACCCCGAGGTGCTGTGG - Intergenic
1079130087 11:17742211-17742233 CACAGACTCCAAATGCTCTGAGG - Intronic
1081722234 11:45298792-45298814 CACTGAACTCCGAGGCTCTGTGG + Intergenic
1081992988 11:47347597-47347619 CTCAGACCCCTGGGGGTCTGCGG + Intronic
1083170590 11:60922039-60922061 CACTGGCTCCCGAGCCTCTGGGG + Exonic
1083627209 11:64077901-64077923 CACAGTCCCCAGAGGGTCTAAGG - Intronic
1084311967 11:68322252-68322274 CTCAGACTCCCTGGGCTCTGAGG + Intronic
1084315151 11:68341555-68341577 CACAGCCCCCTGAAGCTCAGGGG - Intronic
1084683380 11:70679886-70679908 CACAGTCACCCTGGGCTCTGTGG - Intronic
1088695452 11:112362356-112362378 CAGCGAGCCCCGAGGCTCTTCGG + Intergenic
1089083677 11:115798810-115798832 CACAAACCCAGGAGGCTCTGCGG - Intergenic
1090435658 11:126684456-126684478 CTCAGAGCCCTGAGGCTTTGTGG - Intronic
1091099514 11:132857957-132857979 CACTGAACCCCGAGGCAATGAGG + Intronic
1091900623 12:4141242-4141264 CACAGACCCCTTAGGCTCAAAGG + Intergenic
1092208531 12:6631587-6631609 GACAGATCCCAGAGGCCCTGAGG - Intronic
1092793453 12:12088822-12088844 CACGGTCCCCTGAGCCTCTGTGG - Intronic
1095983334 12:47984798-47984820 CGCAATGCCCCGAGGCTCTGTGG + Intronic
1096513092 12:52142656-52142678 CACAGACAACTGAGGCTTTGAGG + Intergenic
1096694602 12:53340553-53340575 CCCAGGCCCCCGCTGCTCTGCGG + Intronic
1100490705 12:95075139-95075161 CTCAGCCTCCCAAGGCTCTGGGG - Intergenic
1101599373 12:106195725-106195747 CACAGAACCCCCATTCTCTGTGG + Intergenic
1104875694 12:132033062-132033084 CTCAGCCCCCCGAGGAGCTGAGG + Intronic
1107411149 13:40159849-40159871 CACAGTCCCTCTAGGCTCTGCGG + Intergenic
1108125134 13:47234321-47234343 CACAGAATCCCCAGGGTCTGGGG + Intergenic
1112290621 13:98142452-98142474 CACTGTCCCCCGAGGCTGGGCGG + Intergenic
1113847945 13:113403162-113403184 CACAGAGCCACGAGGCCATGGGG - Intergenic
1114066436 14:19062712-19062734 CAGAGGCCCCTGAGGCTCGGAGG - Intergenic
1114095832 14:19337312-19337334 CAGAGGCCCCTGAGGCTCGGAGG + Intergenic
1114532025 14:23402379-23402401 CTCAGATCCCAGAGACTCTGAGG - Intronic
1117233046 14:53741908-53741930 CATGGACCCCCAAGGATCTGGGG + Intergenic
1118317942 14:64737139-64737161 CACAGACCTGCGCTGCTCTGTGG + Intronic
1118355937 14:65013797-65013819 CTCAGCCTCCTGAGGCTCTGGGG + Intronic
1119512420 14:75222040-75222062 CAGAGAGCCCCCAGTCTCTGGGG + Intergenic
1119877071 14:78069951-78069973 CCCTGCCTCCCGAGGCTCTGAGG - Intergenic
1121029274 14:90644191-90644213 ACCAGATCCCAGAGGCTCTGGGG - Exonic
1122504572 14:102223850-102223872 CACAGACAGCTGAGGCTGTGAGG - Intronic
1122783357 14:104153085-104153107 CAGAGACCCCGTAGTCTCTGGGG + Intronic
1123702086 15:22922323-22922345 CCCAGGACCCCAAGGCTCTGGGG + Intronic
1124035302 15:26048867-26048889 CATGGCCCCCCGAGGCCCTGGGG - Intergenic
1124634747 15:31357824-31357846 CAGAGACTCCCGAGCCTTTGTGG + Intronic
1127910600 15:63413070-63413092 CAGAGACCCCCAGGGATCTGGGG + Intergenic
1128388151 15:67165152-67165174 CCCATCCCCCCGAGGGTCTGCGG + Intronic
1129262262 15:74374963-74374985 CACAGAACCCCCACCCTCTGTGG + Intergenic
1129330635 15:74825541-74825563 CACACACCCCCAGGGCCCTGGGG + Exonic
1133210844 16:4262665-4262687 CACTAACCCCCGAGACTCAGCGG - Exonic
1136120075 16:28127195-28127217 CACAGAGACACGAGGCTCTGGGG - Intronic
1139958263 16:70703599-70703621 CACACAGCCCAGAGGCCCTGTGG + Intronic
1140943554 16:79746667-79746689 CATGTACCCCTGAGGCTCTGGGG - Intergenic
1141040765 16:80670633-80670655 CAGAGAACCCCGGGGCTCCGTGG + Intronic
1141576191 16:84964743-84964765 CTCAGGCCCCCTTGGCTCTGTGG - Intergenic
1141660156 16:85437152-85437174 CACAGTCCCCCAACCCTCTGAGG + Intergenic
1142287635 16:89177876-89177898 CACTGACTCCCCAGGCTCGGGGG + Intronic
1142709190 17:1714509-1714531 CAGAGGCCCCCGGGGCTGTGAGG + Intergenic
1144639126 17:16927902-16927924 CACAGGCCCCCGGGGATTTGGGG + Intergenic
1144866815 17:18340990-18341012 CACAGACCCAGGAGTCCCTGAGG + Intronic
1146366494 17:32233011-32233033 CCCAGACCTCCAAGACTCTGAGG + Intronic
1146628028 17:34448725-34448747 CACAGACCCCAGAGGCAATGGGG + Intergenic
1147159192 17:38560705-38560727 CACAGACCCCAGGGGCCCCGAGG + Intronic
1147246246 17:39123013-39123035 CATGGAACCCCGAGGGTCTGAGG - Intronic
1147986726 17:44311220-44311242 CACTGACCTCTGAGGCTCTCAGG - Intronic
1148629189 17:49093364-49093386 CACAGACCCCTCCGCCTCTGGGG + Intergenic
1148751213 17:49946932-49946954 CACAGACCCCCCAGTCTGAGGGG - Intergenic
1148751239 17:49947016-49947038 CACAGACCCCCCAGTCTGAGGGG - Intergenic
1149593954 17:57852376-57852398 CACAGCCGCCCAAGGCTGTGAGG + Intergenic
1150246058 17:63676254-63676276 TACAGACCCAGGAGGGTCTGGGG - Intronic
1151055281 17:71023594-71023616 CCAAGACCCCAGAGGCACTGAGG - Intergenic
1152199128 17:78935002-78935024 CAGAGGGCCCCTAGGCTCTGTGG + Intergenic
1152725218 17:81941766-81941788 CACAGTCCCCCAAGGCCCTGGGG + Exonic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1155524267 18:26700531-26700553 GACAGAGCCCTGAGGCTCTTTGG + Intergenic
1160054303 18:75464819-75464841 CCCAGACCCTTGAGGCTCTTCGG + Intergenic
1160538553 18:79608237-79608259 CTGAGACCCTCGGGGCTCTGTGG - Intergenic
1160941131 19:1620961-1620983 CACAGACCTGCCAGGCCCTGGGG + Exonic
1161233479 19:3186919-3186941 CCCAGACCCCTGACGCTCTCTGG + Intronic
1161348367 19:3778955-3778977 CACATACCCCTGGGGCTTTGGGG - Intronic
1161435427 19:4259955-4259977 CACTGACCCCCAGGGCTGTGTGG - Intronic
1161492842 19:4571756-4571778 CACAGCCCAGCCAGGCTCTGGGG + Intergenic
1162110688 19:8398087-8398109 CCCAGCCGCCCCAGGCTCTGGGG - Intronic
1162373851 19:10293894-10293916 CACCAACCCTCGGGGCTCTGCGG + Exonic
1162455302 19:10780382-10780404 CACAGACCCCAAAGGCCCTTAGG - Intronic
1162651563 19:12092559-12092581 CACAGACCCCGGAGTCGCCGCGG - Intronic
1164628682 19:29746719-29746741 CACAGGACCCCAAGGCTCAGGGG + Intergenic
1164703440 19:30302646-30302668 CACAGACGCCAGAGGCTCGTGGG - Intronic
1164894003 19:31853582-31853604 CACAAAACCCCGAGGCACTTTGG - Intergenic
1165152473 19:33769153-33769175 CACTGCCCTCCGAGGCTGTGGGG + Intronic
1165447000 19:35861877-35861899 CCCAGTCCCCCGCGGCTCTCTGG - Exonic
1165453991 19:35900362-35900384 GAAAGACTCCCGAGGCCCTGAGG - Intronic
1165893351 19:39127639-39127661 CACAGAGCCCCTAGCCTCAGAGG + Intronic
1166394913 19:42432515-42432537 CACAGCCTCCCAAGGATCTGGGG - Intronic
1167240557 19:48340753-48340775 CACAGCTCCCTGCGGCTCTGAGG + Intronic
1168181415 19:54664995-54665017 CACAGGCTCCCAAGGCCCTGAGG + Intronic
925360649 2:3278160-3278182 CACAGGCCCCAGAGGCCCAGGGG + Intronic
926095705 2:10079870-10079892 CGCCGTCCCCCGAGGCCCTGCGG + Intronic
926126824 2:10277220-10277242 CAAAGCCCCCCAAGGCTCCGAGG - Intergenic
927963999 2:27258042-27258064 CAAAGCCCCCAGAGTCTCTGCGG + Exonic
928114211 2:28535377-28535399 CACTTACCCCAGAGGCCCTGTGG + Intronic
928138472 2:28706952-28706974 CACTCCCCCCAGAGGCTCTGGGG - Intergenic
933343153 2:81048430-81048452 CACAGCTCCCCCAGGCACTGAGG + Intergenic
933847541 2:86337702-86337724 CCCAGCCCCCCGGGGCTCGGCGG + Intronic
934026254 2:88003587-88003609 CTCCGGCCCCCGAGGCTCAGTGG + Intergenic
934659075 2:96133567-96133589 CAAAGACCACCAGGGCTCTGGGG - Intronic
941432740 2:165431309-165431331 CAGGGACCCCCAAGGCTCTGTGG + Intergenic
942454790 2:176130273-176130295 CACAGGCCCCCGCGGCAGTGCGG + Exonic
944413400 2:199462842-199462864 CCCAGACCCTCGGGCCTCTGGGG - Intronic
944413403 2:199462843-199462865 CCCAGAGGCCCGAGGGTCTGGGG + Intronic
944510067 2:200455899-200455921 CCCAGACACCCCAGGCTTTGTGG + Intronic
945765106 2:213966211-213966233 CTCAGACCCCTCAGGCTCAGTGG - Intronic
945930963 2:215854479-215854501 CACAGGCCCCAAAGGCTATGAGG + Intergenic
946400326 2:219465164-219465186 CACATATGCCCCAGGCTCTGGGG - Intronic
946731800 2:222717119-222717141 CACATACCCTCAAGGCTCTCGGG - Intergenic
947854541 2:233314329-233314351 CTCAGAACCCCGAGGCCCTCAGG + Intronic
948015469 2:234686698-234686720 CACCGTCTCCAGAGGCTCTGGGG - Intergenic
948228743 2:236334366-236334388 CAGAGACCCCACAGCCTCTGGGG - Intronic
948724069 2:239921004-239921026 CACAGAACCCTGTGGCTGTGTGG - Intronic
1169744963 20:8934459-8934481 CATAGGCCCCTGAGGCTCTGAGG + Intronic
1171097338 20:22344184-22344206 CAGAGACCCTCGAGGCCCTAAGG + Intergenic
1171381816 20:24739112-24739134 CACAGGCCCTCGGGACTCTGAGG + Intergenic
1171387021 20:24777262-24777284 CCTCGACCCCAGAGGCTCTGAGG + Intergenic
1172207317 20:33173185-33173207 CTCAGACCACCTTGGCTCTGTGG - Intronic
1172344117 20:34183697-34183719 CATAGACCCCCTAGGCAGTGGGG + Intergenic
1172975787 20:38904785-38904807 CTCAGGCCCCCGAGGTTCTCTGG + Intronic
1173256331 20:41396306-41396328 CAAAGAGCCCCAAGGCGCTGGGG + Intergenic
1174192328 20:48749271-48749293 CACAGCTCCCCGTGGCCCTGTGG - Intronic
1175604073 20:60298283-60298305 CACTCACTCCTGAGGCTCTGGGG + Intergenic
1178875290 21:36409470-36409492 AACACACCCCTGAGGCTCTGAGG - Intronic
1179642014 21:42754003-42754025 CAGAGACCATCGAGGCCCTGCGG + Exonic
1180484914 22:15785303-15785325 CAGAGGCCCCTGAGGCTCGGAGG - Intergenic
1181077993 22:20394224-20394246 CAGAGACCGCCGACGGTCTGAGG - Exonic
1181458032 22:23070602-23070624 CCCCGACCCCTGAGGCTCAGCGG - Intronic
1181474514 22:23160056-23160078 AATAGGCCCCCAAGGCTCTGGGG + Intronic
1181556802 22:23675895-23675917 CTGAGGCCCCCGAGGCACTGTGG - Intergenic
1181809574 22:25395283-25395305 CTCAGACCCCCAGGGCTCCGAGG - Intronic
1182254838 22:29030843-29030865 CTCAGAACTCCGAGGCCCTGCGG - Intronic
1183341667 22:37284977-37284999 CACAAGCCCCACAGGCTCTGCGG - Intronic
1183688463 22:39375290-39375312 CAGGGAACCCTGAGGCTCTGTGG - Intronic
1184715238 22:46278227-46278249 GACCCACCCCTGAGGCTCTGAGG - Intronic
1184856873 22:47151062-47151084 CACAGGCCCCTCAGCCTCTGAGG - Intronic
950098855 3:10345312-10345334 CTAAGGCCCCCGAGCCTCTGTGG + Intronic
950159230 3:10746938-10746960 CACAGCCCCCTGAAGCCCTGTGG - Intergenic
950489398 3:13294564-13294586 CACAGAGCCACGATGCTGTGAGG + Intergenic
950589992 3:13930141-13930163 CACATACCCAGCAGGCTCTGTGG + Intergenic
950743312 3:15066655-15066677 CACAGATCCAGGAGGCTCAGAGG - Intergenic
954489830 3:50893010-50893032 CACAGAACCCTGAGACTCTCAGG + Intronic
955101514 3:55854494-55854516 CAGAGACAACCGCGGCTCTGGGG + Intronic
955363973 3:58296361-58296383 CACACACCCCCTGGGCTCTATGG + Intergenic
956772423 3:72537777-72537799 CCCAGACCCCAGAAGCTCAGGGG - Intergenic
956894571 3:73646736-73646758 CACAGACCCCGAAGGCAGTGAGG - Intergenic
958906267 3:99945352-99945374 CACAGACCTCAGAGAGTCTGAGG - Intronic
960967517 3:123115456-123115478 CTCAGCCCTCCGGGGCTCTGTGG - Intronic
961015381 3:123464509-123464531 CACGGACACCTGTGGCTCTGAGG - Intergenic
961676957 3:128573539-128573561 CCCAGACCCCCGAGTGTCTCTGG + Exonic
964649623 3:158996163-158996185 CACAGACCCCCAAACCTGTGGGG + Intronic
976141630 4:81999279-81999301 CACAGACCAGAGAGACTCTGGGG - Intronic
980119703 4:128715130-128715152 GACAGATCCCTGAGGGTCTGGGG - Intergenic
984553244 4:181185143-181185165 CACAGAGCCCCATGACTCTGTGG + Intergenic
985003962 4:185514001-185514023 CGAACACCCCTGAGGCTCTGGGG - Intronic
988501045 5:31784009-31784031 CCCAGAGCCCTGAGGCCCTGTGG - Intronic
990023645 5:51159624-51159646 CATACACCCCTGAGCCTCTGGGG - Intergenic
990995877 5:61731855-61731877 CCCAGACCCACCAGGTTCTGTGG + Intronic
991764248 5:69957928-69957950 CACAGACCCAGCAGCCTCTGAGG + Intergenic
991783079 5:70160219-70160241 CACAGACCCAGCAGCCTCTGAGG - Intergenic
991843480 5:70833000-70833022 CACAGACCCAGCAGCCTCTGAGG + Intergenic
991875521 5:71160546-71160568 CACAGACCCAGCAGCCTCTGAGG - Intergenic
992419952 5:76593445-76593467 CCCACACCCCTGAGCCTCTGTGG + Intronic
992864195 5:80941177-80941199 CCCAGCCTCCCGAGGATCTGTGG + Intergenic
995571603 5:113487879-113487901 CCCAGGACCCCGAGGCTGTGGGG + Intronic
997722230 5:136088496-136088518 CTCAGGGCCCTGAGGCTCTGGGG + Intergenic
997850708 5:137330219-137330241 CAGAGACCCCCCAGACACTGTGG + Intronic
1000369020 5:160517319-160517341 CACAGAGGCCCCAGGCACTGTGG - Intergenic
1001042045 5:168343056-168343078 TACAAACCCCCCAGGCTCTTAGG - Intronic
1002098233 5:176844566-176844588 CACAGCCCACCGTGGCTCGGAGG + Intronic
1002796278 6:473603-473625 CAGAGACCCCCATGGCTGTGAGG - Intergenic
1006254007 6:32814847-32814869 CTCAGACCCCCAAGGTTCTCAGG - Intronic
1006361733 6:33590645-33590667 CACAGACCCCCGCAGTTCAGAGG - Intergenic
1006438632 6:34040010-34040032 CCCAGACCTCAGCGGCTCTGAGG - Intronic
1006453216 6:34117379-34117401 CAGATACCCCTGAGGCTCTCAGG - Intronic
1010185491 6:73139015-73139037 GCCAGAGCCCTGAGGCTCTGTGG - Intronic
1011025828 6:82868201-82868223 AACAGACCTCTGAGGTTCTGCGG - Intergenic
1018992404 6:168684292-168684314 TTCTGTCCCCCGAGGCTCTGAGG + Intergenic
1019443750 7:1060402-1060424 CACAGAACCCCGGGGCGCTCAGG - Intronic
1019486747 7:1292921-1292943 TACAGACCACCGAAGCCCTGCGG + Intergenic
1019523463 7:1470604-1470626 CGCAGATCTCCGAGGCCCTGAGG - Exonic
1021100783 7:16584800-16584822 CACAGACAGCAGAGGCTTTGTGG + Intergenic
1022802940 7:33792956-33792978 CACAGCCCCAGGAGGCTATGAGG + Intergenic
1023983428 7:45082298-45082320 CCCAGTCCCCAGAGGCTGTGTGG + Exonic
1028035256 7:85973038-85973060 CTCAGCCCCCAGTGGCTCTGAGG + Intergenic
1028888017 7:95956189-95956211 CACAGAGACCAGAGGCTATGTGG + Intronic
1032005880 7:128301672-128301694 CTCAAACCCCAGAGGCTCTGTGG + Exonic
1032391326 7:131556831-131556853 CACAGCCCCCCAAGGCGCGGAGG - Intronic
1033144601 7:138860697-138860719 GAGAGACCCCTGAGGTTCTGAGG - Intronic
1035353493 7:158263592-158263614 CCCAGCACCCAGAGGCTCTGTGG - Intronic
1039471081 8:37814242-37814264 AACAGAACCCCGAGGCGCAGAGG + Intronic
1039525084 8:38207547-38207569 AACATACCCCCCAGGCCCTGGGG + Exonic
1040038739 8:42896378-42896400 CTCTGGCCGCCGAGGCTCTGCGG - Exonic
1042239804 8:66651926-66651948 CACAGACCCCCAAAGTACTGGGG - Intronic
1042536055 8:69860213-69860235 AACATACCCCCCAGGCCCTGGGG - Intergenic
1043266310 8:78271149-78271171 CACAGAGCACCAAGGCTCTGAGG + Intergenic
1043369631 8:79575634-79575656 AACACACCCCTCAGGCTCTGGGG - Intergenic
1050210399 9:3247899-3247921 CACAGTCCCTCCTGGCTCTGAGG + Intronic
1053022084 9:34701759-34701781 CCCAGGCCCCCGAGCCTCGGGGG + Intergenic
1056030930 9:82552379-82552401 CACAGTCCCCAGAGGAACTGGGG + Intergenic
1056379189 9:86041784-86041806 CACAGACCCCCTAGGTTAAGGGG - Intronic
1056690932 9:88808173-88808195 TACAGACCCCCAAGGCTGGGAGG - Intergenic
1056771006 9:89478418-89478440 CACACTCCCCTGAGGCTCTAGGG - Intronic
1057605896 9:96497344-96497366 CAGGGACCCCCGAGGCGCTGGGG + Intronic
1058767850 9:108199076-108199098 CACTGCCACCCGAGGCTGTGAGG - Intergenic
1059634014 9:116154630-116154652 CAGACACCCGCGAGCCTCTGGGG - Intronic
1060527480 9:124328600-124328622 CCCAGACCCCCGAGTGCCTGCGG + Intronic
1060892608 9:127198333-127198355 CTCAGACCTCAGAGGCTCTGAGG - Intronic
1062033064 9:134370784-134370806 CTCAGACCACGGAGGGTCTGGGG + Intronic
1062392822 9:136340727-136340749 CACTGACCCCTGGGCCTCTGAGG - Intronic
1062437646 9:136553689-136553711 CACAGAGCGCCCAGGCTCTAGGG - Intergenic
1062634234 9:137481537-137481559 CACAGCCACCAGAGGCTCAGGGG + Intronic
1062693253 9:137856622-137856644 CACACACCCCAGAGGGTTTGAGG - Intronic
1194197528 X:90914088-90914110 CACTCACCCGCGAGGGTCTGCGG - Intergenic
1196135502 X:112205229-112205251 CACAGAGCTCTGAGGCTCTTTGG + Intergenic
1200086994 X:153611807-153611829 CGCAGTCCCCGGAGGCTGTGGGG - Intergenic
1201063761 Y:10070119-10070141 CCCAGCACCCCTAGGCTCTGGGG - Intergenic